ID: 1093968787

View in Genome Browser
Species Human (GRCh38)
Location 12:25355471-25355493
Sequence ATATAGATATTTTGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093968784_1093968787 5 Left 1093968784 12:25355443-25355465 CCTAGTTTTGATAAAATTATTTT No data
Right 1093968787 12:25355471-25355493 ATATAGATATTTTGGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093968787 Original CRISPR ATATAGATATTTTGGTAAGA GGG Intergenic
No off target data available for this crispr