ID: 1093970519

View in Genome Browser
Species Human (GRCh38)
Location 12:25371439-25371461
Sequence CCTCAGCCTCCTGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093970519_1093970527 9 Left 1093970519 12:25371439-25371461 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG No data
1093970519_1093970525 6 Left 1093970519 12:25371439-25371461 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1093970525 12:25371468-25371490 AATCCCTTGAGTCCCTGAGGCGG No data
1093970519_1093970524 3 Left 1093970519 12:25371439-25371461 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093970519 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG (reversed) Intergenic