ID: 1093970524

View in Genome Browser
Species Human (GRCh38)
Location 12:25371465-25371487
Sequence GAGAATCCCTTGAGTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093970517_1093970524 11 Left 1093970517 12:25371431-25371453 CCTGTAGTCCCAGCTACTCAGGA No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data
1093970521_1093970524 2 Left 1093970521 12:25371440-25371462 CCAGCTACTCAGGAGGCTGAGGT No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data
1093970519_1093970524 3 Left 1093970519 12:25371439-25371461 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data
1093970515_1093970524 29 Left 1093970515 12:25371413-25371435 CCGGTATGGTGGTGGGCACCTGT No data
Right 1093970524 12:25371465-25371487 GAGAATCCCTTGAGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093970524 Original CRISPR GAGAATCCCTTGAGTCCCTG AGG Intergenic