ID: 1093970521

View in Genome Browser
Species Human (GRCh38)
Location 12:25371440-25371462
Sequence ACCTCAGCCTCCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093970521_1093970524 2 Left 1093970521 12:25371440-25371462 CCAGCTACTCAGGAGGCTGAGGT No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data
1093970521_1093970527 8 Left 1093970521 12:25371440-25371462 CCAGCTACTCAGGAGGCTGAGGT No data
Right 1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG No data
1093970521_1093970525 5 Left 1093970521 12:25371440-25371462 CCAGCTACTCAGGAGGCTGAGGT No data
Right 1093970525 12:25371468-25371490 AATCCCTTGAGTCCCTGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093970521 Original CRISPR ACCTCAGCCTCCTGAGTAGC TGG (reversed) Intergenic