ID: 1093977406

View in Genome Browser
Species Human (GRCh38)
Location 12:25438321-25438343
Sequence GGCCAATGGCCTAGTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093977406_1093977411 11 Left 1093977406 12:25438321-25438343 CCTGCACAACTAGGCCATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977406_1093977412 12 Left 1093977406 12:25438321-25438343 CCTGCACAACTAGGCCATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093977406 Original CRISPR GGCCAATGGCCTAGTTGTGC AGG (reversed) Intronic
901149746 1:7093316-7093338 GGCCACTGGCCTAGTTTTCTGGG + Intronic
901879695 1:12186469-12186491 GGTCCATGGCCACGTTGTGCTGG + Intronic
902605567 1:17567251-17567273 GGCCACTGGCCTCTTTCTGCTGG + Intronic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1069631513 10:69899912-69899934 GCCCAAGGGCCTAGATGTTCAGG + Intronic
1070492977 10:76994795-76994817 GGCAAATGTCCTAAATGTGCTGG + Intronic
1070808832 10:79287044-79287066 GGCCCATGTCCTAGGTGTGCTGG - Intronic
1078055236 11:8003806-8003828 GGCCCATGGCTTAGTAGGGCAGG - Intergenic
1078168521 11:8911126-8911148 CGCCAATGGCCCAGCTGCGCCGG + Exonic
1080833851 11:35921459-35921481 GGCAAATTGCCAAGTTGTGAAGG - Intergenic
1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG + Intronic
1087596907 11:100265452-100265474 GGCCCATGACCTAGTGGAGCTGG - Intronic
1088976446 11:114820634-114820656 TCCCAATGGCCTGTTTGTGCAGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1131076666 15:89499511-89499533 GGCAAACGGCCTTCTTGTGCTGG - Intergenic
1135074485 16:19381815-19381837 GGCCAACAGCCTAGTTCTGAAGG - Intergenic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG + Intergenic
1149253071 17:54792538-54792560 GATCAGTGCCCTAGTTGTGCAGG - Intergenic
1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG + Intronic
1154221545 18:12459295-12459317 AGCCCATGCCCTGGTTGTGCAGG + Intronic
1159253396 18:65911417-65911439 TGCCAATGGCCCATTTCTGCTGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164737972 19:30555908-30555930 AGCCAATTGCCTTCTTGTGCTGG - Intronic
926287704 2:11503067-11503089 GACCAATGTTCTAGTTGTGTGGG + Intergenic
935398625 2:102637430-102637452 GATCACTGGCTTAGTTGTGCTGG - Intronic
937459044 2:122069798-122069820 GGCGAATGGCCTGGCTGGGCTGG - Intergenic
941978652 2:171432123-171432145 GCCCAGTGGGCCAGTTGTGCAGG + Intronic
946986080 2:225274978-225275000 GGCCACTGGCCAAGATGTTCTGG - Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1177670929 21:24226066-24226088 TGCCAGTGGCCAAGGTGTGCGGG - Intergenic
1179884850 21:44309525-44309547 GGCCAGTGGCTCAGTTCTGCTGG - Intronic
1180617084 22:17135417-17135439 GGCCAGGGGCCTAGTTGGGGCGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183172525 22:36198719-36198741 GGCAAATATCCTAGTGGTGCAGG + Intronic
1183224210 22:36538163-36538185 GGCCAATGGGCCAGTTGCGGTGG - Intergenic
954972666 3:54664228-54664250 CACCACTGGCCTTGTTGTGCAGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
966978581 3:185108578-185108600 GGCCAATCGCCTAGTTGCTAAGG + Intronic
967771256 3:193335815-193335837 TGCAAGTGGCCTAGTTGAGCTGG - Intronic
975979655 4:80143138-80143160 GTCACATGGCCTAATTGTGCTGG - Intergenic
986184067 5:5420273-5420295 CGCAAATGACCTATTTGTGCTGG - Intergenic
997773385 5:136575226-136575248 GGACAATGGCGTAGTGGTGCAGG + Intergenic
1001247809 5:170118080-170118102 GACCAAAGGCCTAGCTGTGAGGG - Intergenic
1005714222 6:28531806-28531828 GCCCTATGGTCTAGTTGTGTTGG + Exonic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1016613817 6:146024529-146024551 GGCCTATGGCCTCTTTGTTCTGG + Intergenic
1017127790 6:151081749-151081771 GGGCAAGGGTCTAGTTGTGAGGG + Intronic
1019502090 7:1369513-1369535 GGCCAAGGTCCTAGGTGGGCTGG - Intergenic
1021725364 7:23543334-23543356 GGCCAGAGTCCTAGTTGTACAGG - Intergenic
1029686141 7:102149487-102149509 GGGCAATGGCGTAGTGGCGCTGG - Intronic
1032091605 7:128914260-128914282 GGGCACTGGCCTAGCTGTGCTGG + Intergenic
1039153736 8:34532121-34532143 GACCAATGGCATAGATGTGTTGG + Intergenic
1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG + Intronic
1048808786 8:138265917-138265939 GGCCATTAGCCTACTTGAGCAGG - Intronic
1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG + Intronic
1052976472 9:34414377-34414399 GGCCAATTGCCTGGCTCTGCAGG - Intronic
1056324902 9:85469121-85469143 AGCCCATGGCGTAATTGTGCTGG - Intergenic
1056715749 9:89026808-89026830 GTCCAAGGGCCCAGGTGTGCAGG - Intronic
1057407743 9:94788920-94788942 GGCAAATAGCCCAGGTGTGCAGG + Intronic
1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG + Intronic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1062678463 9:137762679-137762701 GGCCAACGGTCCAGATGTGCTGG + Exonic
1187819735 X:23274646-23274668 GGCTAAAGGCCTACTTGTGTGGG - Intergenic