ID: 1093970517

View in Genome Browser
Species Human (GRCh38)
Location 12:25371431-25371453
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093970517_1093970524 11 Left 1093970517 12:25371431-25371453 CCTGTAGTCCCAGCTACTCAGGA No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data
1093970517_1093970525 14 Left 1093970517 12:25371431-25371453 CCTGTAGTCCCAGCTACTCAGGA No data
Right 1093970525 12:25371468-25371490 AATCCCTTGAGTCCCTGAGGCGG No data
1093970517_1093970527 17 Left 1093970517 12:25371431-25371453 CCTGTAGTCCCAGCTACTCAGGA No data
Right 1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093970517 Original CRISPR TCCTGAGTAGCTGGGACTAC AGG (reversed) Intergenic