ID: 1093970527

View in Genome Browser
Species Human (GRCh38)
Location 12:25371471-25371493
Sequence CCCTTGAGTCCCTGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093970517_1093970527 17 Left 1093970517 12:25371431-25371453 CCTGTAGTCCCAGCTACTCAGGA No data
Right 1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG No data
1093970521_1093970527 8 Left 1093970521 12:25371440-25371462 CCAGCTACTCAGGAGGCTGAGGT No data
Right 1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG No data
1093970519_1093970527 9 Left 1093970519 12:25371439-25371461 CCCAGCTACTCAGGAGGCTGAGG No data
Right 1093970527 12:25371471-25371493 CCCTTGAGTCCCTGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093970527 Original CRISPR CCCTTGAGTCCCTGAGGCGG AGG Intergenic