ID: 1093977411

View in Genome Browser
Species Human (GRCh38)
Location 12:25438355-25438377
Sequence ATTTATATATATTTTCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1069
Summary {0: 1, 1: 1, 2: 8, 3: 93, 4: 966}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093977406_1093977411 11 Left 1093977406 12:25438321-25438343 CCTGCACAACTAGGCCATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977403_1093977411 15 Left 1093977403 12:25438317-25438339 CCCGCCTGCACAACTAGGCCATT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977400_1093977411 22 Left 1093977400 12:25438310-25438332 CCAGTTCCCCGCCTGCACAACTA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977402_1093977411 16 Left 1093977402 12:25438316-25438338 CCCCGCCTGCACAACTAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977409_1093977411 -10 Left 1093977409 12:25438342-25438364 CCATTTCCTAGGAATTTATATAT 0: 1
1: 0
2: 1
3: 66
4: 601
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977399_1093977411 26 Left 1093977399 12:25438306-25438328 CCTTCCAGTTCCCCGCCTGCACA 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977408_1093977411 -3 Left 1093977408 12:25438335-25438357 CCATTGGCCATTTCCTAGGAATT 0: 1
1: 0
2: 3
3: 15
4: 245
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966
1093977404_1093977411 14 Left 1093977404 12:25438318-25438340 CCGCCTGCACAACTAGGCCATTG 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG 0: 1
1: 1
2: 8
3: 93
4: 966

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093977411 Original CRISPR ATTTATATATATTTTCACCT TGG Intronic
902418922 1:16262192-16262214 ATGTATATATATTTTAAGATGGG + Intronic
902980572 1:20119745-20119767 ATATATATATATTTTGAGATAGG + Intergenic
903750904 1:25619870-25619892 ATTTATATGTAATTTCACTGGGG - Intronic
904014495 1:27409484-27409506 ATTTAGATTTCTTTCCACCTTGG - Intronic
904954185 1:34269150-34269172 ATATATATATATTTTGTCCTTGG + Intergenic
905501014 1:38436671-38436693 ATTTATTTTTATTCTCAACTTGG - Intergenic
905552365 1:38853448-38853470 ATTTAAAGATACTTTCAGCTGGG + Intronic
905598417 1:39229368-39229390 ATAGATAAATATATTCACCTGGG + Intronic
905935989 1:41824734-41824756 ATATATATATATATTTAACTTGG - Intronic
907682838 1:56579814-56579836 ATTTATATATATTTTTTCTTTGG - Intronic
908208446 1:61874581-61874603 ACTTCTAAATATCTTCACCTTGG + Intronic
908369282 1:63465396-63465418 ATTTATAGATATTTTACCCGTGG + Intronic
908619394 1:65960614-65960636 TTTTATATATATTTTTAGCCTGG - Intronic
908891290 1:68850959-68850981 ATATATATATATATGCACCATGG - Intergenic
908913831 1:69103285-69103307 ATTTAAATATATCTTCTTCTTGG + Intergenic
908988227 1:70052171-70052193 ATTTACATATATTTTCACAAAGG - Intronic
909121942 1:71614250-71614272 ATTTATATATATATAAAACTGGG - Intronic
909173996 1:72331970-72331992 ATTGATATATATTTTCAGTTTGG + Intergenic
909203159 1:72718550-72718572 ATTTATACATCTTTTCATTTGGG - Intergenic
909767884 1:79380523-79380545 ATTTGGATATATTTTCACACTGG + Intergenic
909984634 1:82145531-82145553 ATCTATATAGATTTTCACACTGG - Intergenic
910024753 1:82636774-82636796 ATTTTTAGATATTTCGACCTAGG + Intergenic
910070206 1:83204793-83204815 ATTTATATTTATTTTTAAGTTGG + Intergenic
910773953 1:90856382-90856404 AGTTTTATATAGTTTCATCTGGG + Intergenic
911279700 1:95908620-95908642 AATAATATATAGTTTCACATAGG - Intergenic
911295800 1:96113432-96113454 ATATATACATATTGTCACTTTGG + Intergenic
911370669 1:96991280-96991302 ATTTTTATATATTTTTTGCTGGG + Intergenic
912184231 1:107255474-107255496 CCTTAAATATATTTTCATCTGGG - Intronic
912780177 1:112539141-112539163 ATGTATATATAGGATCACCTGGG + Intronic
912867372 1:113269895-113269917 ATTTATATATAGTTTCATTATGG - Intergenic
913298362 1:117344215-117344237 ATTTATATACATTGTCTCTTTGG - Intergenic
914464199 1:147911461-147911483 ACTAAAATATATTTTTACCTAGG + Intergenic
915009058 1:152667525-152667547 ATGTAGATGTATTGTCACCTGGG + Intergenic
915078592 1:153334476-153334498 ATTTATATATATATACACCAAGG + Intronic
915246690 1:154560434-154560456 ATTTACAAATATTTGCACCTGGG - Intergenic
915764658 1:158350643-158350665 ATTAATATATATTTTTTCTTTGG + Intergenic
916122806 1:161544038-161544060 ATTTATTTATTTTTGCACCTCGG + Intronic
916132707 1:161625482-161625504 ATTTATTTATTTTTGCACCTCGG + Intronic
916282782 1:163071123-163071145 ATATATTTACATTATCACCTTGG + Intronic
916697718 1:167256724-167256746 ATTTATTTATTTTTTCCCCTTGG + Intronic
916713083 1:167429381-167429403 ATATATATATATTTTGAGATAGG + Intergenic
916820012 1:168388978-168389000 TTGTATATATATGTACACCTGGG + Intergenic
917031225 1:170694107-170694129 ATTTGGATATATTTGCACCTGGG - Intronic
917127675 1:171703455-171703477 ATATATATATATATACACATAGG + Exonic
917389488 1:174519175-174519197 ATATATATATATTTACACATGGG - Intronic
917627181 1:176858217-176858239 ATTTATTTATTTTCTCACTTTGG + Intronic
917905912 1:179587034-179587056 AGTTATATTTGTTTTCAGCTTGG + Intergenic
918557360 1:185818842-185818864 ATTTTTATAAACTTTCACTTGGG + Intronic
918683932 1:187391260-187391282 ATTTATATATATTTTCATGGTGG + Intergenic
918723394 1:187884500-187884522 ATTTATTCATATTTTCAGCCTGG + Intergenic
918766726 1:188495977-188495999 ATTTTCTTATATTTGCACCTAGG + Intergenic
918838039 1:189495072-189495094 ATATATATATATATTCATCCAGG - Intergenic
918942657 1:191021779-191021801 ATTTATGTATATTTACATATAGG + Intergenic
919036740 1:192320803-192320825 ATTTTTATATTTTTTCAGCTTGG + Intronic
919196886 1:194297669-194297691 ATCAATATAAATTCTCACCTTGG + Intergenic
919477341 1:198045184-198045206 TATTATATATCTTTTCAGCTGGG + Intergenic
919535722 1:198785548-198785570 ATATAAATATATATTCATCTAGG + Intergenic
919553141 1:199017550-199017572 ATTTATACATGTTTTCTCCTAGG + Intergenic
919631971 1:199968153-199968175 TTTTATGTATATATTCAACTTGG + Intergenic
920225992 1:204439638-204439660 CTATATATATATTTTCACACAGG + Intronic
920886025 1:209928694-209928716 ATATATATATATTTACATATGGG - Intergenic
920937914 1:210453264-210453286 ATTTTTATAAATTTTCTTCTTGG + Intronic
921123312 1:212155453-212155475 ATTTATATTTATTTTACACTGGG - Intergenic
921243593 1:213212983-213213005 ATTTATAAATATTTTCTCTCTGG + Intronic
921335203 1:214078675-214078697 CTTTATATCTTTTTTCCCCTTGG - Intergenic
921565245 1:216709768-216709790 CTTAATTTATATTTTCACCAAGG - Intronic
921865307 1:220082055-220082077 ATATATATATATATTGTCCTTGG - Intronic
921879232 1:220235221-220235243 ATTTAGAGATATTTTTAACTTGG + Intronic
921895169 1:220392196-220392218 ATACATTTATATTGTCACCTAGG + Intergenic
923045011 1:230349364-230349386 ATTTATTTTTATTTTCATTTTGG - Intronic
923058876 1:230452083-230452105 ATTTATTTATTGTCTCACCTTGG - Intergenic
923094691 1:230765700-230765722 ATTGATATTTATTTTCTACTTGG - Intronic
923169459 1:231400303-231400325 GTATATATATATTTTCTCCATGG + Intronic
923218105 1:231868722-231868744 ATATATATATATATTTAGCTGGG + Intronic
923642383 1:235778090-235778112 ATATATATATATATTTAACTGGG - Intronic
923667261 1:236009573-236009595 ATGTAGGTATATTTTCACATAGG + Intronic
924451844 1:244185594-244185616 ATATATATAAAATTTCATCTTGG + Intergenic
924681896 1:246244023-246244045 GTATATATATATTTTAACATGGG + Intronic
924682103 1:246247477-246247499 ATATATATATTTTTTAACATGGG + Intronic
924846652 1:247780991-247781013 ATTTAAAAATATTTTCATATTGG + Intergenic
924879693 1:248146648-248146670 ATATATATATATATACACCATGG - Intergenic
1063777999 10:9286081-9286103 ATTTATATTTATTTTTATTTCGG - Intergenic
1063833183 10:9980362-9980384 CTTTGTAAATATTTTCTCCTAGG - Intergenic
1063955146 10:11258674-11258696 TTATATATACATTTCCACCTTGG - Intronic
1064203926 10:13306786-13306808 ATTTATGTATACTTTCATGTTGG + Intergenic
1064232706 10:13543510-13543532 ATATATATATATATATACCTTGG - Intergenic
1064468722 10:15613271-15613293 ATTTTGTTATATTTTTACCTTGG + Intronic
1064515506 10:16143481-16143503 ATTTGTAAATATTTTCAAATTGG + Intergenic
1064706949 10:18082807-18082829 ATTTGTTTATCTTTTCAGCTTGG + Intergenic
1064933654 10:20655539-20655561 TTTAATAGATATTTTCACCTTGG + Intergenic
1064955130 10:20900104-20900126 TTTAATAGATATTTTCACCTTGG + Intronic
1065296674 10:24282521-24282543 ATGGATATTTATTTTCACTTTGG + Intronic
1065905923 10:30251604-30251626 ATTTATTTATATTTTTTCCTTGG + Intergenic
1066308861 10:34175566-34175588 AGTAAAATATATTTTCACCTGGG + Intronic
1066344798 10:34574123-34574145 ATTTATTTGTATTTTCAGTTAGG + Intronic
1066523237 10:36246506-36246528 ATGTATAAATATTTTCAGATTGG - Intergenic
1066684949 10:37972455-37972477 ACTTCTATATATCTTCACCCAGG + Intronic
1066714347 10:38270553-38270575 ATATATATATATGTTCATCTTGG + Intergenic
1067016624 10:42760942-42760964 ATTTATAGATATTTTTATATAGG - Intergenic
1067781184 10:49208665-49208687 ATTTATACACAGTGTCACCTTGG + Intergenic
1068073010 10:52219709-52219731 ATTTATATGTAAATTCACTTGGG - Intronic
1068268623 10:54689174-54689196 ATTAATATATATGTCCACATAGG + Intronic
1069169643 10:65210194-65210216 ATATATATTTTTTTTCATCTAGG - Intergenic
1069180205 10:65349748-65349770 ATATATATATGATTTCTCCTTGG - Intergenic
1069385176 10:67877563-67877585 TTGTATATAGATTTTGACCTAGG + Intergenic
1069998295 10:72356878-72356900 ATATATATATATATGCACCAAGG + Intergenic
1070054922 10:72925180-72925202 CTATATACATCTTTTCACCTTGG - Intronic
1070578402 10:77698255-77698277 AATTATATATATTTTTAGATGGG + Intergenic
1071114957 10:82207300-82207322 ATAAATATATATTTTCCCTTTGG - Intronic
1071175204 10:82918038-82918060 ATGTATGTATATTTTTTCCTGGG + Intronic
1071213739 10:83374690-83374712 ACATATATATATATTCCCCTTGG + Intergenic
1071248200 10:83787825-83787847 ATTTTTCTAGATTTTCTCCTAGG + Intergenic
1071757933 10:88566219-88566241 ATTTATAAATATTTTTAACTTGG - Intronic
1071840282 10:89463522-89463544 ATTTGCCTATATTTTCACTTAGG - Intronic
1071856703 10:89633128-89633150 ATATATATATATATACACCGTGG - Intronic
1071929200 10:90447135-90447157 CTTGAAATATATTTTCTCCTGGG - Intergenic
1072119532 10:92394333-92394355 ATTTATTTATTTTTTAAACTGGG - Intergenic
1072588745 10:96807161-96807183 ATTTTGATATGTTTTCACTTTGG - Intergenic
1073004067 10:100308241-100308263 CTTTATATACATTTTCTCCCAGG + Intronic
1073507616 10:104013584-104013606 ATTCAGATATATTCTCACCTGGG + Intronic
1073736718 10:106355861-106355883 ATCTATTTATATTTTCATCCTGG - Intergenic
1073832909 10:107407067-107407089 ATTTATATACGTTTTAACTTTGG - Intergenic
1074646861 10:115464213-115464235 AATTAAAGATATATTCACCTGGG + Intronic
1075364419 10:121871686-121871708 ATTTTAATATATTGTCAACTAGG - Intronic
1076110030 10:127853034-127853056 ATATATATATATTTTAAGTTGGG - Intergenic
1076540352 10:131210494-131210516 CTTTCTTTTTATTTTCACCTTGG - Intronic
1076920250 10:133448197-133448219 TTTTACATCTATTTTCACCAGGG - Intergenic
1078459693 11:11504750-11504772 ATATATATATATTTTGAGATGGG - Intronic
1079164391 11:18025540-18025562 AATTAGCTATATTTTCACCTGGG - Intronic
1079634501 11:22718876-22718898 ATTTATATATACATCCACATGGG - Intronic
1079872597 11:25818788-25818810 ATTTGAATATATTTTCACAAAGG + Intergenic
1079890520 11:26047025-26047047 ATTTATATATTTTTTCCAGTTGG - Intergenic
1079918461 11:26400835-26400857 ATATATATATATATTCATCTAGG - Intronic
1080141255 11:28923078-28923100 CTTTATATTTATTTCCACTTAGG + Intergenic
1080188204 11:29517701-29517723 ATTTATTTGTGTGTTCACCTAGG + Intergenic
1080227649 11:29977678-29977700 ATTTTTATATATTTTCCCAAAGG - Intergenic
1080367349 11:31591011-31591033 ATTTGCAAATATTTTCTCCTTGG - Intronic
1080559671 11:33451404-33451426 ATTTATAAATAGTTTCAGGTTGG - Intergenic
1080884262 11:36350897-36350919 ATATATATATATATTTACCATGG - Intronic
1081074582 11:38654648-38654670 ACTTATTTATATTATCACTTTGG - Intergenic
1081836828 11:46162586-46162608 ATGTAAATTTATTTTCTCCTAGG + Intergenic
1081987773 11:47319106-47319128 ATATATATATATATTTTCCTTGG - Intronic
1082623453 11:55454081-55454103 ATTTTTACATGTTTTCACTTAGG + Intergenic
1082819362 11:57533949-57533971 ATTTATTTTTATTTTTACTTAGG + Intergenic
1082860913 11:57855916-57855938 ATATATATATTTTTTAACCTGGG + Intergenic
1083075422 11:60032176-60032198 AATTAGATATCTTTCCACCTGGG - Intergenic
1084368277 11:68717975-68717997 AATTCTAGATATTTTCTCCTGGG - Intronic
1084609112 11:70190328-70190350 ATTTATATATTTTTTGAGATGGG - Intergenic
1085102422 11:73812707-73812729 ATATATATATATTTAGACATGGG - Intronic
1085673590 11:78492992-78493014 TTCTGTATATATTTTTACCTCGG - Intronic
1085867641 11:80313399-80313421 ATATATATATATATACACTTAGG + Intergenic
1085954764 11:81378404-81378426 ATGTATATTTATTTGCAACTTGG - Intergenic
1086081383 11:82906092-82906114 ATTTATTTATTTATTTACCTAGG - Intronic
1086285288 11:85242049-85242071 ATTTATATGGATATTCAACTAGG + Intronic
1086309113 11:85516997-85517019 TTTTATATCTATTTTCATCAGGG - Intronic
1086539560 11:87892007-87892029 ATTTATATATCTTTTATCCCTGG + Intergenic
1087142527 11:94779022-94779044 AATTATATCTATTTTCCACTTGG - Intronic
1087419336 11:97900555-97900577 TTTTATATATCTATTCATCTTGG - Intergenic
1087450551 11:98316350-98316372 ATATATATATATATGCACCAGGG + Intergenic
1087533717 11:99416447-99416469 ATTTATTTTTATTTTCATGTTGG + Intronic
1087912073 11:103765713-103765735 ATATAAATATATTGTCACCCAGG + Intergenic
1088495385 11:110426793-110426815 ATGTATATATATATGGACCTAGG - Intergenic
1091077205 11:132631379-132631401 TTTTATGTATATTTACACCTAGG - Intronic
1091166564 11:133481434-133481456 ATTTATTTATTTTTTTAACTGGG - Intronic
1091499797 12:1005155-1005177 ATCTTTATTTATTTTCACCTGGG + Intronic
1091832435 12:3559495-3559517 ATTTATATGTATTGTCAAGTAGG + Intronic
1092041083 12:5385071-5385093 ATTTGAATATCTGTTCACCTTGG - Intergenic
1092280518 12:7094561-7094583 ATATATATATTTTTTTGCCTTGG + Exonic
1092448729 12:8582541-8582563 AATTACATATATTTTCTCCCAGG + Intergenic
1092921556 12:13236248-13236270 ATATATATATATATTCTCTTGGG + Intergenic
1093171667 12:15868048-15868070 ATTTGCAAATATTTTCTCCTAGG - Intronic
1093220483 12:16414725-16414747 TTTTAAAAATATTTTCAGCTGGG + Intronic
1093482340 12:19617434-19617456 ATTCAAATATATTTTCTCTTAGG - Intronic
1093513459 12:19956707-19956729 ATATATATATATTTTTGCATAGG + Intergenic
1093977411 12:25438355-25438377 ATTTATATATATTTTCACCTTGG + Intronic
1094252173 12:28375104-28375126 ATTTACTAATATTTTGACCTTGG + Intronic
1094579852 12:31724535-31724557 ATATATATATTTTTTTACCATGG + Intronic
1094587781 12:31793845-31793867 ATTTTACTATATTTTAACCTGGG - Intergenic
1094640375 12:32268768-32268790 ATTTATTTTTATTGTCACCCAGG - Intronic
1094686158 12:32717577-32717599 TTTTATATATATATCTACCTAGG - Intronic
1094686160 12:32717610-32717632 TTTTATATATATATCTACCTAGG - Intronic
1094686162 12:32717643-32717665 TTTTATATATATATCTACCTAGG - Intronic
1094686164 12:32717676-32717698 TTTTATATATATATCTACCTAGG - Intronic
1094686166 12:32717709-32717731 TTTTATATATATATCTACCTAGG - Intronic
1094686168 12:32717742-32717764 TTTTATATATATATCTACCTAGG - Intronic
1095145067 12:38717445-38717467 ATATATATATATATACACCATGG + Intronic
1095490436 12:42727841-42727863 ATTTATATCTATCTTCAGCCTGG + Intergenic
1095758072 12:45793632-45793654 ATGTATATATATTGTCCTCTGGG - Intronic
1097072196 12:56363224-56363246 ATATATATATATATACACCCAGG + Intergenic
1097551845 12:61081829-61081851 CTTTTTATTTCTTTTCACCTTGG - Intergenic
1098297551 12:69019128-69019150 ATTTTTATATATGTTCATTTAGG - Intergenic
1098510143 12:71302374-71302396 ATTTGTATATATTTTGAATTTGG - Intronic
1098537670 12:71612975-71612997 ATGTTTTCATATTTTCACCTAGG - Intronic
1098604849 12:72377973-72377995 TTTTATATATATTTTTAATTAGG + Exonic
1098739822 12:74158336-74158358 ATGTATATATACTTTTGCCTGGG - Intergenic
1098811547 12:75100283-75100305 ATTTATAGATTTTCTAACCTTGG + Intronic
1098998447 12:77148776-77148798 TTTCACATATATTTTCCCCTAGG - Intergenic
1099145022 12:79031913-79031935 ACATATATATATTTTCACAAAGG - Intronic
1099345415 12:81493774-81493796 ATATATATATATATACACATTGG + Intronic
1099466139 12:82990195-82990217 ATTTTTACATATTTTCCCTTCGG - Intronic
1099727868 12:86457366-86457388 ATTTATATGTATTTTTTACTAGG - Intronic
1099749523 12:86754987-86755009 ATATATATATATATCAACCTGGG + Intronic
1099750186 12:86763803-86763825 ACTTATAGATCATTTCACCTAGG + Intronic
1099963689 12:89421968-89421990 TTTTATATATATGTTAAACTTGG + Intronic
1100033631 12:90223850-90223872 ATTTATATATATATACACGGTGG + Intergenic
1100359928 12:93867395-93867417 ATATATATATTTTTTAAACTTGG + Intronic
1100599888 12:96104108-96104130 ATATATATATATATTCCCTTTGG + Intergenic
1100710361 12:97249567-97249589 ATATATATATATTTTCTCTATGG - Intergenic
1100736556 12:97541005-97541027 ATATATATATATATACACCTGGG - Intergenic
1100992412 12:100265808-100265830 ATTTACATACATTTTTACATAGG - Intronic
1101105496 12:101436030-101436052 ATTTATATATATTTTTAAGATGG - Intergenic
1101225588 12:102685074-102685096 GTGTATATTTTTTTTCACCTTGG - Intergenic
1101963521 12:109266800-109266822 ATATATATATTTTTTTCCCTTGG - Exonic
1101972130 12:109322431-109322453 ATTTATACATATTTTCAGTGGGG + Intergenic
1102331622 12:112037308-112037330 ATATATATATATATTCAAATTGG + Intronic
1102342240 12:112131374-112131396 AGTTATTTATATTTTGTCCTAGG - Intronic
1102479660 12:113213079-113213101 AATTATATATTTTTTCCCCCTGG + Intronic
1103237835 12:119388559-119388581 GTTTATTTATATTTTCTCTTTGG + Intronic
1105559409 13:21476497-21476519 TTTTATATATATGTACACATAGG + Intergenic
1105574084 13:21633576-21633598 GTTTATATATGTTTTTCCCTAGG + Intergenic
1106066157 13:26352742-26352764 TTTGCTATATATTTTTACCTTGG + Intronic
1106373211 13:29157767-29157789 ATATATATATATCCTAACCTAGG - Intronic
1106421755 13:29591102-29591124 ATATATATATATTTTGAGATAGG - Intronic
1106586119 13:31057659-31057681 ATTTATGTATATTTTTATATGGG + Intergenic
1106586924 13:31065532-31065554 ATTTATTTTTGTTTTCAGCTAGG - Intergenic
1106969294 13:35117849-35117871 ATTTATATTTATTTTCACTTTGG - Intronic
1107190545 13:37579359-37579381 ATAAACATATATTTTCCCCTAGG - Exonic
1107237177 13:38186038-38186060 AATTGTCTATATTTTTACCTTGG + Intergenic
1107274417 13:38661819-38661841 ATTTATTTATTTTTTCTTCTGGG - Intergenic
1107713676 13:43176617-43176639 ATTTAGATAAATTGTCATCTTGG + Intergenic
1107896705 13:44971907-44971929 ATTTATTTTTTTTTTAACCTTGG + Intronic
1107924487 13:45245656-45245678 ATATATATATATTCACACCATGG - Intronic
1108660275 13:52578941-52578963 ATATATATATTTATTCACTTTGG + Intergenic
1108713129 13:53053721-53053743 ATTAATATACAGTCTCACCTGGG - Intergenic
1108999968 13:56787590-56787612 ATATATATATTTTTTCATTTAGG + Intergenic
1109062923 13:57642112-57642134 AATTATATTTATCTTTACCTTGG - Intronic
1109075365 13:57827604-57827626 ATTTATCTATCTTTTCTCATGGG - Intergenic
1109313137 13:60718870-60718892 ATTTATATATATTTACACTTGGG + Intergenic
1109330925 13:60928725-60928747 ATATATATATATATACACATGGG - Intergenic
1109493591 13:63137603-63137625 ATTTTTATATATCTCCAACTTGG - Intergenic
1109699591 13:66008646-66008668 ATATATATATACTTTAACCTGGG + Intergenic
1109842427 13:67936979-67937001 ATATATATATATATTCCTCTGGG + Intergenic
1109884104 13:68520331-68520353 CTTTATATATATTTTTAACATGG - Intergenic
1110426906 13:75377706-75377728 ATATATATATATTTTCTGATTGG + Intronic
1110462543 13:75761065-75761087 ATATATATATATTTAAACTTAGG + Intronic
1110496760 13:76176825-76176847 ATATATATATATTTGAACATGGG + Intergenic
1110630419 13:77699245-77699267 ATTTATTTATTTTTTTACCTAGG + Intronic
1110743903 13:79030549-79030571 AAATATATATTTTTTCACCTAGG + Intergenic
1111081753 13:83320661-83320683 ATTTATATCTATGTGGACCTGGG + Intergenic
1111141327 13:84123030-84123052 ATATATATATATATACACATTGG + Intergenic
1111478085 13:88781212-88781234 ATATATATATATTTCAACATAGG + Intergenic
1111930605 13:94509367-94509389 ATTTCCATATCTTTTCTCCTGGG + Intergenic
1112790576 13:102998228-102998250 ATATATATATATTTGTACTTTGG + Intergenic
1112903925 13:104393911-104393933 ATATATATATATTTTATCTTTGG + Intergenic
1113245461 13:108390020-108390042 ATTGACATATATTTTCAGGTAGG + Intergenic
1113319331 13:109217501-109217523 ATATATATATATATTAAGCTGGG + Intergenic
1113360820 13:109629741-109629763 ATTTATTTAAATTTTCTTCTAGG - Intergenic
1113736443 13:112681804-112681826 ATATATATATATTTTTAGCCGGG - Intronic
1113980868 13:114274271-114274293 ATTTATATATTTTTTGACACAGG + Intergenic
1114185604 14:20399539-20399561 ATTTATATTTATTTTTGGCTGGG + Intronic
1114937904 14:27567109-27567131 ATTAATTTATCTTTTCATCTTGG + Intergenic
1115011295 14:28548830-28548852 AAATATATATATTTTCACTATGG - Intergenic
1115514512 14:34172159-34172181 ATTTTTCTATTTTTTCTCCTTGG + Intronic
1115709480 14:36034553-36034575 ATATATATATATATACACTTGGG - Intergenic
1115859631 14:37669593-37669615 ATCAATATATATGTTCATCTAGG + Intronic
1116067453 14:40002154-40002176 ATTTTTATGAATTTTCACCATGG - Intergenic
1116243263 14:42374869-42374891 ATTTATATATACTTTAAAATAGG - Intergenic
1116378569 14:44234134-44234156 TTTTATGTATATTTTCTTCTAGG - Intergenic
1116536605 14:46039723-46039745 ATTTATCTATGTTTTCTTCTAGG + Intergenic
1116615119 14:47126191-47126213 ATTTATATATATCTTTAACCTGG - Intronic
1116631799 14:47345145-47345167 TTTAATATATATTTTTAGCTAGG + Intronic
1117266900 14:54098536-54098558 ATTTGTAAATATTTTCTCCTTGG - Intergenic
1117692487 14:58322263-58322285 ATTTATATACATTATCGGCTGGG - Intronic
1117770871 14:59133587-59133609 GTTTATATATTTTTTCTTCTTGG + Intergenic
1117830973 14:59749924-59749946 ATATATATATATTTGAACCAAGG - Intronic
1118529175 14:66683319-66683341 ATATATATATATTTCCACATTGG - Intronic
1118666128 14:68072146-68072168 TTTTATATATATTTTTTTCTAGG + Intronic
1118984426 14:70741540-70741562 ATTTCTTTATATTTTCCCCAAGG + Intronic
1119040217 14:71268084-71268106 ATTTACATATATTTTATGCTAGG + Intergenic
1119456564 14:74761058-74761080 ATATATATATATATACACATGGG - Intergenic
1119909806 14:78339224-78339246 TTTTAAATATATTTTCGCATGGG + Intronic
1120002198 14:79315077-79315099 AATTAGATACATTATCACCTGGG - Intronic
1120129774 14:80792359-80792381 TTATTTATATATTTTCAACTAGG - Intronic
1120286740 14:82511960-82511982 ATATATATATATTTTAACATGGG + Intergenic
1120347983 14:83314616-83314638 ACTAATATATATATGCACCTGGG + Intergenic
1120385029 14:83833963-83833985 ATATAGATATATATTTACCTTGG - Intergenic
1120413560 14:84191068-84191090 ATGTATATATTTTTCCACTTAGG - Intergenic
1120471661 14:84933348-84933370 TGTTATATATAATTTAACCTGGG - Intergenic
1120825011 14:88946817-88946839 ATATATATACATTTGTACCTAGG - Intergenic
1120912865 14:89683496-89683518 ATTTATATATTTTGTAACCTAGG - Intergenic
1121966165 14:98307806-98307828 ATATATATATATTTTAATCCAGG + Intergenic
1124260379 15:28184183-28184205 ATATATATATATTTTGAGATAGG - Intronic
1124413590 15:29456655-29456677 GTTTATACATATTTTCTCCAGGG - Intronic
1124506470 15:30280389-30280411 GTTTATAAATATTTTCTCCCAGG - Intergenic
1124737087 15:32258247-32258269 GTTTATAAATATTTTCTCCCAGG + Intergenic
1125254813 15:37751334-37751356 ATTTATTTTTATTTTCAACCCGG - Intergenic
1125296996 15:38213977-38213999 ATTGGTATATATTTTTAACTTGG - Intergenic
1125383273 15:39110335-39110357 CTTTATATACATCTTCTCCTGGG + Intergenic
1125545966 15:40505467-40505489 ATATATAAAGATTTTCAGCTGGG + Intergenic
1126359700 15:47833737-47833759 GTTTTTACATATTTTCACTTTGG - Intergenic
1126455678 15:48859472-48859494 ATTTATAGATATTCTTAACTGGG - Intronic
1126498864 15:49322592-49322614 ATCAATACATATTTTCACATGGG + Intronic
1127000337 15:54496599-54496621 ATATATATATATGTACACCATGG + Intronic
1127513009 15:59661708-59661730 AATCACATATACTTTCACCTTGG + Exonic
1127677237 15:61252485-61252507 ATGTATGTATTTTTTCACTTTGG + Intergenic
1128190051 15:65684531-65684553 ATTTAGATCTATTTTTAACTTGG + Intronic
1128834225 15:70796195-70796217 ACATATATATATGTTTACCTAGG - Intergenic
1129073868 15:72974969-72974991 ATTTATCTAGATTTTCCCATTGG - Intergenic
1129305159 15:74655409-74655431 ATTCAGATCTATTTTCACTTTGG - Intronic
1129782462 15:78281971-78281993 TTATAAATAGATTTTCACCTAGG - Exonic
1129813697 15:78532824-78532846 ATTTACCTTTATTTTCATCTAGG - Intronic
1130000314 15:80040481-80040503 ATGTATATATATTTACAAATAGG + Intergenic
1131240277 15:90735228-90735250 ATATATATATATATTAACTTAGG - Intronic
1131768241 15:95704524-95704546 AATTATATTAATTTTCTCCTTGG + Intergenic
1133655895 16:7863384-7863406 ATATATATATATATACACCATGG - Intergenic
1134293523 16:12923646-12923668 TATTATATATATTTTCAAATAGG - Intronic
1134506697 16:14813557-14813579 ATATATATATATTTTTACCATGG + Intronic
1134994370 16:18727897-18727919 ATATATATATATATTTAGCTGGG - Intergenic
1135506855 16:23045622-23045644 ATATATATATATATACACCATGG + Intergenic
1135782885 16:25321507-25321529 ATTTATATATTGTTTTGCCTTGG - Intergenic
1135855538 16:26006787-26006809 AATTATTTATATCTACACCTTGG + Intronic
1135934149 16:26765131-26765153 AATTATATAAAGTTTCTCCTCGG + Intergenic
1136171514 16:28492633-28492655 ATATATATATATTTGTACCTTGG - Intronic
1137291351 16:47054188-47054210 ATTTATATATATTTTTTTGTAGG + Intergenic
1138310652 16:56020799-56020821 TTATATATAAATTTTCCCCTGGG + Intergenic
1138898752 16:61243253-61243275 GTATATATCTATTTTCACATTGG - Intergenic
1139006680 16:62580701-62580723 TTTTATATCTATTTACATCTAGG - Intergenic
1139401186 16:66683203-66683225 ATATATATAAATTTTCCCCATGG + Intronic
1139692530 16:68650286-68650308 ATATATATATTTTTTCCCCAAGG - Intronic
1140229425 16:73105449-73105471 ATATATATATTTTTTCCCCCAGG + Intergenic
1140563944 16:76018765-76018787 ATGTATATATATATTTACATTGG - Intergenic
1140987753 16:80175095-80175117 ATATATATATATTGTCAGCTTGG + Intergenic
1141377044 16:83540994-83541016 ATTTCTACATCTTTTCACCCTGG - Intronic
1141926919 16:87175882-87175904 ATTTATATTTATTTTGAGATCGG + Intronic
1144392535 17:14808148-14808170 ATTTATAAATATTTTGGACTGGG - Intergenic
1144419312 17:15081716-15081738 TTTTATGTTTATTTTCACCATGG - Intergenic
1144528795 17:16015919-16015941 TTTTATTTATAGTTTCTCCTTGG + Intronic
1146111356 17:30092734-30092756 ATTTATATAGATTTTAAAATAGG - Intronic
1146434638 17:32833035-32833057 ATTAATTTATATTTCCAGCTTGG + Intronic
1147123128 17:38347847-38347869 ATATATATATATATTTACCTGGG - Intergenic
1147296101 17:39483812-39483834 ATTTATAAATATTTACGCCAGGG - Intronic
1147463668 17:40593212-40593234 ATATATATATATTTTTAATTTGG - Intergenic
1147811967 17:43177739-43177761 TTTTATGTATATTTTTACCTGGG + Intronic
1148164838 17:45476204-45476226 ATATATATATATTTTGAGATTGG + Intronic
1148374737 17:47132980-47133002 ATATATATATATATGCGCCTGGG - Intronic
1148519280 17:48254495-48254517 ATCTATATATATGTGCACTTGGG - Intronic
1148803260 17:50246771-50246793 TTTTAAAGATATTTTCACTTGGG + Intergenic
1149085723 17:52713790-52713812 ATTAATATATATTTTAACAAGGG - Intergenic
1149229530 17:54517591-54517613 TTTTTTATTCATTTTCACCTTGG + Intergenic
1149289667 17:55205724-55205746 ATTTATATATATTTTTGGCAAGG + Intergenic
1149691433 17:58580300-58580322 ATATATATATAATTTCAGCTAGG - Intronic
1149933082 17:60775543-60775565 ATGTATATATAGGTTTACCTTGG + Intronic
1149954552 17:61033976-61033998 ATTGATATGTAATTCCACCTTGG + Intronic
1150028782 17:61708804-61708826 ATTTGTAGATATTTTCTCATGGG + Intronic
1150101156 17:62424513-62424535 TTTTATATATAGTTTTACTTTGG + Intronic
1150603881 17:66675089-66675111 ATTAATATATCTTTTTAACTGGG + Intronic
1150870391 17:68902810-68902832 GTTTTGATATATTTTCACCATGG + Exonic
1150885126 17:69076437-69076459 ATTTGTATCTATATTCACCAGGG + Intergenic
1150892065 17:69163512-69163534 ACTTTTATACATTTTTACCTGGG - Intronic
1150969614 17:70012095-70012117 AATTGTAAATATTTTCTCCTGGG + Intergenic
1151070446 17:71204475-71204497 ATTTGGATATTTTTTCATCTTGG + Intergenic
1151075539 17:71268125-71268147 ATATATATATATATTTACATAGG + Intergenic
1151234283 17:72707486-72707508 ATGTATACATATTCTCACTTGGG - Intronic
1153149480 18:2074474-2074496 ATATACATATATGTTCACATAGG - Intergenic
1153172665 18:2333833-2333855 ATATATATATATATTTGCCTGGG - Intergenic
1153338823 18:3953169-3953191 ATTTAAAAATATTTTCCCTTTGG - Intronic
1153660585 18:7322209-7322231 ACTTATACTTATTTTAACCTGGG + Intergenic
1153864643 18:9252995-9253017 ATTTATATATATAATTACCCAGG - Intronic
1154123551 18:11670700-11670722 ATTAATATATTTTATCACTTTGG + Intergenic
1154179288 18:12117420-12117442 TTTTATTTATTTTTTCAACTGGG + Intronic
1154220368 18:12447805-12447827 ATGTATATAAATATGCACCTAGG - Exonic
1154466856 18:14653441-14653463 ATATATATATATTTTTCCATTGG + Intergenic
1154929849 18:20981717-20981739 ATTTATGTATTTTTTTGCCTAGG - Intronic
1154942285 18:21126658-21126680 TTTTATATATGTATACACCTGGG + Intergenic
1155090642 18:22506116-22506138 ATTGATAAATATTTTTACATAGG - Intergenic
1155180805 18:23344536-23344558 ATTTGCAGATATTTTCTCCTAGG + Intronic
1155586025 18:27366404-27366426 ATTTATATATATTTGTGTCTAGG - Intergenic
1155721537 18:29019109-29019131 ATTTGTATATTTGTTAACCTGGG + Intergenic
1156027593 18:32673094-32673116 ATATATATATATTTTTACAACGG + Exonic
1156183732 18:34637443-34637465 ATTTATATATATTCTCCTTTTGG - Intronic
1156931248 18:42646719-42646741 ATTAATATATATTTTAACAATGG + Intergenic
1157348540 18:46863325-46863347 ATATATATATTTTTTCAGATGGG + Intronic
1157379637 18:47201884-47201906 AATTATATGTATATTCATCTTGG + Intergenic
1157823309 18:50789846-50789868 ATATATATATATTTAGACATGGG + Intergenic
1158297677 18:56016458-56016480 ATATATATATATATGCACCATGG - Intergenic
1158376028 18:56868390-56868412 CTTAAAACATATTTTCACCTGGG - Intronic
1158585065 18:58725715-58725737 TCTTATTGATATTTTCACCTTGG + Intronic
1158738924 18:60116847-60116869 ATATATATATATATGCACATAGG - Intergenic
1158791075 18:60781309-60781331 ATATATTTATTTTTTCAACTTGG - Intergenic
1158816897 18:61111254-61111276 ATTTATGCAAGTTTTCACCTGGG + Intergenic
1159185010 18:64958896-64958918 ATATAAATATATTTTAACTTAGG + Intergenic
1159503507 18:69304638-69304660 ATTTATTTGTATTTTCATATGGG + Intergenic
1159691608 18:71495203-71495225 ATTTATATATTGTATCAGCTTGG - Intergenic
1159740536 18:72163317-72163339 AAATATATAAATTTTCACCCTGG - Intergenic
1159778919 18:72638416-72638438 TTTTATATCTAATTTCACTTAGG + Intronic
1161753036 19:6110996-6111018 ATATATTTAAATTTTCAGCTGGG - Intronic
1162513063 19:11131423-11131445 TTTTATATATTTATTCATCTGGG + Exonic
1164281527 19:23773095-23773117 ATATATATATATTTTTATTTTGG + Intronic
1165082721 19:33318597-33318619 ATATATATATAGTTTTACTTTGG - Intergenic
1165298804 19:34953670-34953692 ATCTACATATAATATCACCTGGG - Intergenic
1166060876 19:40324681-40324703 ATATATATATATTTAGACATGGG - Intronic
1166233932 19:41442479-41442501 ATATGTATATATATGCACCTTGG + Intergenic
1168279325 19:55295961-55295983 ATATATATATATTTTTAGATAGG - Intronic
1168619018 19:57862143-57862165 ATCTATATGTATTGTCACTTTGG - Exonic
924965656 2:74039-74061 TTTTAAACATATTTCCACCTGGG - Intergenic
925706524 2:6689610-6689632 ATATATATATATATACACCATGG + Intergenic
925758248 2:7156052-7156074 ATTTATAAATGTTTTTACCAAGG - Intergenic
926016515 2:9457689-9457711 ATTTATATACAATTCTACCTTGG - Intronic
926035685 2:9633703-9633725 ATTTATATGTGATTTGACCTTGG + Intergenic
926646511 2:15295521-15295543 TTTTATATATATTGTCTCTTAGG - Intronic
926783669 2:16499143-16499165 ATTTATTTGTTTATTCACCTAGG - Intergenic
926926318 2:17991759-17991781 ATATATATATATTTGCAAGTGGG + Intronic
928766941 2:34658157-34658179 ATTTACATATATTTTCATCATGG - Intergenic
928825704 2:35418845-35418867 ATATATATATATATACACCATGG + Intergenic
928851405 2:35751548-35751570 ATATTTATATATTTTCTTCTAGG - Intergenic
929187834 2:39113526-39113548 ATTTATTTATTTTTGCACCATGG - Intronic
929252395 2:39773632-39773654 AAATATATATATTTCCCCCTGGG + Intronic
929300318 2:40296833-40296855 ATTAACCTATATTTTCACCCAGG + Intronic
929346651 2:40891949-40891971 ATTTATATGTATTTTTTTCTGGG - Intergenic
929406095 2:41643074-41643096 ATTGATATATATGTTTACTTTGG - Intergenic
929951895 2:46417844-46417866 TTTTACATATATGTTCATCTGGG - Intergenic
930159563 2:48140436-48140458 ATATATATATATATACACCATGG - Intergenic
930360016 2:50366225-50366247 TTTTATATATTTTTTAATCTGGG - Intronic
930426014 2:51213585-51213607 AAGTATATATATTTTCCCCTGGG + Intergenic
930798322 2:55416484-55416506 ATATGTATATATTTTCTTCTAGG + Intronic
930889121 2:56362425-56362447 ATATATATATATTTTAACTATGG + Intronic
930897329 2:56461615-56461637 ATATATATATATTTTTCCTTTGG + Intergenic
931009583 2:57894203-57894225 ATATATATATATATTCATTTTGG + Intergenic
931076818 2:58724679-58724701 ATATATATATAATTTCAACTGGG + Intergenic
931255800 2:60571043-60571065 TTTTTTTTATATTATCACCTTGG + Intergenic
931918874 2:66990640-66990662 CTGTATATTTACTTTCACCTTGG + Intergenic
932644426 2:73486703-73486725 TTTTATATATATTTTCCAGTGGG + Intronic
933048952 2:77577356-77577378 ATATATATATATATGCACCATGG + Intronic
933051467 2:77608050-77608072 ATTTGTATATATATTCACTATGG - Intergenic
933128291 2:78638824-78638846 ATTTCTCTATATTTTTACATAGG - Intergenic
933135958 2:78735986-78736008 ATTTATATATTGTTTCAATTAGG + Intergenic
933245808 2:79973559-79973581 TTTTCTACTTATTTTCACCTGGG - Intronic
935058113 2:99585290-99585312 GTTTATATATATATTCAAGTTGG + Intronic
935835173 2:107043190-107043212 ATTTATTTCTATTTTCATTTGGG - Intergenic
935864070 2:107366182-107366204 ATTTATATATATATACACACTGG - Intergenic
936619249 2:114077894-114077916 ATTAATATATAGTTTCCTCTGGG - Intergenic
936680150 2:114760542-114760564 ATATATATATATATTTTCCTAGG + Intronic
936819814 2:116506640-116506662 TTTTGTATATATTTTCATCAAGG + Intergenic
936862194 2:117031367-117031389 ATTTTTTTTTATTTTGACCTTGG - Intergenic
937148567 2:119669471-119669493 ATATATATATATTTTTTTCTGGG + Intergenic
937165806 2:119815786-119815808 ATTTAGAAAGATTTTCAGCTTGG + Intronic
937817394 2:126266942-126266964 ATGTATATATATATACACCGTGG - Intergenic
937859066 2:126694105-126694127 ATGTATATATATATTTACCCAGG - Intronic
938616166 2:133001174-133001196 ATTGATATATATGTACACCTTGG + Intronic
938712400 2:133986769-133986791 CTTTATATATATTTTCATGAGGG + Intergenic
938833551 2:135076640-135076662 GTTTATATATATTTTTACTGTGG + Intronic
939034444 2:137113745-137113767 ATTGTTATTTATATTCACCTAGG + Intronic
939059243 2:137400050-137400072 ATAAATATATCTTATCACCTTGG + Intronic
939384153 2:141475069-141475091 ATTTAAATATATTAGCACTTGGG + Intronic
939438512 2:142210423-142210445 ATTTACATGTATTTTCATGTGGG - Intergenic
939561536 2:143738094-143738116 ATATATATATTTTTTAACTTGGG + Intronic
939624354 2:144458709-144458731 ATTTATGCATACTTTCACTTTGG + Intronic
939768437 2:146283565-146283587 ATGTATATATATTTAGAGCTGGG - Intergenic
939926557 2:148181664-148181686 CTTTATATATTTTTTCATTTGGG + Intronic
939981203 2:148783837-148783859 ACTTATACACATTTTCCCCTTGG - Intronic
940275718 2:151938549-151938571 ATTCATTTCTACTTTCACCTAGG + Intronic
940395114 2:153180445-153180467 ATTTGCATATATGTTCACCAAGG + Intergenic
940552579 2:155179849-155179871 GTTGCTATATAGTTTCACCTTGG - Intergenic
940576595 2:155514145-155514167 ATTTATATTTATTTTCTACTAGG + Intergenic
940796377 2:158083785-158083807 ATGTATATATATATACACCATGG - Intronic
940914930 2:159243738-159243760 ATTTATGTATACCTTCTCCTAGG + Intronic
941316699 2:164002269-164002291 ATTTAAGAATATTTTCAACTTGG + Intergenic
941504511 2:166325244-166325266 ATTTATGTCTATTATCACTTAGG - Intronic
941598768 2:167512640-167512662 ATATATATATATTTTGAGATAGG + Intergenic
941771184 2:169347993-169348015 ATTTGTATATGTTGTCACCATGG - Intronic
941788457 2:169524072-169524094 AGTTATATTTACTTTCAGCTTGG - Intronic
941821496 2:169848514-169848536 ATTTATATTTAAGTTCACTTAGG + Intronic
941948175 2:171123031-171123053 ATTTATTTATTTTTTCATATAGG - Intronic
942075550 2:172354126-172354148 ATATATATATATTTTGTCATTGG + Intergenic
942148437 2:173050103-173050125 TTTTAAATACATTTTCCCCTTGG - Intronic
942885181 2:180914711-180914733 AATTATATATATTTCCACAATGG - Intergenic
942891722 2:180998001-180998023 ATTTCTTTATATTTTCATCTCGG + Intronic
942951861 2:181730374-181730396 ATCTTTATATATTCTCACCTTGG + Intergenic
942951963 2:181731580-181731602 ATTTGTCTATATTTTCCCCATGG + Intergenic
943045741 2:182860311-182860333 AATAATATATATTTTCATTTAGG - Intronic
943724361 2:191237619-191237641 ATTTATTTATGTTTTCAGTTGGG + Intergenic
943977412 2:194502052-194502074 ATTAATGTATCTTTTCATCTTGG - Intergenic
944587987 2:201189617-201189639 ATTTATATATATTTTGTAATGGG - Intronic
944682016 2:202085749-202085771 ATTTACATATATTTTTGCTTAGG - Intronic
944794057 2:203164244-203164266 ATATATATATATTTTTAGATGGG - Intronic
944890016 2:204107864-204107886 ATTTATAAATATTTTCTGATTGG - Intergenic
946065611 2:216984858-216984880 ATTGGTATATATTTTCAGCAAGG - Intergenic
946263103 2:218513104-218513126 ATATATATATATTAACTCCTGGG + Intronic
946544441 2:220722231-220722253 ATATATATATATATACACCATGG - Intergenic
946592130 2:221262374-221262396 ATTTATCAGTAGTTTCACCTAGG - Intergenic
947303629 2:228718550-228718572 ATTTATTTATTTTTTCAGATTGG + Intergenic
949011556 2:241682388-241682410 TTTTATACATATTTTCTCCTAGG - Intronic
1169040331 20:2489038-2489060 ATTTATATATATTTTGAGACAGG - Intronic
1169887889 20:10421782-10421804 ATATATATATATTTTAAATTTGG + Intronic
1169904068 20:10582590-10582612 ATAAATCTATATTTTCAACTTGG + Intronic
1169969741 20:11256582-11256604 ATATATATATATATACACCATGG - Intergenic
1170290522 20:14763946-14763968 ATATGTATATACTTTCCCCTTGG + Intronic
1170320868 20:15096437-15096459 ATTTATATATATATTAGCATGGG - Intronic
1170528768 20:17268026-17268048 ATATATATATATATACACATTGG - Intronic
1170871035 20:20206758-20206780 ATATATATATGTTTTCATTTGGG + Intronic
1171170753 20:23013300-23013322 ATTTATATACATTTTTATATAGG - Intergenic
1172275923 20:33679236-33679258 CTTTATATATTTATTCATCTGGG - Intronic
1172339913 20:34148905-34148927 ATTTATTTATATTTTTATCCTGG - Intergenic
1172397089 20:34615908-34615930 ATGTGTTTATATTTTCAACTGGG + Intronic
1172513709 20:35517874-35517896 ATTTTTATATTTTTTCGCTTAGG - Exonic
1172551944 20:35807661-35807683 ATATATATATTTTTTCTCTTTGG + Intronic
1172710156 20:36915763-36915785 TTTTATACAGATTTTCAACTAGG + Intronic
1173351075 20:42246146-42246168 ATTGATATATATATGCAGCTGGG + Intronic
1173409908 20:42801069-42801091 ATTTATTTATATATTTATCTTGG - Intronic
1173603482 20:44312373-44312395 TTCTAAATTTATTTTCACCTGGG + Intergenic
1173971670 20:47157708-47157730 ATTTATTTTTATTTCCACTTGGG - Intronic
1173985158 20:47255473-47255495 ATATATTTATATCTCCACCTCGG - Intronic
1174017359 20:47499746-47499768 ATATATATATATTTCCACCAGGG - Intergenic
1174972125 20:55287566-55287588 TTTTATGTATATTTCCACCACGG + Intergenic
1176691859 21:9921902-9921924 ATTTTTTAATATTATCACCTTGG - Intergenic
1177128138 21:17221958-17221980 ATATATATATATATACACCATGG + Intergenic
1177142260 21:17369897-17369919 ATATATATATATTTTCATTTGGG - Intergenic
1177189757 21:17837831-17837853 AATTTTAGATATTTTTACCTGGG - Intergenic
1177216380 21:18134918-18134940 TTTTATATGAACTTTCACCTTGG - Intronic
1177346719 21:19882791-19882813 ATTTAAATATGCTTTCAGCTAGG + Intergenic
1177399816 21:20588090-20588112 ATATATATATATATACACCCGGG + Intergenic
1177465661 21:21476202-21476224 ATTTATTTATATTTATACCCTGG + Intronic
1177722370 21:24924993-24925015 TTTTATAAATATTTTCTTCTAGG + Intergenic
1177885483 21:26741222-26741244 ATCTATAGATATTCTCATCTTGG + Intergenic
1177922705 21:27172667-27172689 CTTTCTATATACTTTCAACTTGG - Intergenic
1178196605 21:30352113-30352135 ATTTAAATATATATTCACTATGG + Intronic
1178316657 21:31572043-31572065 TTTTCTATATATTTTCTCTTAGG - Intergenic
1178517582 21:33261868-33261890 ATTTATATATTTTTAGAGCTAGG - Intronic
1179255615 21:39712919-39712941 ATCTATATGTGTTTTAACCTCGG + Intergenic
1180353839 22:11823557-11823579 ATATATATATATCAGCACCTCGG - Intergenic
1180384409 22:12168802-12168824 ATATATATATATCAGCACCTCGG + Intergenic
1180487284 22:15814387-15814409 ATTTATAGATGTTTTTACATAGG + Intergenic
1180624474 22:17184973-17184995 ATATATATATATTTTGACATGGG - Intronic
1181012334 22:20049030-20049052 ATTGTTATATATTTTCCTCTGGG - Intronic
1181090641 22:20470186-20470208 ATATATATATAATATCAGCTAGG + Intronic
1181154606 22:20911477-20911499 ATATATATATATTTTTATCATGG - Intergenic
1182811425 22:33120131-33120153 ATGTATATATATTTACTCTTAGG - Intergenic
1182959356 22:34457549-34457571 ATGTAGATATATTTTCATGTCGG - Intergenic
1183134994 22:35878754-35878776 TTTTATTTATATTGTCACCCAGG + Intronic
949123029 3:410942-410964 ATTTATATAGATGATCACGTCGG - Intergenic
949389878 3:3548565-3548587 ATTTATATATAATTTTATTTTGG + Intergenic
949748190 3:7319908-7319930 TTTTATATATGTATTCACCAAGG + Intronic
949805366 3:7949633-7949655 ATTGACAGCTATTTTCACCTTGG - Intergenic
951072020 3:18340254-18340276 ATTTATATATATTTTATGGTAGG - Intronic
951134670 3:19091025-19091047 ATTCATATATCATTTCTCCTGGG - Intergenic
951330390 3:21360950-21360972 ATATATATATATTCTCCCTTAGG - Intergenic
951581409 3:24168497-24168519 ATATATATATATATGCGCCTAGG + Intronic
951669407 3:25163494-25163516 ATATATATATATTTTGAGATAGG - Intergenic
951802813 3:26615347-26615369 ATATATATATATCTCCACATGGG + Intergenic
951903765 3:27682839-27682861 ATTTATTTATTTTTTTACATTGG - Intergenic
952035966 3:29201973-29201995 ATGTGTATATATTTTCACACAGG - Intergenic
952121321 3:30248083-30248105 ATATATATATATATTTAGCTAGG + Intergenic
952471713 3:33661022-33661044 ATTGATATATTTTTCTACCTGGG + Intronic
952477201 3:33722587-33722609 ATTTATTTATATTTTCATTTAGG + Intergenic
952539381 3:34351455-34351477 AGTTATAAATATATTCACCCTGG + Intergenic
952576005 3:34775046-34775068 ATTAAAATATATTTTAACTTTGG - Intergenic
953318767 3:41953574-41953596 ATATATATATTTTTTAAGCTAGG + Intronic
953519407 3:43627041-43627063 AATTATGTAAATTATCACCTTGG - Intronic
953665808 3:44925667-44925689 TCTTATCTATATTTTAACCTGGG - Exonic
954457349 3:50607092-50607114 ATTTATTTATTTATTCTCCTTGG - Exonic
954547540 3:51451255-51451277 ATATATATATATTTACAGATGGG + Intronic
955126895 3:56121753-56121775 GTGTATATATATTTTAAACTAGG + Intronic
955804034 3:62715419-62715441 ATTTATATATATTTTTGCTGGGG + Intronic
956490406 3:69765435-69765457 AATTATAGATATTTCCATCTTGG + Intronic
956815641 3:72905827-72905849 ATTTATTTTTATTTTCAGATTGG - Intronic
957490804 3:80924370-80924392 ATTTATTTATTTTTTCAACATGG - Intergenic
957646095 3:82930013-82930035 ATATATATATATTTGCATTTTGG - Intergenic
957729210 3:84110814-84110836 ATTTATATATTTTTTCAAATAGG + Intergenic
957798278 3:85040811-85040833 ATTTATATATTCTTTCTTCTGGG - Intronic
957828892 3:85489001-85489023 ATTTATTTATATATTTTCCTGGG + Intronic
957927310 3:86831063-86831085 ATATATATATATTTTTCCTTTGG + Intergenic
957979946 3:87495709-87495731 ATTTCTATAAATTTTCACTCTGG - Intergenic
958428541 3:94008930-94008952 ATATATGTATAGTTTCACTTGGG + Intronic
958478010 3:94609747-94609769 ATTTATATATATTTCTGCTTAGG - Intergenic
958581331 3:96028472-96028494 AATTATACATATGTTCACTTGGG + Intergenic
958593184 3:96186961-96186983 ATTTTCATATATTTTTCCCTTGG + Intergenic
958830209 3:99078175-99078197 ATTTATTTATCTATTCACCAGGG + Intergenic
958887357 3:99741102-99741124 CATTAAATATATTTTCATCTTGG + Intronic
959224879 3:103567468-103567490 ATACATATATATTTTATCCTTGG + Intergenic
959230213 3:103639501-103639523 ATTTGCATACATTTTCACATGGG + Intergenic
959711026 3:109386024-109386046 ATTTATTTATTTTTTCACTGTGG + Intergenic
959899576 3:111645145-111645167 ATATATATATATATACACCACGG - Intronic
960091892 3:113648873-113648895 ATATATATATATTTTCACTTTGG - Exonic
960210584 3:114960487-114960509 ATGTCTATATGTTTTAACCTTGG - Intronic
960893976 3:122481851-122481873 ATTTATATATCTATTCAACTAGG + Intronic
960904610 3:122587535-122587557 ATTTATTTATTTTTTGAGCTGGG + Intronic
961152832 3:124654173-124654195 ATTTAAATATATCTTTACCATGG - Intronic
961651720 3:128420308-128420330 ATTAATCTTTATTTTCATCTTGG - Intergenic
961976857 3:131034930-131034952 ACTTATGTGTATTTTCCCCTTGG + Intronic
962687113 3:137858376-137858398 ATATATATATATTTTCTCCCAGG - Intergenic
962700309 3:137992018-137992040 AATTATTTATATTTTACCCTGGG - Intergenic
962774062 3:138642066-138642088 ATATATATATATATACACCTAGG + Intergenic
962844805 3:139264793-139264815 ATGTGTCTATATTTCCACCTAGG - Intronic
963073560 3:141325606-141325628 ATGTTTTTATATTTTCTCCTAGG - Intronic
963358991 3:144246190-144246212 ATTTGTAAATATTCTGACCTTGG + Intergenic
963512110 3:146259283-146259305 ATTTTTATACCTTTTCACATAGG + Intergenic
963760938 3:149286857-149286879 ATATATATATATATAAACCTTGG + Intergenic
964009673 3:151876809-151876831 TTTTATAAATATTTTCTCCAAGG - Intronic
964092945 3:152897274-152897296 ATATATATATATACTCTCCTTGG - Intergenic
964107412 3:153054317-153054339 ATTTAGAATGATTTTCACCTTGG + Intergenic
964267715 3:154918872-154918894 ATATATATATATTTACATTTGGG - Intergenic
964519518 3:157548585-157548607 ATTTATTTATTTTTGCATCTGGG + Intronic
964597155 3:158446053-158446075 ATTAATAGATATTTTCAAGTAGG - Intronic
965266565 3:166551188-166551210 ATCTGTATATATTCTCACCTTGG + Intergenic
965337603 3:167446853-167446875 ATTTAGGTATATTTGCACTTCGG + Intronic
965345605 3:167545511-167545533 ATATATATATATATGCACCCTGG + Intronic
965518265 3:169645738-169645760 CATTATATATATTTTCATATAGG - Intronic
965598909 3:170436006-170436028 ATTTTAATAAATCTTCACCTAGG + Intronic
965619006 3:170623627-170623649 CTTTATTTAGATTTTCCCCTAGG + Intronic
965690478 3:171351240-171351262 ATATATATATATTTTCTCTATGG - Intronic
965834096 3:172831740-172831762 ATTTATATCCATTCTTACCTAGG + Intergenic
966294042 3:178396983-178397005 ATTTATATAAATTTTAAAATGGG - Intergenic
966635936 3:182133698-182133720 ATTTATATTTAATTTTCCCTGGG + Intergenic
966988683 3:185206384-185206406 ATTTTTTTATATTTTCTTCTAGG - Intronic
967057893 3:185845942-185845964 ATTTTTATAAATTTTTATCTAGG - Intergenic
967914457 3:194568132-194568154 ATTTATTTATATTTTAAGATAGG - Intergenic
968259839 3:197311788-197311810 AGTTATATATATTTGCACAATGG + Intergenic
968488701 4:878030-878052 ATTTAAAAATATCTTCAACTAGG - Intronic
968973368 4:3808408-3808430 ATTTATATAAATGTTTTCCTGGG + Intergenic
969380724 4:6795598-6795620 ATTTATTTATTTTTTGAGCTAGG + Intronic
969886916 4:10223145-10223167 ATGCATATATATTCTGACCTTGG + Intergenic
970020890 4:11567508-11567530 ATTTTTATATATTTCCACTTAGG - Intergenic
970090846 4:12406243-12406265 TCTAATATATATTTTCACCCTGG + Intergenic
970794531 4:19894883-19894905 ATTTATATATAACTTCAGCAAGG - Intergenic
971087029 4:23290482-23290504 ATTTAAATATATTTTCTCAAAGG + Intergenic
971118258 4:23674064-23674086 AAATATATATCTATTCACCTTGG - Intergenic
971192643 4:24442010-24442032 GTTTATATTCATTTTCTCCTTGG + Intergenic
971240954 4:24888255-24888277 ATCTATGTATATATTCAGCTTGG - Intronic
971691158 4:29838431-29838453 ATTTATATATCTTATCAACTTGG + Intergenic
971764627 4:30814098-30814120 ATTTATGTATATTTACAGATAGG + Intronic
972189919 4:36577696-36577718 ATTTATGTATTTTTGCAACTTGG - Intergenic
972438413 4:39058624-39058646 ATATATATATTTTGTCACCAAGG + Intronic
973007138 4:45024369-45024391 ATTTATATATATCTATATCTAGG + Intergenic
973051517 4:45604855-45604877 ATTTCTTTTTTTTTTCACCTTGG + Intergenic
973068166 4:45822992-45823014 ATATATATATATATACACCATGG + Intergenic
973084857 4:46045432-46045454 ATTAATTTCTATTTTCTCCTTGG - Intronic
973111633 4:46404536-46404558 ATATATATATATTTTAATTTTGG + Intronic
973153022 4:46911588-46911610 ATGAATATTTATTTTCTCCTAGG + Intergenic
973374339 4:49277094-49277116 ATATATATATATCAGCACCTCGG + Intergenic
973383072 4:49333147-49333169 ATATATATATATCAGCACCTCGG - Intergenic
973386677 4:49518134-49518156 ATATATATATATCAGCACCTCGG - Intergenic
973573074 4:52259894-52259916 ATTTATTTATTTTTTTACCCAGG - Intergenic
973912502 4:55595535-55595557 ATATATATATATATACAGCTGGG - Intronic
973966350 4:56166149-56166171 ATTAATTTATATTTCCAGCTGGG - Intergenic
974119178 4:57617990-57618012 ATTTATATATATTTTCTCATAGG + Intergenic
974501128 4:62704217-62704239 ATTTATGGAAATTCTCACCTAGG - Intergenic
974655521 4:64814628-64814650 ATATATATATATATGTACCTTGG + Intergenic
974763667 4:66311567-66311589 ATTTTGATTTATTTTCACATTGG + Intergenic
975398030 4:73900429-73900451 ATATATATATATATATACCTTGG + Intergenic
975451889 4:74538084-74538106 CTGTCTATATATTTTCACATGGG - Intergenic
975515402 4:75242366-75242388 CTTTATTGATATTTCCACCTTGG - Intergenic
975567617 4:75775651-75775673 TTTTTTCTATATTTGCACCTAGG - Intronic
975661739 4:76695652-76695674 ATTTAATTACATTTTCCCCTGGG - Intronic
975789152 4:77929865-77929887 ATGTATTTATATTTTAAACTTGG - Intronic
975858229 4:78647595-78647617 ATATATATATATTTTTAGATGGG - Intergenic
976031112 4:80754965-80754987 ATTAATATCTATTCTCACATAGG - Intronic
976809014 4:89080387-89080409 CTCCACATATATTTTCACCTTGG + Intronic
976892829 4:90071195-90071217 ATTCATATATATTTCTAACTAGG + Intergenic
977133779 4:93275434-93275456 ATATATATATATATATACCTAGG + Intronic
977444494 4:97112471-97112493 AATTTTAAATATTTTCATCTTGG + Intergenic
977453775 4:97231508-97231530 ATTTATTTTTTTTTTCACTTTGG - Intronic
977562930 4:98551298-98551320 TTTTACATATATTTTCATCAGGG + Intronic
977914942 4:102581347-102581369 ACTTATTTATATTTTCAGTTAGG - Intronic
978086252 4:104659014-104659036 AGTTGTATATATTATCACTTGGG - Intergenic
978260253 4:106747755-106747777 ATATATGTATATTTTTACATTGG + Intergenic
978526456 4:109672078-109672100 ATATATATATATTTTTAATTGGG + Intronic
978606129 4:110481728-110481750 ATGTATATATATTTGTACTTAGG + Intronic
978674566 4:111295739-111295761 TTTTACATATATTCTCACCAAGG - Intergenic
978797839 4:112725904-112725926 ATTTATTTATATTTTTAAATTGG - Intergenic
979065283 4:116123668-116123690 ATTAATATATATATTTAGCTTGG - Intergenic
979092481 4:116502930-116502952 ATTGGTGTATATTTTCACCAAGG + Intergenic
979110693 4:116751661-116751683 TTTTATAAATATTTTCAAGTTGG - Intergenic
979287392 4:118941544-118941566 ATTTATACATTTTTTATCCTTGG + Intronic
979571670 4:122233994-122234016 TTTTACATGTATTATCACCTTGG - Intronic
979868730 4:125789615-125789637 GTGTATATATATTTGCACCTGGG + Intergenic
979908367 4:126327360-126327382 ATTTATATACATTTACAGATGGG - Intergenic
979911550 4:126373238-126373260 ATTAATATGTTTTTTCCCCTTGG - Intergenic
980109936 4:128625610-128625632 ATGTATATTTATTTTCATTTGGG - Intergenic
980254968 4:130367726-130367748 ATTTATGAATATTTTTACTTTGG - Intergenic
980315505 4:131194393-131194415 ATCCATATATATTTTAATCTTGG - Intergenic
980364444 4:131782103-131782125 ATTTTTTAATATTATCACCTTGG - Intergenic
980584609 4:134795592-134795614 ATAAATATATAATTTCAGCTGGG - Intergenic
980595548 4:134949442-134949464 ATTTAAAAATATTATCTCCTAGG - Intergenic
980785751 4:137552241-137552263 ATGTATAAATATATTCACCTAGG - Intergenic
981195370 4:141913679-141913701 ATATATATATTTTTTTTCCTTGG + Intergenic
981442802 4:144802053-144802075 ATATATATATATATACACCATGG - Intergenic
981455731 4:144951581-144951603 ATTCTTATATATTTTCTTCTAGG - Intergenic
981818585 4:148860065-148860087 CATTATATATATTTTCAACTGGG + Intergenic
981881551 4:149619118-149619140 ATATATATATATATACACCATGG + Intergenic
982745006 4:159097571-159097593 ATTTATCAATATTATTACCTAGG - Intergenic
982809967 4:159812819-159812841 ATTTATGTATATTTCCACATAGG + Intergenic
982874715 4:160632327-160632349 ATATATATATATATTCCCTTAGG + Intergenic
983222511 4:165056160-165056182 AAATATATATATTTTCAGCTTGG + Intergenic
983675070 4:170282427-170282449 ATTTTTATATAATTTCCCTTAGG + Intergenic
983724300 4:170901140-170901162 ATGTATATATATTTTAAACAGGG + Intergenic
983738064 4:171088766-171088788 ATTTATGTATATTTTCCCAATGG + Intergenic
983856330 4:172650322-172650344 ATTTATATATGAATTCACTTTGG - Intronic
983946146 4:173587389-173587411 ATATATATATATTTTGAGATGGG + Intergenic
984544017 4:181077338-181077360 ATTTATATATATGGTTACCAGGG - Intergenic
985204398 4:187519382-187519404 ATGTATATATTTTTTCTCTTAGG - Intergenic
985262901 4:188131516-188131538 ATATATATATATATTTAGCTAGG - Intergenic
985802714 5:2015867-2015889 ACTTGTATATGTTTCCACCTGGG - Intergenic
986074563 5:4321940-4321962 ATTTATTTATAATTTAATCTTGG - Intergenic
987432803 5:17857084-17857106 ATTTATATATATTTTTATAGTGG + Intergenic
987477385 5:18408343-18408365 ATTTATTTATATTTGCAGATGGG + Intergenic
987824865 5:23017684-23017706 ATTTATAAATATATACACATAGG - Intergenic
987832075 5:23107196-23107218 ATTTTTATATGTTTTCACGATGG - Intergenic
988149021 5:27351627-27351649 ATATATATATATTTGCTACTTGG - Intergenic
988269891 5:29000409-29000431 AATTATATATCTTTTAATCTAGG - Intergenic
988371539 5:30375654-30375676 ATTTATTTATTTTTCCACTTTGG - Intergenic
988677614 5:33449347-33449369 ATATATATATATCTTAAACTGGG + Intronic
988894836 5:35661380-35661402 ATATATATATATATTTATCTTGG - Intronic
989012506 5:36889074-36889096 ATTTGAATATATTTTCAGTTTGG + Intronic
989019669 5:36988157-36988179 ATTGGTATATTATTTCACCTGGG + Intronic
989468732 5:41789785-41789807 ATTTAAATATATTATGACATAGG - Intronic
989728213 5:44614008-44614030 ATTAATATATATTCTCACCAAGG - Intergenic
990235282 5:53760617-53760639 ATTTACATTTATTTTAACCAAGG - Intergenic
990264363 5:54059940-54059962 ATTTATATTCATTATCACCAAGG - Intronic
990729148 5:58789258-58789280 GTTTAATAATATTTTCACCTTGG - Intronic
990967201 5:61461954-61461976 AGGTAGATATATTTTTACCTTGG - Intronic
991273762 5:64818959-64818981 ATTTAAAGATATTTGCTCCTAGG + Intronic
992129632 5:73678879-73678901 ATGTATATATATTTTGACTAGGG + Intronic
992229646 5:74651475-74651497 TTTCAAATAAATTTTCACCTTGG + Intronic
992364031 5:76073531-76073553 ATATATATATATATACACCATGG + Intergenic
992520030 5:77540990-77541012 AATTATATTGATTTTCTCCTTGG - Intronic
992563649 5:77976457-77976479 ATTTATTTAAAAATTCACCTCGG + Intergenic
993046980 5:82878643-82878665 CTGTAAATATATATTCACCTAGG - Intergenic
993571590 5:89546653-89546675 ATTTCAATATATTTTCAACTTGG - Intergenic
993572008 5:89552455-89552477 AATTCTATATTTTTCCACCTGGG - Intergenic
993718852 5:91301927-91301949 ATTTATTTATTTTTTGACATAGG + Intergenic
993849813 5:92993141-92993163 ATTTTTATATATTTTCAGTTTGG + Intergenic
993997537 5:94740795-94740817 ATTTGGAAATATTTTCATCTGGG - Intronic
994083786 5:95736146-95736168 ATTTATATTTATTTAGAACTGGG - Intronic
994149138 5:96428251-96428273 ATATATATATATTTTCCCCCTGG + Intronic
994197892 5:96939500-96939522 AAGTATATATACTTTCAGCTGGG - Intronic
994247250 5:97492383-97492405 ATATATATATATATTTAGCTGGG - Intergenic
994437048 5:99749743-99749765 ATGTACATTTTTTTTCACCTAGG + Intergenic
994554546 5:101282051-101282073 ATCTATTTATATTTTCTTCTAGG - Intergenic
994589568 5:101756585-101756607 AGTTTTATATAGTTTCACCCAGG - Intergenic
994798094 5:104332251-104332273 ATCTTTATATAGTTTCCCCTAGG - Intergenic
994955177 5:106521390-106521412 ATTTAAATATGTTTTCAGCAGGG - Intergenic
995068889 5:107894650-107894672 ATTTATATATAATGTCCCCCAGG - Intronic
995077898 5:108009219-108009241 ATATATATATATATACAGCTTGG + Intronic
995286646 5:110396364-110396386 ACCTATATAGATATTCACCTGGG + Intronic
995631180 5:114134499-114134521 ATTTATTTATTTTGTCTCCTAGG + Intergenic
995701876 5:114945273-114945295 ATATATATATATATTCGGCTGGG - Intergenic
995734152 5:115280871-115280893 ATTCATATTAATTTCCACCTGGG - Intronic
995814752 5:116155035-116155057 ATTTATGTATCTTTTAACATTGG + Intronic
996018135 5:118563804-118563826 ATTTATTTATTTTTTTACCCAGG + Intergenic
996184483 5:120459231-120459253 ATCTATAAAAATTTTCTCCTGGG + Intergenic
996477680 5:123939422-123939444 ATGTTTATATAGTTTGACCTGGG + Intergenic
996644435 5:125796939-125796961 ATTTCCATTTATTTTCTCCTAGG + Intergenic
996674261 5:126156284-126156306 ATTTCTATATACTTTCAACACGG - Intergenic
996998706 5:129731497-129731519 ATTTACATATATATGCTCCTTGG - Intronic
997161007 5:131609288-131609310 ATTTACATATATTTTCACCTTGG - Intronic
997689590 5:135817478-135817500 ATTTATCTATATTTTCCATTTGG - Intergenic
998389041 5:141775087-141775109 ATTTGTATATATTTTCATGAAGG - Intergenic
998529291 5:142870297-142870319 TCTTATGTAGATTTTCACCTTGG - Intronic
998580969 5:143375321-143375343 GTGTACATATATTTTCCCCTTGG - Intronic
998870086 5:146543187-146543209 ATTTATTTATTTTTTTACATAGG + Intergenic
998938844 5:147259234-147259256 TTTTATATATTTTTTGACTTAGG + Intronic
999517024 5:152311793-152311815 TTTTATTGATCTTTTCACCTCGG + Intergenic
999938380 5:156513788-156513810 CTTTATAAATATTTGCATCTGGG + Intronic
1001103982 5:168837340-168837362 ATTTATAAAATGTTTCACCTGGG - Intronic
1001487721 5:172131549-172131571 ATTTATTTATTTTTTTGCCTTGG + Intronic
1002133278 5:177094063-177094085 ATTTATTTATTTTTTCAGATAGG - Intronic
1002260290 5:177988833-177988855 ATATATATATATATACACATCGG + Intergenic
1002798020 6:491824-491846 ATTTAAATATATTTTAGCTTTGG - Intronic
1002951755 6:1819785-1819807 ATATATATATATATCTACCTTGG + Intronic
1003059240 6:2849859-2849881 ATATATATGTATATGCACCTGGG + Intergenic
1003105874 6:3215350-3215372 TTATATATAGATTTTCAACTAGG - Intergenic
1003612255 6:7624387-7624409 TGTTATACATATTTTCACCCAGG - Intergenic
1003723864 6:8736736-8736758 ATTTTTACATAGTTTCTCCTTGG + Intergenic
1004248628 6:14003680-14003702 ATATATATATATATCCACGTTGG + Intergenic
1004594645 6:17087532-17087554 ATATATATATATTTTCAACTTGG - Intergenic
1004758561 6:18640684-18640706 ATATATATATATTTTTGCTTTGG + Intergenic
1004796373 6:19090454-19090476 AATGTTATATATTTTCATCTTGG + Intergenic
1004885160 6:20044147-20044169 ATCTATTTATACTTTCACCCTGG - Intergenic
1005079243 6:21940263-21940285 ATTTATAAATTCTTTCACATAGG + Intergenic
1005328634 6:24726810-24726832 ATATGTATATATTTGCACATAGG - Intergenic
1005617437 6:27587931-27587953 TTTTGTTTATATTTTCCCCTTGG - Intergenic
1005633035 6:27726641-27726663 TTTTATAAAAATTTACACCTCGG - Intergenic
1005682386 6:28219377-28219399 ATTTATATATAATTTTGCCCTGG - Intergenic
1006862713 6:37183710-37183732 ATATATATATATTTTTAAATCGG + Intergenic
1007080558 6:39099590-39099612 ATTTATGTATTTTATGACCTGGG - Intergenic
1007820242 6:44555656-44555678 CTTTATATTGCTTTTCACCTGGG + Intergenic
1008190734 6:48453827-48453849 ATATATATATATATGCACCATGG + Intergenic
1008250761 6:49237061-49237083 ATTTATATATATATACACCATGG - Intergenic
1008374020 6:50770894-50770916 ATATATATATATTATAACATGGG + Intronic
1008417462 6:51259377-51259399 ATGTATATATTTTTTCAATTTGG - Intergenic
1008424470 6:51340970-51340992 ATTTATGTATATACTCACCCTGG + Intergenic
1008891713 6:56500664-56500686 TTTTATGTATATTTTCACTCTGG - Intronic
1009274941 6:61663513-61663535 ATATATATATATATGCAGCTGGG + Intergenic
1009327172 6:62366276-62366298 ATTGATATATGTTTTCCCTTGGG + Intergenic
1009465771 6:63966954-63966976 ATGTATATATATTTTCCTTTTGG + Intronic
1009641931 6:66349439-66349461 ATCTATATGTATTTTTAACTAGG - Intergenic
1009766722 6:68086482-68086504 CTTTATATAAAATTTTACCTAGG + Intergenic
1009912978 6:69956383-69956405 CTATATATATATTTTTAACTTGG + Intronic
1009936938 6:70245561-70245583 ATTTATAAATATTAGCAACTGGG - Intronic
1010199523 6:73270604-73270626 GTTGATATATATTGTCAACTGGG - Intronic
1010302359 6:74276298-74276320 ATATATATTTATTCTTACCTTGG + Intergenic
1010555180 6:77270373-77270395 ATTTATATATATTTACCATTTGG + Intergenic
1010613761 6:77988400-77988422 ATATATATTTAATTTCACATTGG - Intergenic
1010643200 6:78355797-78355819 TTTTAAATATTTTTTCATCTTGG + Intergenic
1010771130 6:79832401-79832423 CTTTATATATTTTTACTCCTAGG - Intergenic
1010801388 6:80179680-80179702 ATATATATATATTCAAACCTTGG - Intronic
1011278552 6:85654129-85654151 TTTTATATATATGTTGAACTTGG + Intergenic
1011419911 6:87160173-87160195 ATTTATATATTTTATCACTGAGG + Intronic
1011510265 6:88093128-88093150 ATTTAGAGACATTTTCACTTAGG - Intergenic
1011612043 6:89161824-89161846 ATTCATCCATATTTTCACATTGG + Exonic
1011902123 6:92311934-92311956 ATTTTTATATATGTACACTTTGG - Intergenic
1012050535 6:94337066-94337088 ATATATATATATTTACACTGAGG - Intergenic
1012238039 6:96839944-96839966 ATATATATATATATTCAACTTGG + Intergenic
1012350012 6:98238661-98238683 ATTAATTTATGTTTTCACTTAGG - Intergenic
1012358353 6:98345014-98345036 ATTTATAGAAATTTTCACCAGGG + Intergenic
1012443702 6:99287264-99287286 ATATATATATTTTTTAAGCTGGG - Intronic
1012776822 6:103506337-103506359 ATTTATTTACATTTTCTACTTGG - Intergenic
1012914004 6:105149073-105149095 ATTTACATATATTTGGAACTCGG + Intergenic
1012943322 6:105439862-105439884 ATTTATATAAAATTCCATCTTGG - Intergenic
1013010022 6:106111772-106111794 ATTTCTAGATATTTTTTCCTTGG + Intergenic
1013402554 6:109813136-109813158 ATTTATATACATTTTAAATTGGG + Intronic
1013467126 6:110427548-110427570 ATATATATATATTCTTAGCTTGG + Intronic
1013510161 6:110837760-110837782 ATATATATATATATTCCTCTGGG + Intronic
1013689082 6:112618305-112618327 ACCTTAATATATTTTCACCTTGG + Intergenic
1013749973 6:113393638-113393660 TTTTATATATATTTTAAAATAGG - Intergenic
1014271178 6:119338245-119338267 ATGTATTTATATTCTGACCTTGG - Intronic
1014294292 6:119599701-119599723 ATTTATATCTATTTTAACTATGG - Intergenic
1014429023 6:121343868-121343890 ATATATATATATTTTTAAATGGG - Intergenic
1014944681 6:127483142-127483164 ATTTAGATATATTTTTACTTTGG + Intronic
1015228796 6:130889465-130889487 ATTTATACATATTTTCCCTTGGG + Intronic
1015297658 6:131616362-131616384 ATTTATATAGATTTTGTCCTAGG + Intronic
1015427486 6:133088757-133088779 TATTATATATATTTTAACCAGGG - Intergenic
1015498181 6:133902548-133902570 ATTTAAAAATTTTTTCACTTAGG - Intergenic
1015802975 6:137079137-137079159 ATGTATATATATATACACCATGG - Intergenic
1016014396 6:139168853-139168875 AGTTATACATATTTTCCCCTTGG + Intronic
1016070099 6:139728067-139728089 ATTCATATGTATTTTTACATAGG + Intergenic
1016684224 6:146863475-146863497 AATTTGATATATTTACACCTGGG - Intergenic
1016845380 6:148563642-148563664 CTTGAAATAGATTTTCACCTTGG - Intergenic
1017306116 6:152920721-152920743 ATTTATATATTTTTTAAGATGGG + Intergenic
1017364467 6:153618272-153618294 ATATATATATACTTCAACCTTGG - Intergenic
1017797045 6:157854401-157854423 ATTTATTCATATTTTCTCTTAGG - Intronic
1018631189 6:165824570-165824592 CTTTATTTCAATTTTCACCTTGG + Intronic
1018804348 6:167247494-167247516 ATATATATATATTTTAACCTTGG + Intergenic
1020599748 7:10257987-10258009 ATTTAAATATAATTTTACTTCGG - Intergenic
1020610653 7:10392979-10393001 ATATATATATATTTTATCTTTGG + Intergenic
1020760533 7:12263208-12263230 ATTTATACATAGTTTTCCCTAGG - Intergenic
1020783904 7:12550365-12550387 ATGTATGTATATTTACACATAGG - Intergenic
1020986393 7:15140224-15140246 GTTTATACATATTTTCTCTTAGG + Intergenic
1021182244 7:17520196-17520218 ATGTATATATATTTTCTGTTTGG + Intergenic
1021188560 7:17593972-17593994 ATTTCTATTTATTTTCCCCTTGG - Intergenic
1021198867 7:17704387-17704409 ATATATATATATTTTTTCCATGG - Intergenic
1021338312 7:19431902-19431924 ATTATTATTTATTTTCTCCTTGG - Intergenic
1021369448 7:19823480-19823502 ATTTACACATTTTTTCTCCTGGG + Intergenic
1022009020 7:26292563-26292585 AATTATATGGATTTTCCCCTGGG - Intronic
1022281306 7:28912857-28912879 ATATATATATATATACACCATGG + Intergenic
1022628406 7:32061826-32061848 ATTTATGTATATTTTCTCATTGG - Intronic
1022984000 7:35632332-35632354 ATATATATATTTTTTCCCCTGGG + Intergenic
1023231613 7:38037299-38037321 AATTATAAATAATTTCCCCTGGG + Intergenic
1023649970 7:42359449-42359471 TTTTGAATATATTTGCACCTTGG - Intergenic
1023916622 7:44594645-44594667 ATTTATTTTTATTTTTACTTTGG - Intergenic
1024602529 7:50996421-50996443 ATGTATATATATATACACCATGG - Intergenic
1024640511 7:51324839-51324861 CTTTATATATAATTTTGCCTTGG + Intergenic
1024843297 7:53613028-53613050 ATATATATATTTTTTTACCTTGG + Intergenic
1024895953 7:54262405-54262427 ATTACTGTATATTTTCACATTGG + Intergenic
1024946250 7:54810083-54810105 ATTAAAATAGATTTTCATCTCGG + Intergenic
1026250797 7:68668729-68668751 GATTATAAATATTCTCACCTGGG + Intergenic
1026475896 7:70734974-70734996 ATTTATATTTATCTTGACCTTGG - Intronic
1026646359 7:72173316-72173338 ATATATATATATATTCATTTAGG - Intronic
1026686465 7:72514383-72514405 ATATATATATTTTTTCCCCTGGG - Intergenic
1026782029 7:73274721-73274743 ATATATATACATTTTTACATTGG - Intergenic
1027065134 7:75117737-75117759 ATATATATACATTTTTACATTGG + Intronic
1027287978 7:76669967-76669989 ATTTATATTTATTTTTAAGTTGG + Intergenic
1027409161 7:77895580-77895602 ATTTATATATATTTTTTCTGAGG - Intronic
1027817438 7:82994581-82994603 TTTTATATATATTTTTATTTTGG + Intronic
1028171099 7:87597403-87597425 ATTTAAATCTATTTTAACATGGG - Intronic
1028235157 7:88352360-88352382 ATTTATTTATATTTTAAATTGGG + Intergenic
1028343732 7:89754727-89754749 AAGTATATATATTTTAAACTTGG + Intergenic
1028718286 7:94000032-94000054 ATTTATATATGTATTCACTAAGG - Intronic
1029815604 7:103091500-103091522 ATATATATATATACACACCTAGG + Intronic
1030321185 7:108170176-108170198 ATATATATATATTTACACAATGG + Intronic
1030460123 7:109824831-109824853 CTTTAGATATATTTTCAACCAGG + Intergenic
1030584739 7:111403442-111403464 ATATATATATATATATACCTGGG - Intronic
1030702137 7:112652354-112652376 TTTTATATCTATTTTCATCAGGG - Intergenic
1030803380 7:113882610-113882632 ATTTACATATGTTTTTACTTTGG - Intronic
1031185381 7:118473267-118473289 ATTTGTATCTATGCTCACCTTGG + Intergenic
1031221795 7:118976103-118976125 AATTATATATAATTTAACATAGG - Intergenic
1031281393 7:119805385-119805407 TTTTAAATATTTTTTCACCTAGG + Intergenic
1031301169 7:120062521-120062543 ATTTCTTTATAATTTCATCTTGG + Intergenic
1031457831 7:122006272-122006294 AATAATATATATTTTCAGATAGG - Intronic
1031462533 7:122069303-122069325 ATTTATTTATCTATTGACCTTGG + Intergenic
1031499632 7:122497658-122497680 ATTTATTTATATTTGCCCTTGGG + Intronic
1032118356 7:129136722-129136744 ACATATATATATATTCAGCTGGG + Intergenic
1032443911 7:131963681-131963703 ATTTATTTCTATTTTTACTTTGG + Intergenic
1033535818 7:142311069-142311091 ATTTAGATTTGTTTTAACCTGGG - Intergenic
1033832867 7:145274704-145274726 ATTTATATAAATTTTTAAATAGG - Intergenic
1033925670 7:146457524-146457546 ATATATATATATAGTCACCCAGG + Intronic
1033946262 7:146722714-146722736 ATATATATATATATACACGTTGG + Intronic
1034038885 7:147855749-147855771 ATATATATTTTTTCTCACCTAGG - Intronic
1034637916 7:152581922-152581944 ATATATATATATATACCCCTTGG - Intergenic
1035772710 8:2161567-2161589 ATTAATACATATTAGCACCTAGG - Intronic
1035838366 8:2783471-2783493 ATTTTTATATATTTACCTCTTGG + Intergenic
1036606979 8:10316246-10316268 AATTATATATATTTACAAATCGG + Intronic
1037045939 8:14303775-14303797 ATTGATATATATTGTCACCCAGG + Intronic
1037868402 8:22467180-22467202 ATTTTTTTTTATTTTCTCCTAGG - Intronic
1038772585 8:30497002-30497024 AACTAAATATATTTTAACCTTGG + Intronic
1040525116 8:48215641-48215663 TTTTCTCTATGTTTTCACCTAGG - Intergenic
1041226082 8:55699547-55699569 AGTTATTTAAATTTTCACTTTGG + Intronic
1041343673 8:56872572-56872594 TTATATATATATATTCTCCTAGG - Intergenic
1041852745 8:62411120-62411142 TTTTATATCTATGTTCACCAGGG - Intronic
1041918112 8:63156309-63156331 CTTTAGAAATATTTTCACCAGGG + Intergenic
1041959918 8:63601393-63601415 CATTATATAAATTTTCAGCTAGG + Intergenic
1041988860 8:63960159-63960181 ATTTGTATATATTTTCTTGTAGG - Intergenic
1042243922 8:66692074-66692096 GTTTATTTATCTATTCACCTAGG - Intronic
1042259217 8:66839547-66839569 ATATATATATATTTTCATATGGG + Intronic
1042381631 8:68121693-68121715 AGTTATATATTTTTACAACTAGG - Intronic
1042668987 8:71240005-71240027 ATTTATGTTTATTTTTAGCTAGG - Intronic
1042688371 8:71467156-71467178 GTATATATATATTTTAACATAGG - Intronic
1042754789 8:72198882-72198904 ATATATATATTTTTTCCCTTTGG + Intergenic
1042995996 8:74699422-74699444 ATATATATATATATACACCATGG + Intronic
1043075508 8:75693764-75693786 ATTTATATGTATGATCAACTGGG - Intergenic
1043228190 8:77761589-77761611 TTATATATATATATTTACCTTGG - Intergenic
1043249238 8:78049303-78049325 ATATATATATATTTCCACCTTGG + Intergenic
1043254275 8:78113412-78113434 ATTTATTTATATTTTAGCCATGG - Intergenic
1043533295 8:81173259-81173281 ATATATAGATATTTTCATTTAGG - Intergenic
1043637682 8:82406806-82406828 ATTTTTTTTTATTTTAACCTTGG - Intergenic
1043721902 8:83555138-83555160 ATATATATATATATACACCATGG - Intergenic
1043782829 8:84357785-84357807 ATTTATATATATTTTGATAGTGG + Intronic
1043913003 8:85885469-85885491 ATTTTTATATAATTTAATCTAGG - Intergenic
1044011979 8:87005585-87005607 ATATATATTTCTTTTGACCTAGG + Intronic
1044062715 8:87659027-87659049 TTTAAAATATATTTTCTCCTTGG + Intergenic
1044096361 8:88071114-88071136 ATTTAGATATTTTTTGAACTAGG - Intronic
1044432029 8:92119489-92119511 ATATATATATATATACACATAGG - Intergenic
1044508078 8:93043819-93043841 ATATATATATATATACACCATGG - Intergenic
1044517161 8:93153144-93153166 ATTTATATACATGTCCACATTGG - Intronic
1044872872 8:96637641-96637663 ATCTAAATATATGTTCACCTTGG - Intergenic
1044974548 8:97650735-97650757 ATTTATTTATTTTTTGAGCTGGG + Intronic
1045099735 8:98832276-98832298 ATCTATATATATATTCACAAAGG + Intronic
1045716187 8:105048417-105048439 ATATATATATATTTGCATTTTGG - Intronic
1045915181 8:107461147-107461169 ATTTTTATAAATTTTGAGCTGGG + Intronic
1045950784 8:107849438-107849460 ATTTATGTTTATTTTCATCTGGG - Intergenic
1046365087 8:113218108-113218130 ATATATATATATTTTAATATTGG + Intronic
1046883922 8:119341403-119341425 ATTAATATATATTCTCACCTAGG - Intergenic
1048207348 8:132425998-132426020 ATTTGTATTTCTTTGCACCTGGG - Intronic
1048429532 8:134357040-134357062 ATTTATAAATATTTTCCAGTTGG - Intergenic
1049135433 8:140893792-140893814 ATATATTTATATTTTCACAGAGG - Intronic
1050813816 9:9783243-9783265 ATTTGTATATTTTTTTACCAAGG + Intronic
1050826039 9:9947638-9947660 ATATATATATATATACACCATGG + Intronic
1050832676 9:10033398-10033420 TATTATATATATTGACACCTTGG - Intronic
1050869297 9:10546505-10546527 AATTTTACATATTTTCACCTAGG + Intronic
1051977628 9:22971287-22971309 CTTTATATATATGTTCCCCATGG + Intergenic
1051999629 9:23261627-23261649 AGTTCTATTTATTTTCTCCTTGG - Intergenic
1052152037 9:25128995-25129017 ATATATTTTTATTTTCTCCTAGG - Intergenic
1052178165 9:25490457-25490479 ATCTATATATTTTTACACTTAGG - Intergenic
1052393363 9:27907594-27907616 ATATATATATTTTTTTACTTAGG + Intergenic
1052453607 9:28664784-28664806 ATGTAGATATATTTTAAGCTGGG - Intronic
1052474143 9:28937240-28937262 ATTTAGATACACTTTCATCTTGG - Intergenic
1052628977 9:31012704-31012726 ATATATATATATATACACCATGG - Intergenic
1052628978 9:31012753-31012775 ATATATATATATATACACCATGG + Intergenic
1052642633 9:31188952-31188974 ATGAATATCTAGTTTCACCTGGG + Intergenic
1052678987 9:31663946-31663968 ATATATATATATATGCACCTAGG + Intergenic
1052678989 9:31663987-31664009 ATATATATATATATGCACCTAGG + Intergenic
1053183277 9:35992624-35992646 ATTTGTATGTTTTTTCCCCTTGG + Intergenic
1053324953 9:37135637-37135659 ATTTATTTATTTTTTCCCTTAGG + Intronic
1053369226 9:37546551-37546573 ATTTATTAATATTTTCTCTTAGG - Intronic
1053596783 9:39570707-39570729 ATATATTTATCTTTTCAGCTAGG - Intergenic
1053628796 9:39907995-39908017 ATTTTTTAATATTATCACCTTGG - Intergenic
1053777271 9:41558349-41558371 ATTTTTTAATATTATCACCTTGG + Intergenic
1053851747 9:42296339-42296361 ATTAATATAAATGCTCACCTAGG - Intergenic
1053854754 9:42327353-42327375 ATATATTTATCTTTTCAGCTAGG - Intergenic
1054215091 9:62342707-62342729 ATTTTTTAATATTATCACCTTGG + Intergenic
1054364462 9:64320137-64320159 ATTTTTTAATATTATCACCTTGG - Intergenic
1054569471 9:66794295-66794317 ATATATTTATCTTTTCAGCTAGG + Intergenic
1054869385 9:70035354-70035376 ATTTTTATACATATTCCCCTGGG + Intergenic
1055158200 9:73091040-73091062 ATTTATATATAGATCCACATGGG - Intergenic
1055177771 9:73341612-73341634 ATCTATATATTGTTTCACTTTGG + Intergenic
1055306085 9:74930403-74930425 ATATAGATATATTGTAACCTTGG - Intergenic
1055455451 9:76467508-76467530 ATTGATATAGAGTTTGACCTGGG - Intronic
1055674059 9:78637025-78637047 ATTTTGATATACTTTCACTTAGG - Intergenic
1055997643 9:82178089-82178111 ATTTATATTTGTTTTCAGGTTGG + Intergenic
1056030447 9:82547891-82547913 CTTTATATAAATTTTCATTTTGG - Intergenic
1056163004 9:83916608-83916630 GTTTATATATATTTTTAGCCAGG - Intronic
1056440955 9:86620690-86620712 ATATATATATTTTTTAAGCTGGG - Intergenic
1056509058 9:87285454-87285476 ATTTATGGATGTTTTCTCCTGGG - Intergenic
1056682250 9:88730052-88730074 ATTTATATATACCTCCAGCTGGG - Intergenic
1057112370 9:92485524-92485546 ATTTATTTTTATTTTCACGATGG - Intronic
1058581032 9:106457541-106457563 ATTTATCTATTTTTTAACCATGG + Intergenic
1058795272 9:108491857-108491879 ATGTATATATAAAATCACCTAGG - Intergenic
1058941646 9:109818433-109818455 ATTTCTATTTATTTTTAACTGGG + Intronic
1059798053 9:117720957-117720979 ATTTTTATATAGTGTCTCCTAGG - Intergenic
1059843062 9:118240440-118240462 TTTTATATATTTTTTCATCTTGG - Intergenic
1059935392 9:119305228-119305250 TTTTATCTATATTTCCAGCTAGG + Intronic
1060233834 9:121846713-121846735 ATTTAAAAATATTTTAAACTAGG + Intronic
1060317261 9:122523923-122523945 ACTTATAAATCTTTGCACCTTGG - Intergenic
1060326254 9:122618914-122618936 CTTTATATATACTTTCTCTTTGG - Intergenic
1061102702 9:128504384-128504406 ATATATATATATATTTACCTAGG + Intergenic
1061686067 9:132279819-132279841 ATTAATATATATTCTGACATGGG + Intronic
1203698009 Un_GL000214v1:115002-115024 ATATATATATATCAGCACCTCGG + Intergenic
1203551197 Un_KI270743v1:165979-166001 ATATATATATATCAGCACCTCGG - Intergenic
1185918343 X:4061640-4061662 ATGTATATACATCTTCACATTGG - Intergenic
1186083224 X:5956275-5956297 ATTTATATCTATATTTGCCTGGG + Intronic
1186173731 X:6903929-6903951 ATATATATATTTTTTAAACTTGG - Intergenic
1187611049 X:20943417-20943439 ATATATATATACTTTGAGCTAGG - Intergenic
1187671544 X:21671060-21671082 ATATATATATATACTCACCACGG - Intergenic
1187794659 X:22989966-22989988 ATTTACAGATATTTTCTCCCAGG + Intergenic
1188145727 X:26610333-26610355 ATATATATGTGTTTTCACATTGG + Intergenic
1188226563 X:27606220-27606242 ATATATATATATTTGTATCTAGG - Intronic
1188636588 X:32439754-32439776 ATTTATTTATTTTTTCACTGTGG + Intronic
1188820821 X:34772913-34772935 ATTTTTGTATGTTTTCACTTTGG + Intergenic
1188877900 X:35454775-35454797 ACATATATATATTTATACCTTGG - Intergenic
1189132861 X:38518243-38518265 ATTTAAATATATTAACAACTGGG + Intronic
1189797608 X:44660452-44660474 ATTTAAATATAATTTTACCAGGG - Intergenic
1189842114 X:45091332-45091354 AGTTATATAAATTCTTACCTAGG + Intronic
1190025481 X:46918453-46918475 ATTTATATTTATTCTCATCCAGG + Intronic
1190237488 X:48628102-48628124 ATTTATATACATTTTGATCCAGG + Intergenic
1190520567 X:51275561-51275583 ATTTATATATATTTATATATGGG - Intergenic
1190623053 X:52307832-52307854 ATTCATATTTATTTTCTACTTGG - Intergenic
1191608747 X:63088890-63088912 GCTTATTTATATTTGCACCTTGG + Intergenic
1192137491 X:68617484-68617506 AGTTAAATATATTTTCATGTAGG + Intergenic
1192489186 X:71559213-71559235 ATCTACATAAATTTTCATCTAGG - Intronic
1193133288 X:77941812-77941834 ATTTAAATATATTTTCTATTTGG - Intronic
1193815260 X:86097525-86097547 ATATATATATATTTATCCCTGGG + Intergenic
1194043680 X:88973888-88973910 ATTTTTATATATTTATACCGTGG + Intergenic
1194080676 X:89460593-89460615 ATATATATATATATTCCTCTGGG - Intergenic
1194095599 X:89635228-89635250 ATTTACATTTGTTTTGACCTAGG - Intergenic
1194142785 X:90225455-90225477 ATATATATATAGTTTTTCCTGGG - Intergenic
1194240992 X:91448187-91448209 ATATATGTATATTTTCCCCCAGG + Intergenic
1194515456 X:94845971-94845993 ATATATATATATATACACATAGG + Intergenic
1194555166 X:95349517-95349539 ATCTATAAATATTTCCTCCTTGG - Intergenic
1194858850 X:98969365-98969387 ATGTAAATACAATTTCACCTGGG + Intergenic
1194864112 X:99044473-99044495 ATTTTTTTATATCTTAACCTTGG + Intergenic
1195175276 X:102308929-102308951 AGTTATATATATTTTTCCCCTGG - Intronic
1195183589 X:102378164-102378186 AGTTATATATATTTTTCCCCTGG + Intronic
1195238822 X:102930654-102930676 ATATATATATTTTTTCACAATGG + Intergenic
1195345871 X:103950603-103950625 ATATATATATATTTTTCTCTTGG - Intronic
1195632319 X:107070425-107070447 ATTTTTATATCTTTCCTCCTAGG - Intronic
1195776585 X:108412801-108412823 AATTAAATGTGTTTTCACCTGGG - Intronic
1195859630 X:109369249-109369271 ATTAATCTATATATTCACTTTGG - Intergenic
1196081329 X:111636032-111636054 ATTTATATATATTTAAATCAAGG - Intergenic
1196129235 X:112135900-112135922 ATATATATATATGTATACCTTGG + Intergenic
1196433139 X:115649130-115649152 CTTTATATATATAATTACCTAGG - Intronic
1196434367 X:115661533-115661555 ATATATATATATATTTAGCTGGG + Intergenic
1197116759 X:122842818-122842840 AATTTTCTATATTTTGACCTGGG + Intergenic
1197153978 X:123250082-123250104 ATTTGTATTTATTATTACCTTGG - Intronic
1197373366 X:125651993-125652015 ATTTTTATATATTTTTCTCTAGG + Intergenic
1197462544 X:126760577-126760599 ATTTATATTTATTTTGCCATAGG - Intergenic
1197598622 X:128499180-128499202 ATTTATGTATTTTTTGACCTGGG + Intergenic
1197611639 X:128645578-128645600 ATATATATATTTTTTCCTCTGGG + Intergenic
1197675100 X:129321161-129321183 ATTTAAATATATTTTCTAGTTGG + Intergenic
1197993552 X:132346390-132346412 TTTTTTATATATTTACACCTAGG - Intergenic
1198181176 X:134210720-134210742 GTTGATAGGTATTTTCACCTTGG - Intergenic
1198205180 X:134459232-134459254 ATGTATATATATATGCACTTAGG - Intergenic
1198342018 X:135723963-135723985 ATATATATATATATGCACGTAGG + Intergenic
1198345972 X:135759333-135759355 ATATATATATATATGCACGTAGG - Intergenic
1198382530 X:136098114-136098136 ATTTATAGATATTCTCAAATCGG - Intergenic
1198762767 X:140050815-140050837 GTACATATATGTTTTCACCTGGG + Intergenic
1198982129 X:142409983-142410005 ATTTATATCTTTTTTGAACTTGG - Intergenic
1199164313 X:144652343-144652365 ATTTTCATTTATTTTCAACTGGG - Intergenic
1199475619 X:148241884-148241906 ATTGCTAGATATTTTCTCCTGGG - Intergenic
1199511104 X:148623607-148623629 ATATATATATATATTTAACTTGG + Intronic
1199590786 X:149466768-149466790 ATATATATATATTTTCCTATTGG + Intergenic
1200433347 Y:3116658-3116680 ATATATATATATATTCCTCTGGG - Intergenic
1200448598 Y:3296592-3296614 ATTTACATTTGTTTTAACCTAGG - Intergenic
1200479978 Y:3689670-3689692 ATATGTATTGATTTTCACCTTGG - Intergenic
1200488543 Y:3794553-3794575 ATATATATATAGTTTTTCCTGGG - Intergenic
1200616141 Y:5381867-5381889 ACTTATATTTAATTTCAACTTGG + Intronic
1200946199 Y:8841190-8841212 ACTTAAATATTTTTTGACCTGGG + Intergenic
1201297311 Y:12474950-12474972 ATTTATAGATAGTTCCTCCTGGG - Intergenic
1201370349 Y:13256354-13256376 ATTTACAAATGTTTTCAACTCGG + Intronic
1201619425 Y:15939327-15939349 CCATATATATATTTTCATCTGGG - Intergenic