ID: 1093977412

View in Genome Browser
Species Human (GRCh38)
Location 12:25438356-25438378
Sequence TTTATATATATTTTCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1087
Summary {0: 1, 1: 1, 2: 14, 3: 107, 4: 964}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093977403_1093977412 16 Left 1093977403 12:25438317-25438339 CCCGCCTGCACAACTAGGCCATT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977406_1093977412 12 Left 1093977406 12:25438321-25438343 CCTGCACAACTAGGCCATTGGCC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977402_1093977412 17 Left 1093977402 12:25438316-25438338 CCCCGCCTGCACAACTAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977400_1093977412 23 Left 1093977400 12:25438310-25438332 CCAGTTCCCCGCCTGCACAACTA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977404_1093977412 15 Left 1093977404 12:25438318-25438340 CCGCCTGCACAACTAGGCCATTG 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977409_1093977412 -9 Left 1093977409 12:25438342-25438364 CCATTTCCTAGGAATTTATATAT 0: 1
1: 0
2: 1
3: 66
4: 601
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977408_1093977412 -2 Left 1093977408 12:25438335-25438357 CCATTGGCCATTTCCTAGGAATT 0: 1
1: 0
2: 3
3: 15
4: 245
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964
1093977399_1093977412 27 Left 1093977399 12:25438306-25438328 CCTTCCAGTTCCCCGCCTGCACA 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG 0: 1
1: 1
2: 14
3: 107
4: 964

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093977412 Original CRISPR TTTATATATATTTTCACCTT GGG Intronic
900056128 1:632104-632126 TTTATTTTTCTTTTCACCGTAGG + Intergenic
901300571 1:8197439-8197461 TTTATATATATTTTCTCAGCTGG + Intergenic
901456306 1:9364790-9364812 TTTATTTATTTTTTCAGTTTTGG + Intronic
903089597 1:20899980-20900002 TTTATGTATATTTACACCCGTGG - Intronic
904954186 1:34269151-34269173 TATATATATATTTTGTCCTTGGG + Intergenic
905084139 1:35354957-35354979 TTTGTATATATTTTAGTCTTGGG + Intronic
905191005 1:36234513-36234535 TGTATATATATTTTTTCCTTTGG + Intronic
906661230 1:47583852-47583874 TTTATAAATATTGTCTCATTTGG + Intergenic
907362632 1:53931915-53931937 ATAATCTAAATTTTCACCTTAGG - Intronic
907534310 1:55135741-55135763 ATTATATATATTTCCCCCTATGG - Intronic
907803521 1:57795340-57795362 TTTATACCTATTTACACCATAGG + Intronic
908208447 1:61874582-61874604 CTTCTAAATATCTTCACCTTGGG + Intronic
908289800 1:62653566-62653588 TGTATAGATATTTACTCCTTAGG - Intronic
908369283 1:63465397-63465419 TTTATAGATATTTTACCCGTGGG + Intronic
908372449 1:63496514-63496536 TTTTTATATATTTTAATCTAAGG + Intronic
908378548 1:63572388-63572410 TTTTTATATATTGTTACTTTTGG - Intronic
908430472 1:64051709-64051731 TTTATCTATATTTTTATTTTGGG + Intronic
908671131 1:66548907-66548929 CTTGCATATATTTTCATCTTGGG - Intronic
908701298 1:66903949-66903971 ATAATAAATATTTTCACCATTGG + Intronic
908913832 1:69103286-69103308 TTTAAATATATCTTCTTCTTGGG + Intergenic
908945543 1:69491908-69491930 TTTATATTAAGTTTCACTTTTGG - Intergenic
909310926 1:74148054-74148076 TTCAAATATATTTTTTCCTTTGG + Intronic
909767885 1:79380524-79380546 TTTGGATATATTTTCACACTGGG + Intergenic
909786973 1:79625295-79625317 TTAATATATAGTTTCACTGTTGG + Intergenic
909845194 1:80384973-80384995 TATATATAAATTGTCATCTTAGG + Intergenic
909945700 1:81660577-81660599 GTTCTATAAATTTTCACCATAGG - Intronic
910053523 1:83004714-83004736 TTTATATAAGTTTACACATTTGG - Intergenic
910325446 1:86001739-86001761 TGTATATATATTTCCTCCCTTGG - Intronic
910372201 1:86528170-86528192 TTTATATATATTTTGCCATAAGG - Intergenic
910466686 1:87507729-87507751 TTTAGCTATATTTTCCCCCTGGG - Intergenic
911474238 1:98356774-98356796 TTTAAATATATTTTTACCAGAGG + Intergenic
911702765 1:100973789-100973811 GATATATATATTTTCCCTTTTGG - Intronic
911854201 1:102856207-102856229 TTTGTCTTTATTTTCATCTTTGG + Intergenic
911865035 1:103007497-103007519 ATTATTTATATTTTCAAATTTGG - Intronic
912092259 1:106093921-106093943 TTTATATAAATTATTACCTTAGG - Intergenic
912119878 1:106457445-106457467 TTTATTTATATTTTAACTTATGG - Intergenic
912300700 1:108513785-108513807 TTTATATATACTTTAAGCTCTGG + Intergenic
913016484 1:114741737-114741759 TCAATATATATTTTTAGCTTGGG + Intronic
913215879 1:116620075-116620097 TTTATATATATATACATATTTGG + Intronic
913323030 1:117603225-117603247 TATATATATATTTTTTTCTTGGG - Intergenic
914506515 1:148294629-148294651 TTTAGCTATATTTTCCCCATGGG - Intergenic
915097413 1:153473155-153473177 TCTGTATATATTCTCACCTCAGG + Intergenic
915669237 1:157474028-157474050 TTTATATATTTTTTCTCTTCTGG - Intergenic
916469647 1:165110484-165110506 TTTTTATTTATTTCCACCTAAGG - Intergenic
916617715 1:166459723-166459745 TTTATTCATATTTACACATTTGG + Intergenic
916919461 1:169448583-169448605 TTTCAATATATTTTTGCCTTTGG + Intronic
917031224 1:170694106-170694128 TTTGGATATATTTGCACCTGGGG - Intronic
918069592 1:181125211-181125233 TTTAAATTTATTTACATCTTGGG - Intergenic
918683933 1:187391261-187391283 TTTATATATATTTTCATGGTGGG + Intergenic
918700901 1:187606019-187606041 TGTATATATTTTATTACCTTTGG + Intergenic
919131002 1:193450401-193450423 TATATATTTCTTTTCACTTTGGG + Intergenic
919139192 1:193549232-193549254 TCTATTTATCTGTTCACCTTTGG - Intergenic
919190163 1:194206062-194206084 TTTTTATTTTTTTTCACCTAAGG + Intergenic
919196887 1:194297670-194297692 TCAATATAAATTCTCACCTTGGG + Intergenic
919328857 1:196143305-196143327 TTTATTTATATTTTCTTCCTAGG - Intergenic
919363733 1:196630035-196630057 TTGATATATATTATTACTTTAGG - Intergenic
919591862 1:199514023-199514045 TTTACATATTTTTTAACTTTGGG - Intergenic
919596741 1:199573466-199573488 TTTATCAATATGTTCACATTAGG - Intergenic
919615607 1:199805110-199805132 TTAATATTTATTGTTACCTTTGG + Intergenic
919953307 1:202386838-202386860 TTTAGGTATATTTTCGCCTAAGG + Intronic
920225993 1:204439639-204439661 TATATATATATTTTCACACAGGG + Intronic
920714718 1:208328800-208328822 TTTATATATATATTCCCCTGTGG - Intergenic
921305750 1:213794906-213794928 TCTATTTATATTTTAACATTTGG - Intergenic
921308904 1:213823838-213823860 TTTACATATATTATCTCATTAGG + Intergenic
921528415 1:216247226-216247248 TTTAAATATATTTTATCTTTAGG - Exonic
921632304 1:217450042-217450064 TTTATATAACTTTTCAATTTAGG - Intronic
921649717 1:217662928-217662950 CATATATATATTTTTTCCTTAGG + Intronic
921772746 1:219061364-219061386 GTGATATATTTTTCCACCTTAGG + Intergenic
921993432 1:221391957-221391979 TTTCTACAGATTCTCACCTTGGG + Intergenic
922398875 1:225229928-225229950 TGTATATATTTTTTCATCTTTGG + Intronic
923094690 1:230765699-230765721 TTGATATTTATTTTCTACTTGGG - Intronic
923284392 1:232478144-232478166 TTTATGTATATTTTAACCTAAGG - Intronic
923748659 1:236726604-236726626 GTTGGTTATATTTTCACCTTTGG + Intronic
923867542 1:237955993-237956015 TTTATTTACCTTCTCACCTTTGG + Intergenic
924068247 1:240248583-240248605 TTAATATTTATTTTCCCTTTGGG + Intronic
924097903 1:240573515-240573537 TTTATTTATCTTTACAACTTAGG + Intronic
924350315 1:243108295-243108317 TTTATCTCGATTTTCAACTTTGG - Intergenic
924407448 1:243765001-243765023 TTTATACATATATTTACTTTTGG + Intronic
924451845 1:244185595-244185617 TATATATAAAATTTCATCTTGGG + Intergenic
924575305 1:245275718-245275740 TTTGTCTATATGTTTACCTTTGG + Intronic
924698600 1:246426902-246426924 TTTATATATATTTTCTTTTTAGG - Intronic
924717651 1:246592525-246592547 TTTGTACATGTTTTCACATTAGG + Intronic
924846653 1:247780992-247781014 TTTAAAAATATTTTCATATTGGG + Intergenic
1064706950 10:18082808-18082830 TTTGTTTATCTTTTCAGCTTGGG + Intergenic
1064802079 10:19087956-19087978 TTTAAATATTTTGTCACATTTGG + Intronic
1064933655 10:20655540-20655562 TTAATAGATATTTTCACCTTGGG + Intergenic
1064955131 10:20900105-20900127 TTAATAGATATTTTCACCTTGGG + Intronic
1065066960 10:21978758-21978780 TTTAAAAGTATTTTTACCTTAGG - Intronic
1065296675 10:24282522-24282544 TGGATATTTATTTTCACTTTGGG + Intronic
1065337606 10:24670397-24670419 TTTAAATATCTTTTCACTTTAGG - Exonic
1065511855 10:26487233-26487255 TTAATCTTTATTTTGACCTTTGG + Intronic
1066211458 10:33243317-33243339 TATATTTATATGTTCATCTTAGG + Intronic
1066308862 10:34175567-34175589 GTAAAATATATTTTCACCTGGGG + Intronic
1066528669 10:36311925-36311947 ATTATATATATTAGCCCCTTTGG + Intergenic
1066667373 10:37798210-37798232 ATTATATAATTTGTCACCTTTGG - Intronic
1066814723 10:39391600-39391622 GTTATACACTTTTTCACCTTAGG - Intergenic
1067184058 10:44012216-44012238 TATATATATTTTTTGACCTTCGG - Intergenic
1067515796 10:46941669-46941691 TTTGTTTATATTTTTACTTTGGG + Intronic
1067646454 10:48110144-48110166 TTTGTTTATATTTTTACTTTGGG - Intergenic
1067781185 10:49208666-49208688 TTTATACACAGTGTCACCTTGGG + Intergenic
1068031012 10:51704915-51704937 TTTCTATATATTTTCTACCTAGG + Intronic
1068145427 10:53063649-53063671 TTTATAACTATTTGCACATTTGG - Intergenic
1068153807 10:53169585-53169607 TTTATATCTGTTTTTCCCTTTGG + Intergenic
1068181477 10:53524471-53524493 TATATATATATTTTTTTCTTTGG - Intergenic
1068344232 10:55750853-55750875 TTGATATATATTTTCCAGTTTGG + Intergenic
1068512851 10:57987821-57987843 TTTAAATATCTTTTTACTTTAGG + Intergenic
1068738151 10:60438203-60438225 TTTATATATATATAAAACTTTGG - Intronic
1068802058 10:61152545-61152567 TTTATATTTCATTTCACATTTGG + Intergenic
1068897330 10:62220777-62220799 TTTTTATTTATTTTTGCCTTTGG - Intronic
1069303264 10:66935635-66935657 TATATATATATTTTCCTATTAGG + Intronic
1069314826 10:67084441-67084463 TTAATATATATTTTAATATTTGG - Intronic
1069342729 10:67431113-67431135 GTCATAGGTATTTTCACCTTTGG + Intronic
1069450799 10:68515945-68515967 GTTATATATATTATCATTTTAGG - Intronic
1069886249 10:71625621-71625643 TTTAAATTTATTTTCACATTTGG + Intronic
1070275842 10:75005606-75005628 TTTAAATATAATTTCATATTGGG + Intronic
1072201697 10:93165754-93165776 TTTATATAAAGTTTCACCTGAGG - Intergenic
1072208739 10:93227022-93227044 TATATATATATATTCATATTTGG + Intergenic
1072274070 10:93805119-93805141 TTAATATATATTTTGTCTTTAGG - Intergenic
1072353565 10:94582492-94582514 AATATATATATTTTCAACATTGG + Intronic
1072627165 10:97119905-97119927 TATATATATATATACCCCTTTGG - Intronic
1073118209 10:101105148-101105170 TTTATTTTTATTTTTATCTTTGG + Intronic
1073553678 10:104427445-104427467 TTTATATATATTGTCTCATTCGG + Intronic
1073736717 10:106355860-106355882 TCTATTTATATTTTCATCCTGGG - Intergenic
1073832908 10:107407066-107407088 TTTATATACGTTTTAACTTTGGG - Intergenic
1074233306 10:111559302-111559324 TTTATATATATTTAGAACCTTGG + Intergenic
1074334524 10:112557649-112557671 TATATATATATATTCACACTTGG + Intronic
1074642762 10:115406409-115406431 ATTATTCATATTTTCAACTTTGG + Intronic
1075975862 10:126694252-126694274 TATATATATATATTCCCATTAGG + Intergenic
1078038810 11:7837807-7837829 TATATATATATTTTTGCCTTTGG - Intergenic
1078248866 11:9600995-9601017 TTCATCAATATTTTCAGCTTTGG - Intergenic
1078553502 11:12297916-12297938 TTTATATATTTTTTTATTTTAGG + Intronic
1078712174 11:13804312-13804334 GTTATATATATTTTCATATATGG - Intergenic
1078764943 11:14287351-14287373 TATATATATATTTTAACTTAAGG - Intronic
1079017798 11:16884330-16884352 TTCATATAAAATTTCAGCTTAGG + Intronic
1079157995 11:17966537-17966559 TTTAATTTTATTGTCACCTTTGG + Intronic
1079164390 11:18025539-18025561 ATTAGCTATATTTTCACCTGGGG - Intronic
1079370107 11:19845345-19845367 TTTCTACATATCTTCTCCTTTGG - Intronic
1079524132 11:21363975-21363997 ATAATAAATATTTTCACCTGTGG + Intronic
1079648611 11:22898106-22898128 TCTATTTCTACTTTCACCTTGGG + Intergenic
1079710286 11:23674832-23674854 TTTATACATATTTTTATCTTTGG - Intergenic
1080141256 11:28923079-28923101 TTTATATTTATTTCCACTTAGGG + Intergenic
1080244604 11:30165320-30165342 ATTATATAAGCTTTCACCTTAGG + Intergenic
1080270139 11:30442484-30442506 TTTTAAAATATTTTCACATTTGG - Intronic
1080299253 11:30766334-30766356 TAGGTATATATTTTCACATTTGG - Intergenic
1080723396 11:34871212-34871234 TTTAAATATTTTTACTCCTTTGG - Intronic
1081059033 11:38449536-38449558 TTTATATATTTATTCACCACTGG - Intergenic
1081090041 11:38853309-38853331 TATATATATATATTCTACTTAGG - Intergenic
1081172671 11:39888110-39888132 GTTATATATATTTTACCCTAAGG + Intergenic
1081831221 11:46117143-46117165 TTTATATGTATTATCTCATTTGG + Intronic
1082130825 11:48487373-48487395 ATTATGTATCTTTTCACCTCAGG + Intergenic
1082186589 11:49189551-49189573 TGTATAATTATTTTCAACTTAGG - Intronic
1082564327 11:54658246-54658268 ATTATGTATCTTTTCACCTCAGG + Intergenic
1082597727 11:55105820-55105842 TATATATACTTTTTCACCATAGG - Intergenic
1082700862 11:56428702-56428724 TTTATATTTATTTTAAACTATGG + Intergenic
1082731716 11:56806253-56806275 TTCATATAGATTTTAACATTAGG + Intergenic
1082860914 11:57855917-57855939 TATATATATTTTTTAACCTGGGG + Intergenic
1082918335 11:58464281-58464303 TATATATATATATTCCCTTTAGG + Intergenic
1084348865 11:68579016-68579038 TTTAAATACATTTTCCCCCTTGG - Intronic
1084897354 11:72283157-72283179 TTTAGATATATTTTAACCTGTGG - Intergenic
1085867640 11:80313389-80313411 TATATATATATATTAACTTTAGG - Intergenic
1085967288 11:81542820-81542842 TCTATATATTTTTTTAACTTGGG + Intergenic
1085978049 11:81684322-81684344 TTTATATAAATTTACAGCATGGG + Intergenic
1086148469 11:83581581-83581603 ATCATATCTATTTTCACCTGTGG - Intronic
1086240592 11:84685659-84685681 TTGAAATATATTTTCATTTTTGG - Intronic
1086320569 11:85643078-85643100 TTTATATATATTTTTGTATTTGG - Intergenic
1086533483 11:87814578-87814600 TTTAAATAGAATTTCAGCTTTGG + Intergenic
1086583528 11:88426184-88426206 TTTATTTATATTTTCATCTTAGG - Intergenic
1086679748 11:89655821-89655843 TGTATAATTATTTTCAACTTAGG + Intergenic
1086795358 11:91094587-91094609 TATACATATATATTAACCTTAGG + Intergenic
1086941783 11:92805704-92805726 TTTATATAAGTTTACACATTTGG + Intronic
1087595327 11:100246775-100246797 TTTATACATGTTTTTACTTTTGG - Intronic
1087964485 11:104395569-104395591 TTTATAAATATTTTTCCCTATGG + Intergenic
1088672391 11:112155370-112155392 TATAAATATAGTTTCACCTGAGG + Intronic
1089932309 11:122325750-122325772 ATTATATACATTTTCACATCAGG - Intergenic
1090092146 11:123708377-123708399 TATATATATATTTTTACTATAGG - Intergenic
1090674624 11:128979147-128979169 TTTATATATATCTTCATATTTGG + Intronic
1091499798 12:1005156-1005178 TCTTTATTTATTTTCACCTGGGG + Intronic
1091516346 12:1186525-1186547 TTTGTATAAAATATCACCTTTGG - Intronic
1091579896 12:1778603-1778625 TTTATATATGTTTTCTCCTAAGG - Intronic
1091964938 12:4732063-4732085 GTAATATATATTCTCACATTGGG + Intronic
1092045238 12:5427559-5427581 TGGATGTATATTTTCCCCTTTGG - Intergenic
1092932472 12:13329425-13329447 TTTGTATACATTTTCCCCCTTGG - Intergenic
1092995528 12:13946785-13946807 TTTTTATATATTTTAAACTGTGG - Intronic
1093533278 12:20192977-20192999 TTTATATGAATTTTTTCCTTAGG + Intergenic
1093585724 12:20833350-20833372 GTTATATATAATATAACCTTAGG - Intronic
1093585734 12:20834395-20834417 GTTATATATAATATAACCTTTGG + Intronic
1093585737 12:20834429-20834451 GTTATATATAATATAACCTTAGG + Intronic
1093676384 12:21945459-21945481 TTTATATATTTTTTCATGGTAGG + Intergenic
1093744721 12:22727068-22727090 TTTATATATAGTTTAAGGTTTGG - Intergenic
1093907203 12:24707075-24707097 TGTATATATATTTTAACAATAGG - Intergenic
1093977412 12:25438356-25438378 TTTATATATATTTTCACCTTGGG + Intronic
1094003084 12:25717442-25717464 TTTGTATAAATTTTCTCCTCTGG + Intergenic
1094080058 12:26524517-26524539 TTTAGAGATATTTTTACATTTGG - Intronic
1094150123 12:27273514-27273536 TTTATATACATTATCTCATTTGG - Intronic
1094252174 12:28375105-28375127 TTTACTAATATTTTGACCTTGGG + Intronic
1094408962 12:30149332-30149354 TTCATATATATTCCAACCTTGGG - Intergenic
1095259169 12:40079096-40079118 TTTATATGAATTTTCACCTGTGG + Intronic
1095268072 12:40183237-40183259 CATATATATATATTTACCTTTGG - Intergenic
1095362656 12:41362496-41362518 TATATATATATTTTTTCTTTAGG + Intronic
1095699559 12:45176934-45176956 TTAACATATATTTTCCCCTTTGG + Intergenic
1097536406 12:60875928-60875950 TTTATATCTATTTTAAACTTTGG - Intergenic
1097551291 12:61074821-61074843 TTTTTATTTCTTTTTACCTTTGG - Intergenic
1097551844 12:61081828-61081850 TTTTTATTTCTTTTCACCTTGGG - Intergenic
1097628097 12:62025852-62025874 ATTAAATATATTTTTTCCTTAGG - Intronic
1098204429 12:68093107-68093129 TTTATTTTTAGTTTCACCTTAGG + Intergenic
1098716413 12:73832405-73832427 TATATATATATATTCTCCTGTGG + Intergenic
1098716416 12:73832440-73832462 TATATATATATGTTCTCCTGTGG + Intergenic
1098716419 12:73832473-73832495 TATATATATATGTTCTCCTGTGG + Intergenic
1098716424 12:73832541-73832563 TATATATATATATTCTCCTGTGG + Intergenic
1098716427 12:73832578-73832600 TATATATATATATTCTCCTGTGG + Intergenic
1098716430 12:73832617-73832639 TATATATATATATTCTCCTGTGG + Intergenic
1098716433 12:73832654-73832676 TATATATATATATTCTCCTGTGG + Intergenic
1098716436 12:73832695-73832717 TATATATATATATTCTCCTGTGG + Intergenic
1098716439 12:73832728-73832750 TTTATATATATATTCTCCTGTGG + Intergenic
1098716442 12:73832763-73832785 TATATATATATATTCTCCTGTGG + Intergenic
1098716445 12:73832794-73832816 TTTATATATATATTCTCCTATGG + Intergenic
1098811548 12:75100284-75100306 TTTATAGATTTTCTAACCTTGGG + Intronic
1098998446 12:77148775-77148797 TTCACATATATTTTCCCCTAGGG - Intergenic
1099324124 12:81191207-81191229 TTTAAATATATTTTCATTCTTGG + Intronic
1099327582 12:81238931-81238953 ATTATGTAAACTTTCACCTTAGG - Intronic
1099406526 12:82270340-82270362 TTTATATACATTTTAAGCTTTGG - Intronic
1099596932 12:84678661-84678683 TATATGTATATTTTCACAGTTGG - Intergenic
1099963690 12:89421969-89421991 TTTATATATATGTTAAACTTGGG + Intronic
1100100689 12:91100795-91100817 TTTATATATATTTTTACTTCTGG + Intergenic
1100129457 12:91473367-91473389 TTTATATATATATTCAGAATAGG + Intergenic
1100252488 12:92842117-92842139 TTTTTAAATTTTTTCAACTTTGG - Intronic
1100434226 12:94557176-94557198 TTTATATATATTTTGAAATCAGG + Intergenic
1100599889 12:96104109-96104131 TATATATATATATTCCCTTTGGG + Intergenic
1100683428 12:96956890-96956912 TTTATATCAATTTTTACTTTTGG - Intergenic
1100710360 12:97249566-97249588 TATATATATATTTTCTCTATGGG - Intergenic
1100783902 12:98058868-98058890 TTTTTACATATTTTTAACTTTGG + Intergenic
1100969936 12:100057840-100057862 TTTAAATATAATTTCAGCTATGG - Intronic
1101283896 12:103289523-103289545 TTTATGAATATTTTCACTATAGG - Intronic
1101974539 12:109345079-109345101 TTTATCTATTTTTTTACCTTTGG - Intergenic
1102837776 12:116082379-116082401 TCTATATATTTTTTCTCATTTGG - Intronic
1103531596 12:121606086-121606108 TTTATATATATTGTTTTCTTTGG + Intergenic
1103883137 12:124181974-124181996 TTTATATATTTTTTGAGATTTGG + Intronic
1104200915 12:126587938-126587960 TACATATATATTCTCTCCTTTGG - Intergenic
1104825339 12:131704046-131704068 TTTATATCTATTTCCAGATTTGG - Intergenic
1105219611 13:18313554-18313576 TTTATATATATATACATATTTGG + Intergenic
1106539554 13:30677720-30677742 TGTATATATATTTTTTTCTTTGG - Intergenic
1107033685 13:35879083-35879105 TTTATATATTTTTTAATTTTTGG - Intronic
1107165137 13:37274860-37274882 TTTATACATTTATTCCCCTTGGG - Intergenic
1107331447 13:39305627-39305649 TCTATATATATTTTTTCTTTTGG + Intergenic
1107620458 13:42223760-42223782 TATATATATATATTCATTTTTGG - Intronic
1107621959 13:42242600-42242622 GTTTTATGTGTTTTCACCTTTGG + Intronic
1107772948 13:43807974-43807996 TGTATATAGATCTTCCCCTTAGG + Intergenic
1107896706 13:44971908-44971930 TTTATTTTTTTTTTAACCTTGGG + Intronic
1108984670 13:56570459-56570481 TGTATATTTATTTTCTGCTTGGG - Intergenic
1109070703 13:57763383-57763405 TTTTTTTTTATTTTCCCCTTTGG - Intergenic
1109100124 13:58173253-58173275 TTTTCATATATTATCACATTTGG - Intergenic
1109191996 13:59336233-59336255 TTAATATATAATATCAACTTAGG + Intergenic
1109383232 13:61593083-61593105 TTTATATTTATATTTTCCTTTGG - Intergenic
1109568632 13:64155076-64155098 TATATGTATATTTTCATATTTGG - Intergenic
1109638671 13:65157567-65157589 TATATATATATTTTAAGTTTTGG + Intergenic
1109651610 13:65335090-65335112 TATATATATATTTTCCCACTAGG - Intergenic
1109697768 13:65983245-65983267 TTTAACAATATTTTCAACTTAGG - Intergenic
1109699319 13:66005064-66005086 TTTATATATATTCTCACTATAGG - Intergenic
1109776084 13:67042444-67042466 TTTATATTCTTTTTCTCCTTTGG - Intronic
1109882091 13:68492791-68492813 ATTAAATCTATTTTCAACTTGGG + Intergenic
1109912904 13:68940056-68940078 TTCATATTTACTTTCACCTTTGG - Intergenic
1110168898 13:72476155-72476177 TTTATGTATATCTTTATCTTGGG - Intergenic
1110169258 13:72481250-72481272 ATTAAATGTATTTTCAACTTAGG + Intergenic
1110415779 13:75250807-75250829 TATATATATATTCTTACCTCTGG + Intergenic
1110575593 13:77051641-77051663 TTCATATATATTATTTCCTTTGG - Intronic
1110997463 13:82130746-82130768 TTTTTATATATTCTCTCCTTAGG - Intergenic
1111255046 13:85656608-85656630 TTTGAAAATAATTTCACCTTTGG + Intergenic
1111311453 13:86492386-86492408 TTTATATATTTTTTTACCATTGG - Intergenic
1111354159 13:87077846-87077868 TATATATATAATCTCAACTTTGG - Intergenic
1111404773 13:87789630-87789652 TCGATACATCTTTTCACCTTAGG - Intergenic
1111491173 13:88977425-88977447 TTTATAGATTTATTCAACTTGGG + Intergenic
1111621117 13:90727192-90727214 TTTGTGTAAATTCTCACCTTAGG - Intergenic
1111796716 13:92930044-92930066 TTTATAAATATCTTCTCCATAGG - Intergenic
1111901181 13:94201477-94201499 TATATATATCTTAACACCTTTGG + Intronic
1112013322 13:95310292-95310314 TTTAAATATATTTTAAGATTAGG - Intergenic
1112036687 13:95503261-95503283 TTTCTTTACATTTTCTCCTTTGG - Intronic
1112660985 13:101507482-101507504 TTTATATATTTTTTATCATTAGG - Intronic
1112797167 13:103069151-103069173 TTTACATAAATTTGCACATTAGG + Intergenic
1112932515 13:104759829-104759851 TATATATATATATTTACCTGAGG - Intergenic
1113047243 13:106169056-106169078 TATATATATATATACATCTTTGG - Intergenic
1113240730 13:108334309-108334331 TTTATTTTTATTTTTACTTTTGG - Intergenic
1113283881 13:108824360-108824382 TTTTTGTACATTTTCACCATGGG - Intronic
1114202653 14:20537240-20537262 TTTATATATTTATTGACTTTAGG - Intergenic
1114937905 14:27567110-27567132 TTAATTTATCTTTTCATCTTGGG + Intergenic
1115023210 14:28708314-28708336 TTCATATATATCTTTACCTCAGG - Intergenic
1115471057 14:33769157-33769179 CTTATGTATGTTTTCTCCTTTGG + Intronic
1115701887 14:35961707-35961729 TTTATATTTTGTTTCTCCTTAGG - Intergenic
1116145058 14:41055534-41055556 TTTATGTATCTTTTTACCTGAGG - Intergenic
1116195474 14:41719777-41719799 TATATATATATATTTCCCTTTGG + Intronic
1116262116 14:42643900-42643922 TTTATATATACTTTAAGCTCTGG + Intergenic
1116383488 14:44301483-44301505 TTTAAATTTATTTTTACTTTAGG + Intergenic
1116413021 14:44648064-44648086 TTTATTTATATTCTTACCTGTGG - Intergenic
1116586455 14:46711009-46711031 TTTAAAGATATTTTCCCCTCTGG + Intergenic
1116615118 14:47126190-47126212 TTTATATATATCTTTAACCTGGG - Intronic
1116748779 14:48854674-48854696 TTTAAATAAATTGTCATCTTTGG - Intergenic
1117517942 14:56521105-56521127 TATATATATATCTCCAACTTAGG + Intronic
1118529174 14:66683318-66683340 TATATATATATTTCCACATTGGG - Intronic
1118643161 14:67811979-67812001 TTTATATATATTCTCACTGAAGG + Intronic
1119199011 14:72739410-72739432 TTCATATGTATTATCTCCTTTGG - Intronic
1119738082 14:76996671-76996693 TTTATATTTTTTTGCTCCTTGGG - Intergenic
1119895012 14:78212807-78212829 ATTAGATATATTTTTACTTTTGG + Intergenic
1120022260 14:79544051-79544073 TTTGTATTTATTTTCACTGTTGG - Intronic
1120292160 14:82589641-82589663 TTTATATATATTTTTTACATAGG - Intergenic
1120679251 14:87460339-87460361 TATATATATATATACACCTATGG + Intergenic
1120687256 14:87551977-87551999 TTTATATCTCTATTCACCTGTGG - Intergenic
1120946028 14:89997811-89997833 TTTATATATATATTCTATTTTGG + Intronic
1121302632 14:92884068-92884090 TTTTTTTATATTTTCATATTAGG + Intergenic
1121847824 14:97189097-97189119 TATACATATATTTTTATCTTAGG - Intergenic
1122031041 14:98912694-98912716 TTCATAAAAAATTTCACCTTTGG + Intergenic
1122342291 14:101036295-101036317 TTTATGTATAGATTTACCTTAGG - Intergenic
1123208185 14:106734152-106734174 TTTATATATATTTTTAGATGTGG + Intergenic
1202936739 14_KI270725v1_random:94537-94559 TTTTTTTATATGTTCACATTTGG + Intergenic
1124196448 15:27634901-27634923 TTTATAGATAGGTGCACCTTAGG + Intergenic
1125324274 15:38520370-38520392 GGTGTATATATTTTAACCTTTGG + Intronic
1125393318 15:39219692-39219714 GTTATATATAATTTAACTTTAGG - Intergenic
1125573357 15:40738042-40738064 TATATTTACATTTTCCCCTTAGG - Exonic
1125869682 15:43088246-43088268 TAAATATATATTTTCACACTTGG - Intronic
1126125935 15:45294371-45294393 TTTATATATGATTTCAACCTTGG - Intergenic
1126162464 15:45626618-45626640 TTTATATATTTTATCACATTTGG + Intronic
1126256480 15:46632563-46632585 TTAATACATATTTTCACTTTTGG - Intergenic
1126397465 15:48234366-48234388 ATGATATATATTTTGACTTTTGG + Intronic
1126450150 15:48798593-48798615 ATTATGTATCTTTTCATCTTTGG - Intronic
1126729496 15:51668321-51668343 TTTATATAAATTTTCCTCTTAGG - Intergenic
1126895122 15:53249220-53249242 TTTATATATATATATATCTTTGG - Intergenic
1127079183 15:55359169-55359191 TTTATGTATTTATTCACTTTTGG - Intronic
1127216381 15:56827028-56827050 TTTTTAAACATTTTGACCTTTGG - Intronic
1127401192 15:58587797-58587819 TTTATACATATTTCCATATTAGG + Intergenic
1128190052 15:65684532-65684554 TTTAGATCTATTTTTAACTTGGG + Intronic
1128440111 15:67698985-67699007 GTTAAAGATATTTTTACCTTTGG - Intronic
1128855357 15:71007302-71007324 ATTATATATTTTTTCATCTTTGG - Intronic
1129063956 15:72885385-72885407 TTTATATATGTCTTCACATCCGG + Intergenic
1129127836 15:73460099-73460121 TTTATAAATGTTTCCAACTTGGG + Intronic
1129172135 15:73814640-73814662 TTTCTAAATTATTTCACCTTTGG - Intergenic
1130801664 15:87270749-87270771 TTTATAAATATTTTCACCAAAGG - Intergenic
1130814655 15:87418576-87418598 TTTGGAAATATTTTCCCCTTTGG - Intergenic
1133693757 16:8241113-8241135 TTTAGAAAGATTTTCAACTTAGG + Intergenic
1134531189 16:14985168-14985190 TTTAAAAATTTTTTCATCTTAGG - Intronic
1135006455 16:18827783-18827805 TTTATATATATTTTGGTATTTGG + Intronic
1135716563 16:24774947-24774969 TTTATTTATATTTTTATTTTTGG + Intronic
1135746929 16:25025324-25025346 TGTATATATATTTTTGTCTTTGG + Intergenic
1135830759 16:25770901-25770923 TTTATACACATTGTCACTTTGGG + Intronic
1135949875 16:26904159-26904181 TAGACATATAGTTTCACCTTAGG - Intergenic
1136505984 16:30703498-30703520 TATATATATATTTTTAAGTTTGG + Intronic
1137076363 16:35968137-35968159 TTTGAATATATTTTCACCATAGG - Intergenic
1137354087 16:47742219-47742241 TTTATTGATATTTTCTCTTTGGG + Intergenic
1137487725 16:48905853-48905875 TTTATTTATATAATCACGTTAGG - Intergenic
1138115058 16:54354077-54354099 TTTATTTATTTATTCAGCTTGGG + Intergenic
1138405264 16:56787903-56787925 TTTAGATCTATTTATACCTTGGG + Intronic
1138715346 16:59015793-59015815 TATATCTATTTTTTCATCTTTGG - Intergenic
1139021237 16:62752788-62752810 ATTATATATATTTTTTCCTCTGG + Intergenic
1139125721 16:64074082-64074104 TGTATATACATTTTCTCATTGGG - Intergenic
1139129772 16:64127936-64127958 TGTATATACATTTTCATTTTAGG + Intergenic
1139158564 16:64475189-64475211 TTTATATAAATTTTCAATGTAGG + Intergenic
1139168722 16:64603617-64603639 TTTATATATTTTGTCAAGTTTGG - Intergenic
1139223404 16:65209157-65209179 TATATATATTTTTTCAAATTTGG - Intergenic
1139487809 16:67268701-67268723 TATATATATATTTTTACAGTAGG + Intronic
1139560854 16:67741046-67741068 ATTATATATAGTGTGACCTTTGG + Intronic
1139583888 16:67888742-67888764 TTAATATATCTCTTCACCTAAGG + Intronic
1140101783 16:71924245-71924267 TTTAATGATACTTTCACCTTTGG - Intronic
1140160680 16:72489366-72489388 TTGATATATATTTCCACCTAAGG - Intergenic
1140987754 16:80175096-80175118 TATATATATATTGTCAGCTTGGG + Intergenic
1141377043 16:83540993-83541015 TTTCTACATCTTTTCACCCTGGG - Intronic
1203013455 16_KI270728v1_random:324523-324545 TTTATATTGTTTTTCACCATTGG - Intergenic
1203031790 16_KI270728v1_random:597682-597704 TTTATATTGTTTTTCACCATTGG - Intergenic
1203039931 16_KI270728v1_random:736749-736771 TTTATATTGTTTTTCACCATTGG + Intergenic
1143820389 17:9556810-9556832 TATATATATATTTTAACACTTGG + Intronic
1143996281 17:11009215-11009237 GTTATATACATTCTCACTTTAGG + Intergenic
1144070823 17:11669861-11669883 TTTTTATATTTTTTCCCCATGGG + Intronic
1144333366 17:14245503-14245525 TTCAGATATATGTTCACATTAGG + Intergenic
1145100304 17:20070477-20070499 TTTATATATGTTTTTAGGTTTGG + Intronic
1145297689 17:21605223-21605245 TTTCTATGAATTTTCATCTTTGG - Intergenic
1145352567 17:22098201-22098223 TTTCTATGAATTTTCATCTTTGG + Intergenic
1146152746 17:30489977-30489999 TTTAAAGTTATTTTTACCTTTGG + Intronic
1146360580 17:32173145-32173167 TTAATATATATTTGCATCTGTGG + Intronic
1147503759 17:40993121-40993143 TTTATATATTTTGTCATATTTGG + Intergenic
1147883297 17:43667915-43667937 TATATATACATTTAAACCTTTGG + Intergenic
1148481226 17:47960645-47960667 TTTATAAAAATTTTCACCTTTGG + Intergenic
1149089398 17:52760465-52760487 TTTGAATCTATTTTCATCTTTGG - Intergenic
1149837832 17:59929811-59929833 TATATATATTTTTTAACCTCAGG + Intronic
1149925541 17:60698573-60698595 TTTGTATATATTATGACCTCAGG + Intronic
1149933083 17:60775544-60775566 TGTATATATAGGTTTACCTTGGG + Intronic
1150162640 17:62911964-62911986 TTTATTTATATTTTTTCCTCTGG + Intergenic
1150891972 17:69162628-69162650 TTTACATATATTTTAAGATTAGG - Intronic
1151925126 17:77189978-77190000 TTTATATATTTTTTCTCCTGTGG + Intronic
1152180930 17:78821378-78821400 TATATATATATATTCTCATTAGG - Intronic
1203166480 17_GL000205v2_random:101807-101829 TTTATTTATGTTTTAACTTTTGG + Intergenic
1153134414 18:1897752-1897774 TTTCTCTATTTTTTCACCCTTGG - Intergenic
1153214302 18:2804632-2804654 TTTTTCTATATTTTCACAGTTGG + Exonic
1153410449 18:4786896-4786918 TATATATATGTTTTCAACTGAGG - Intergenic
1153531904 18:6055206-6055228 TTTAAAGATATTTTAACCTTTGG + Intronic
1153784843 18:8525587-8525609 TTTATATTTATTTTCACAGAAGG - Intergenic
1154123552 18:11670701-11670723 TTAATATATTTTATCACTTTGGG + Intergenic
1155261384 18:24045881-24045903 TATATATATATTTTCACAGAAGG - Intronic
1155356679 18:24960308-24960330 TTTATACATATCTTCATCTCAGG - Intergenic
1155358299 18:24975445-24975467 TTTCTATTTATATTCATCTTTGG - Intergenic
1156054828 18:32988593-32988615 TTTATATATTTTTTTAAATTTGG - Intronic
1156183731 18:34637442-34637464 TTTATATATATTCTCCTTTTGGG - Intronic
1156253144 18:35371290-35371312 TTTATATATTTTTTCAAGTTAGG - Intronic
1156311357 18:35925240-35925262 TTTATGTATATTTTCAGATTTGG - Intergenic
1156658238 18:39313028-39313050 ATTATTTATATTTTCATCTCTGG - Intergenic
1157174746 18:45441221-45441243 TTTACATAATTTTTCAGCTTGGG + Intronic
1157866168 18:51186922-51186944 TATGTGTATATTTTCACTTTTGG + Intronic
1157882482 18:51333815-51333837 ATTATATATATTTTTACCTTTGG + Intergenic
1158805992 18:60973704-60973726 TTAATATATATTTTCACAAAAGG - Intergenic
1159192144 18:65060351-65060373 TATGTATATATTTTCATATTTGG - Intergenic
1159361740 18:67414017-67414039 TATAAATTTAGTTTCACCTTGGG + Intergenic
1159398374 18:67895223-67895245 TTTATATACATTTTCTTCTTTGG - Intergenic
1159455109 18:68651496-68651518 TTTATATATTTTTTTATGTTTGG + Intergenic
1159473210 18:68883115-68883137 TTTATATATACTTTTAAGTTTGG - Intronic
1159510014 18:69385175-69385197 TATATATATATTTATATCTTTGG + Intergenic
1159510634 18:69394548-69394570 TATATATATATTTTATTCTTAGG - Intergenic
1159737961 18:72126326-72126348 ATTATATATATTTTCATTTGTGG - Intergenic
1159793977 18:72819795-72819817 AGTATATATTTTTTCACTTTTGG - Intronic
1159826900 18:73224124-73224146 TATATATATATTTATACATTTGG + Intronic
1159873805 18:73788115-73788137 TTTATATATTCTGTCACTTTAGG - Intergenic
1160390880 18:78531623-78531645 ATTATTTATATTTTTTCCTTAGG + Intergenic
1162708870 19:12576849-12576871 TTTATATATATTTTTAAATATGG - Intronic
1165216833 19:34280485-34280507 TTTATAAATATTTTCATCTATGG + Intronic
1166233933 19:41442480-41442502 TATGTATATATATGCACCTTGGG + Intergenic
1166599080 19:44078049-44078071 GTGGTAAATATTTTCACCTTAGG - Intronic
1168619017 19:57862142-57862164 TCTATATGTATTGTCACTTTGGG - Exonic
924961574 2:39618-39640 TTTAGAAATGTTTGCACCTTTGG - Exonic
925521285 2:4748429-4748451 TTTTTAAATAGCTTCACCTTGGG - Intergenic
926016514 2:9457688-9457710 TTTATATACAATTCTACCTTGGG - Intronic
926543233 2:14206612-14206634 TTTATTTCTATTTCCTCCTTGGG - Intergenic
926767242 2:16332765-16332787 TATGTATATATTTTCACTTTAGG + Intergenic
928150148 2:28819893-28819915 TATATATATATTTTATCCTGAGG + Intronic
928766940 2:34658156-34658178 TTTACATATATTTTCATCATGGG - Intergenic
929250910 2:39754024-39754046 CTTTTATGTATTTTCACTTTAGG - Intronic
929430609 2:41883150-41883172 TTTCTATAGAATTCCACCTTTGG - Intergenic
929654721 2:43719051-43719073 TTTATTTACATTTTCTCATTTGG + Intronic
929842988 2:45490328-45490350 TTTATATAAATTTTCCCCCAAGG + Intronic
930889122 2:56362426-56362448 TATATATATATTTTAACTATGGG + Intronic
931115263 2:59159734-59159756 TATATACATATTTTCATTTTAGG - Intergenic
931158707 2:59664788-59664810 TTTTTTTTTTTTTTCACCTTTGG - Intergenic
931815574 2:65897431-65897453 CTTATATATTTTTCCACTTTTGG + Intergenic
931842297 2:66166286-66166308 TGTATGTATATTTACACTTTTGG - Intergenic
932368726 2:71170150-71170172 TTTAAAAATATTTTCACTTGTGG - Intergenic
932599852 2:73116029-73116051 TTTATATATATTATCACTCTTGG + Intronic
932661191 2:73653831-73653853 GTTATATATATTTTTATTTTCGG + Intergenic
932800016 2:74733395-74733417 TTTATAAATAAATTCAACTTGGG - Intergenic
932872678 2:75418753-75418775 TTTATATAAATTTTCATATTAGG - Intergenic
932965223 2:76466343-76466365 TTTATACAGATTTTCAACCTTGG + Intergenic
933051466 2:77608049-77608071 TTTGTATATATATTCACTATGGG - Intergenic
933056451 2:77674753-77674775 TTTATATATATTTTTACAGCTGG + Intergenic
933171794 2:79133201-79133223 TATATATATATTTTTGCCTATGG + Intergenic
933213279 2:79596375-79596397 CTTATATATATTATAACATTTGG - Intronic
933392826 2:81693744-81693766 CTTTTATATATTTTTATCTTAGG - Intergenic
933615678 2:84480169-84480191 TTTATAGATAATTTCTACTTTGG + Intergenic
933682262 2:85112600-85112622 TCTGTGTATATTTTCATCTTGGG - Intergenic
933926523 2:87095514-87095536 TTTATATATATTTTTACAGCTGG + Intergenic
934184437 2:89658965-89658987 TTTATATATATATACATATTTGG - Intergenic
934294722 2:91733103-91733125 TTTATATATATATACATATTTGG - Intergenic
935004759 2:99062182-99062204 GTTATATATATTTACAGATTAGG - Intronic
935088490 2:99871231-99871253 TTTATATATTTTTTGAATTTTGG - Intronic
935560970 2:104559551-104559573 TTTCTAGCTATTTTCAGCTTAGG - Intergenic
935723320 2:105998718-105998740 TGTATTTACATTTTCACATTGGG + Intergenic
935864069 2:107366181-107366203 TTTATATATATATACACACTGGG - Intergenic
935870675 2:107445567-107445589 TTTATATTTATGTTCTCTTTGGG - Intergenic
935876338 2:107512008-107512030 TTTCCCTATATTTTCACCATGGG - Intergenic
936819815 2:116506641-116506663 TTTGTATATATTTTCATCAAGGG + Intergenic
937147687 2:119661368-119661390 TTTATTTAAACTTTCAGCTTTGG + Intronic
937848852 2:126614499-126614521 TTCATGTATTTTTTAACCTTTGG - Intergenic
938048607 2:128146387-128146409 TTTATGAATATTTTCATCATAGG - Intronic
938616167 2:133001175-133001197 TTGATATATATGTACACCTTGGG + Intronic
938618276 2:133022000-133022022 TTATGATATATTTTCTCCTTTGG + Intronic
939121977 2:138128073-138128095 TTTATATAAGTTTTAAACTTTGG + Intergenic
939150756 2:138469713-138469735 TTTATATCTTTTTTCTGCTTTGG + Intergenic
939303982 2:140385757-140385779 TTTATGCATATATTCACATTTGG - Intronic
939435487 2:142171696-142171718 TATATATATATATACACCTTTGG + Intergenic
939447729 2:142332357-142332379 TCTATATATATTTTCTCTTATGG - Intergenic
939585088 2:143994398-143994420 TGGACATATATTTTCACTTTGGG - Intronic
939931746 2:148243429-148243451 TTTTCATATATTATAACCTTAGG - Intronic
940168869 2:150805096-150805118 TTTACATATGTATTCATCTTGGG - Intergenic
940552578 2:155179848-155179870 TTGCTATATAGTTTCACCTTGGG - Intergenic
940690373 2:156910865-156910887 TATATATATTTTTTCTTCTTCGG + Intergenic
941055827 2:160786811-160786833 TTCATATATATTCCTACCTTGGG - Intergenic
941066668 2:160910692-160910714 TATATATATTTTTTTCCCTTTGG + Intergenic
941129618 2:161630440-161630462 TTCATATATATTTTGACCACAGG + Intronic
941515725 2:166474051-166474073 TTTATATGTATTTTCAAATGTGG + Intronic
942075551 2:172354127-172354149 TATATATATATTTTGTCATTGGG + Intergenic
942373997 2:175317057-175317079 ATTAAATATATTTTCAACTTAGG + Intergenic
942539349 2:176999257-176999279 TTCATATATATTTTCCTGTTGGG - Intergenic
942951964 2:181731581-181731603 TTTGTCTATATTTTCCCCATGGG + Intergenic
943157730 2:184205807-184205829 TTTATATACATATGAACCTTTGG - Intergenic
943393059 2:187294923-187294945 TTCAAATATATTTTTACCTGTGG - Intergenic
943432636 2:187823992-187824014 TATATATATATTTTTACATTTGG + Intergenic
943711505 2:191100816-191100838 TTTATATATTTTATAACCTCTGG + Intronic
943801841 2:192070035-192070057 TATATATATGTCTTCACGTTTGG + Intronic
943824294 2:192369544-192369566 TAAATATATATATTCACGTTAGG - Intergenic
943888970 2:193260936-193260958 TTTATATATATATTTTCTTTTGG - Intergenic
944008937 2:194948021-194948043 TTTATTTATGGTTTCTCCTTTGG + Intergenic
944012396 2:194988428-194988450 TGTACATATTTTTTCACCTATGG + Intergenic
944384435 2:199148972-199148994 CTCATTTATATTTTTACCTTTGG - Intergenic
944589816 2:201206431-201206453 TATATATATATATTCACAGTAGG - Intronic
945134885 2:206616539-206616561 TTTATACCTATTTTGAGCTTTGG + Intronic
945338536 2:208621297-208621319 TATATATATATATTCTGCTTTGG + Intronic
945470918 2:210226904-210226926 TATATATATATTTTTATATTTGG + Intergenic
945553737 2:211253738-211253760 TTGATGTATCTTTTCTCCTTGGG + Intergenic
945827787 2:214745621-214745643 TTTACATATGTTTTAACCATTGG - Intronic
945845750 2:214942647-214942669 TTTATTCATTTTTTCATCTTTGG + Intronic
945913348 2:215675649-215675671 TTTATATGTATTTTTAAATTGGG + Intergenic
946975272 2:225141477-225141499 TTTATATATTTCTTCAGGTTTGG - Intergenic
947003081 2:225479941-225479963 TCTTAATATATATTCACCTTTGG - Intronic
947303630 2:228718551-228718573 TTTATTTATTTTTTCAGATTGGG + Intergenic
947477097 2:230460098-230460120 GGTATGTATATTTTCACCTTTGG - Intronic
947919945 2:233861441-233861463 TATATATATATTTTCATTTATGG - Intergenic
948170476 2:235897806-235897828 TTTATAAATATTTTCTTCTTTGG + Intronic
948210977 2:236192956-236192978 TCCATATATATATACACCTTGGG - Intergenic
948924994 2:241089939-241089961 TTTATATCTATTTTTACTGTAGG - Intronic
1169904069 20:10582591-10582613 TAAATCTATATTTTCAACTTGGG + Intronic
1169978417 20:11356551-11356573 TATATATATATATTCACCTTAGG - Intergenic
1169992581 20:11519917-11519939 CTTATATTTATTTGCACTTTGGG - Intergenic
1170000260 20:11607155-11607177 TTTTTGTATATTTTAACCTAAGG - Intergenic
1170001559 20:11620512-11620534 TATATATGTATTTTAATCTTTGG - Intergenic
1170290523 20:14763947-14763969 TATGTATATACTTTCCCCTTGGG + Intronic
1170338543 20:15297888-15297910 TTTATATAATTTTTCCACTTGGG + Intronic
1170895442 20:20408968-20408990 TTTAAAAATATTTTCTCATTAGG + Intronic
1171092788 20:22301879-22301901 TATATATATATTTTAACATTTGG - Intergenic
1172339912 20:34148904-34148926 TTTATTTATATTTTTATCCTGGG - Intergenic
1172429480 20:34877439-34877461 TTTATTTATTTTTTTAACTTGGG + Intronic
1173009602 20:39169983-39170005 TCAATAAATATCTTCACCTTTGG + Intergenic
1175436335 20:58952674-58952696 TTTATATAGTTTTTCTTCTTGGG - Intergenic
1176335106 21:5589520-5589542 TTTGTTTTTCTTTTCACCTTAGG - Intergenic
1176392651 21:6231428-6231450 TTTGTTTTTCTTTTCACCTTAGG + Intergenic
1176405275 21:6357289-6357311 TTTATTTATGTTTTAACTTTTGG - Intergenic
1176431882 21:6631814-6631836 TTTATTTATGTTTTAACTTTTGG + Intergenic
1176468768 21:7084746-7084768 TTTGTTTTTCTTTTCACCTTAGG - Intronic
1176492329 21:7466524-7466546 TTTGTTTTTCTTTTCACCTTAGG - Intergenic
1176508313 21:7671859-7671881 TTTGTTTTTCTTTTCACCTTAGG + Intergenic
1176586574 21:8594439-8594461 TTTTTTTATATGTTCACATTTGG - Intergenic
1177065314 21:16426022-16426044 TTTATTTATAATTTCATTTTGGG - Intergenic
1177071411 21:16513452-16513474 TTTATAAATATTTTCAATGTAGG + Intergenic
1177325834 21:19587544-19587566 TTAATATAAATTTCCACCTTAGG - Intergenic
1177448908 21:21239227-21239249 TTTATATATATTTTTAATATGGG - Intronic
1177465662 21:21476203-21476225 TTTATTTATATTTATACCCTGGG + Intronic
1177479823 21:21671837-21671859 TTTAATAATTTTTTCACCTTAGG - Intergenic
1177617493 21:23542149-23542171 TTAAATTATATTTTCTCCTTAGG - Intergenic
1177638447 21:23815787-23815809 CTTATTTATATTTTCTCCCTGGG + Intergenic
1177688375 21:24470094-24470116 TTTATATTGGTTTTCAACTTTGG - Intergenic
1177864247 21:26493830-26493852 TTTATAAACATGTTCATCTTTGG - Intronic
1177871902 21:26583637-26583659 TATATATATATCATCACCATAGG + Intergenic
1177885484 21:26741223-26741245 TCTATAGATATTCTCATCTTGGG + Intergenic
1177950510 21:27529941-27529963 TTTATATTTATATTCTACTTAGG - Intergenic
1178329796 21:31678047-31678069 TCTATTTACATTTTCTCCTTAGG + Intronic
1178345874 21:31827586-31827608 TCTGTATATCTTTTCACTTTGGG - Intergenic
1178565772 21:33682843-33682865 TTTATATTTATTGTCACACTAGG + Intronic
1178786776 21:35661062-35661084 TTCATATATATTTTTAAATTTGG + Intronic
1179089776 21:38253920-38253942 TTTATATTTGTTTTTATCTTCGG + Intronic
1179772596 21:43633973-43633995 TTTATATTTACTGGCACCTTTGG - Intronic
1180031931 21:45217111-45217133 TTTATATATATTTATATGTTTGG + Intronic
1180234903 21:46452498-46452520 TCCATGTATATTCTCACCTTGGG + Intergenic
1180269382 22:10571344-10571366 TTTTTTTATATGTTCACATTTGG - Intergenic
1182389258 22:29977525-29977547 CTTTCATATATTTTCAACTTGGG + Intronic
1182888968 22:33800305-33800327 GTTATATAAATTATCACCATTGG - Intronic
1182948992 22:34353819-34353841 TATATATATATTTTTTACTTTGG + Intergenic
1182971293 22:34580754-34580776 ATAATATACATTTTCCCCTTAGG + Intergenic
1184515888 22:44962348-44962370 GTTAAATGTATTTTCAACTTAGG - Intronic
1185198442 22:49487456-49487478 TTTTTATGTATTTTCTGCTTGGG + Intronic
949110285 3:252468-252490 TTTATCTTTATTTTTACCTTAGG + Intronic
949381659 3:3453460-3453482 TTCATTTTTATTTTCACCTCTGG + Intergenic
949902447 3:8828293-8828315 TTTACTTATATTTTCAACTTAGG + Intronic
950269512 3:11602533-11602555 TTTATATTTCTTTTAACTTTCGG - Intronic
950562287 3:13739883-13739905 TCTTTGTATATTTTCAGCTTGGG + Intergenic
950960473 3:17100448-17100470 CATATATATATTTTCTGCTTTGG - Intergenic
951258231 3:20476075-20476097 TTTAAATATATTTTTACATACGG - Intergenic
951635065 3:24764871-24764893 TAAATATATATTTTAAACTTTGG + Intergenic
951903764 3:27682838-27682860 TTTATTTATTTTTTTACATTGGG - Intergenic
952539382 3:34351456-34351478 GTTATAAATATATTCACCCTGGG + Intergenic
953113174 3:39963691-39963713 TATACATAAATTTTCAACTTTGG - Intronic
953148580 3:40303154-40303176 TTTATATATATTACCCCCTTAGG - Intergenic
953275959 3:41498432-41498454 ATTCTATAAATTCTCACCTTAGG + Intronic
953487614 3:43317128-43317150 TTTATATAAATATTAACTTTTGG - Intronic
954457348 3:50607091-50607113 TTTATTTATTTATTCTCCTTGGG - Exonic
955029139 3:55199599-55199621 ATTATTTATATTTTCTGCTTTGG + Intergenic
955051158 3:55412320-55412342 TTTACATATATTATCACTCTTGG - Intergenic
955814081 3:62823435-62823457 TTTAATTATATTTTCCCTTTGGG + Intronic
955994089 3:64660249-64660271 TTAATTTTTATTTTTACCTTTGG - Intronic
956186161 3:66564113-66564135 TGTATATATACACTCACCTTAGG - Intergenic
956337208 3:68177543-68177565 ATTAGATATATTGTCATCTTGGG + Intronic
956996103 3:74827941-74827963 TATATATATATATTTACCTCTGG - Intergenic
957231518 3:77523367-77523389 TCTGTATTCATTTTCACCTTTGG - Intronic
957393849 3:79615569-79615591 TTAATCTATATTTTTAGCTTAGG - Intronic
957414555 3:79884496-79884518 TTTATTTATCTTTATACCTTTGG + Intergenic
957490803 3:80924369-80924391 TTTATTTATTTTTTCAACATGGG - Intergenic
957646094 3:82930012-82930034 TATATATATATTTGCATTTTGGG - Intergenic
957694086 3:83611102-83611124 TTTTTATATAGTATAACCTTGGG + Intergenic
957728407 3:84099164-84099186 CTCCTATATATTTTCACGTTTGG - Intergenic
957741388 3:84274400-84274422 TTTAGAGTTATTTTCCCCTTAGG + Intergenic
957808086 3:85177707-85177729 GTTAGATATAATTTTACCTTGGG - Intronic
957945039 3:87052882-87052904 TTAATGTAAATTTTCACCCTAGG + Intergenic
957979945 3:87495708-87495730 TTTCTATAAATTTTCACTCTGGG - Intergenic
958092973 3:88901235-88901257 TTTGTATTTATTTTCTCCTGCGG - Intergenic
958105398 3:89066292-89066314 TTGCTATTTATTTTCAACTTTGG - Intergenic
958584260 3:96066491-96066513 TATACATATGTTTTCGCCTTTGG - Intergenic
958613232 3:96454334-96454356 TTCATATATATAGTCACCTTAGG + Intergenic
959224880 3:103567469-103567491 TACATATATATTTTATCCTTGGG + Intergenic
959430966 3:106254699-106254721 TTTCTATTTTTATTCACCTTTGG - Intergenic
959472716 3:106772530-106772552 TTAATAAACATTTTCAGCTTTGG + Intergenic
959840691 3:110970780-110970802 TTTATTTACATTTTCAACGTTGG + Intergenic
960210583 3:114960486-114960508 TGTCTATATGTTTTAACCTTGGG - Intronic
961155936 3:124679753-124679775 TTGCTAAATATTTTCTCCTTTGG + Intronic
961483762 3:127201814-127201836 TTTATTAATATTTTCTCTTTTGG + Intergenic
962528578 3:136257582-136257604 TATATACATATTTCCACCTCTGG - Intronic
962628887 3:137255998-137256020 TTTACATGTATTGTGACCTTGGG + Intergenic
962687112 3:137858375-137858397 TATATATATATTTTCTCCCAGGG - Intergenic
962757479 3:138476899-138476921 TATGTATATATTTTTTCCTTTGG + Exonic
962857192 3:139358278-139358300 TTCATATATATCTTCACTTGTGG - Intronic
963049954 3:141132661-141132683 TATATATATATTATCATATTTGG + Intronic
963261422 3:143195467-143195489 TATATATATATATGCCCCTTTGG + Intergenic
963312035 3:143720246-143720268 TATATATTTTTTTTCACATTTGG + Intronic
963360261 3:144263579-144263601 CTTTTATTTATTTTCTCCTTTGG + Intergenic
963760939 3:149286858-149286880 TATATATATATATAAACCTTGGG + Intergenic
963924916 3:150941242-150941264 TTTATATATATAATCAAATTAGG + Intronic
964092944 3:152897273-152897295 TATATATATATACTCTCCTTGGG - Intergenic
964103200 3:153011403-153011425 TTTATATAAGTTTTGTCCTTAGG - Intergenic
964498044 3:157315837-157315859 TTTATATTTGGTTTCATCTTTGG - Intronic
964838330 3:160965594-160965616 ATTAAATGAATTTTCACCTTAGG + Intronic
964986938 3:162753830-162753852 TATATATATATTTGCATCTTAGG - Intergenic
965042832 3:163532915-163532937 TATATATATTTTCTCACCTCAGG - Intergenic
965217846 3:165887069-165887091 TATATATATATTTTTATATTTGG - Intergenic
965518264 3:169645737-169645759 ATTATATATATTTTCATATAGGG - Intronic
966235705 3:177699718-177699740 TTTATATTTATTTTAAACTATGG - Intergenic
966641843 3:182200527-182200549 TTTATACATATTTTCAGATCCGG - Intergenic
966699432 3:182830386-182830408 TTTTTATGTATTTTCCCCCTGGG + Intronic
966699466 3:182830987-182831009 TCTATATATACTTTCACCTTAGG + Intronic
967252551 3:187556261-187556283 TTTATATATTTTTCCAACATTGG - Intergenic
967616813 3:191579794-191579816 TTTATATATATATTAATTTTAGG + Intergenic
967618924 3:191608029-191608051 TTTAAATATATTTTAAAATTAGG - Intergenic
967652421 3:192002966-192002988 GATATAAATATTCTCACCTTTGG - Intergenic
967765604 3:193276131-193276153 TGTATATATATTTTAAAATTTGG + Intronic
968474769 4:799002-799024 TATATATATGTTTTCATCTATGG + Intronic
969886917 4:10223146-10223168 TGCATATATATTCTGACCTTGGG + Intergenic
970521970 4:16894027-16894049 TTTACCTATATTTTCATCTCAGG + Intronic
970711218 4:18864827-18864849 TTTTCATATATTTTCACTTCAGG + Intergenic
970748135 4:19324896-19324918 TTTATATACATCTTCTCCCTAGG + Intergenic
970908622 4:21247726-21247748 TATATATATATATCCACCTGTGG - Intronic
970908629 4:21247791-21247813 TATATATATATATCCACCTGTGG - Intronic
970908632 4:21247838-21247860 TATATATATATCTCCACCTGTGG - Intronic
971069689 4:23077527-23077549 TGAATATCTATTTTCACCATTGG - Intergenic
971099900 4:23454224-23454246 TTTATATTTATTTTATACTTTGG + Intergenic
971691159 4:29838432-29838454 TTTATATATCTTATCAACTTGGG + Intergenic
971988637 4:33862541-33862563 TTTCTATGAATTTTCATCTTTGG - Intergenic
972092706 4:35307565-35307587 TTCTTATATTCTTTCACCTTTGG + Intergenic
972189918 4:36577695-36577717 TTTATGTATTTTTGCAACTTGGG - Intergenic
972478451 4:39475205-39475227 TGTATATATATTTTTTCTTTTGG - Intronic
972604698 4:40603424-40603446 TTTATACATATGTTCACCAAAGG - Intronic
973111634 4:46404537-46404559 TATATATATATTTTAATTTTGGG + Intronic
973166469 4:47083979-47084001 TTTACAGATATTTTTTCCTTTGG - Intronic
973185125 4:47317847-47317869 TATATATATATATTCACATACGG + Intronic
973235412 4:47897601-47897623 TTTATATAAACTATGACCTTTGG - Intronic
973901822 4:55482828-55482850 TTTATTTTTCTTTTCACCTAAGG - Exonic
973964109 4:56143595-56143617 ATTATATATTTTTTCTTCTTAGG + Intergenic
974181666 4:58391555-58391577 TTTATATATATTGTGCCATTTGG - Intergenic
974327591 4:60434824-60434846 TTTGTATAGATTTTCAAATTAGG + Intergenic
974452621 4:62086455-62086477 TTTATATATATATTCACAACAGG + Intergenic
974492243 4:62581355-62581377 TTTATACATATTTTCCCCTGAGG - Intergenic
974696820 4:65387170-65387192 TTGATAGTGATTTTCACCTTAGG + Intronic
974783324 4:66583623-66583645 TTTATATGTAATATCAACTTAGG - Intergenic
974884367 4:67799292-67799314 TTCATTTATTTTTTCACCTTTGG + Intergenic
974982849 4:68981916-68981938 TTAATATATATTTGGACATTAGG + Intergenic
975515401 4:75242365-75242387 TTTATTGATATTTCCACCTTGGG - Intergenic
976017140 4:80570819-80570841 TTTATTTATCCTTTCTCCTTTGG - Intronic
976844889 4:89476671-89476693 TTTATATATATTGTAAGTTTTGG - Intergenic
977032399 4:91902334-91902356 TATATATATTTTTTCCCCTGTGG + Intergenic
977230214 4:94442732-94442754 TTTATATATATTTCCATCTTTGG + Intergenic
977907330 4:102493090-102493112 ATTTTACATCTTTTCACCTTAGG + Intergenic
978035018 4:103982062-103982084 TATATATATTTTATCACCCTAGG + Intergenic
978229412 4:106380661-106380683 TTTAGATATATTTTCAGCACTGG - Intergenic
978526383 4:109671041-109671063 TTTATCTATCTTTTCAATTTTGG + Intronic
978593788 4:110355251-110355273 TTTATCTGTATTTTTATCTTGGG - Intergenic
978674565 4:111295738-111295760 TTTACATATATTCTCACCAAGGG - Intergenic
978848630 4:113306692-113306714 TATATATATATTTTCAGTTAAGG + Intronic
979040758 4:115790345-115790367 TAGATATAAATTTTCCCCTTAGG + Intergenic
979064130 4:116105580-116105602 TTTAAATCTTTTTTCCCCTTAGG - Intergenic
979065282 4:116123667-116123689 TTAATATATATATTTAGCTTGGG - Intergenic
979201338 4:117982663-117982685 TTTATTTATATTTTTATTTTAGG - Intergenic
979251619 4:118572259-118572281 TTTATCTCGATTTTCAACTTTGG + Intergenic
979786921 4:124727117-124727139 TCTATATATAATTTCCACTTTGG + Intergenic
979870740 4:125817361-125817383 TTTAGGCATATTTTCCCCTTAGG + Intergenic
980181804 4:129410300-129410322 ATAGTAAATATTTTCACCTTTGG - Intergenic
980227517 4:130005829-130005851 TATATATATATATTCAAATTTGG + Intergenic
980254967 4:130367725-130367747 TTTATGAATATTTTTACTTTGGG - Intergenic
980513081 4:133819554-133819576 ATAATATATATTTTCATCTTTGG - Intergenic
980583134 4:134780224-134780246 CTTATGTATATTTTCATGTTTGG + Intergenic
980595153 4:134945462-134945484 ATTATCTACATGTTCACCTTAGG + Intergenic
980640491 4:135571303-135571325 TTTATATCTTTTTTCTGCTTTGG - Intergenic
980759328 4:137208588-137208610 TTTATATATTCATTCAACTTTGG + Intergenic
980784834 4:137538659-137538681 ATTGGAGATATTTTCACCTTCGG - Intergenic
981599933 4:146475677-146475699 GTTATATTTATCTTCACCTGAGG - Intronic
981854428 4:149271143-149271165 TGGATATATATTTTCTTCTTTGG + Intergenic
981864686 4:149402330-149402352 CTTATATATTTTGTGACCTTAGG - Intergenic
981864901 4:149405819-149405841 TATATATATATATGCTCCTTAGG - Intergenic
981893996 4:149774828-149774850 TTTATATATACTTTCCTCCTGGG - Intergenic
981975153 4:150719115-150719137 AGTATATATATTTTCAGTTTCGG - Intronic
982407951 4:155041705-155041727 TTTCTTTATATTCTCACCATCGG - Intergenic
982413997 4:155110652-155110674 TAGTTAGATATTTTCACCTTTGG - Intergenic
982620832 4:157702923-157702945 TTTTTATTTATTTTCAGTTTTGG - Intergenic
982697942 4:158624873-158624895 TTTGAATTTATTTTAACCTTGGG - Intronic
982879669 4:160696948-160696970 ATTAAATGTATTTTCACTTTAGG + Intergenic
982888498 4:160815970-160815992 TTATTTTATATTTTCACCTTTGG + Intergenic
983789333 4:171776066-171776088 TTGAATAATATTTTCACCTTTGG - Intergenic
984045604 4:174793837-174793859 TTCATATATATTTTCAGATATGG + Intronic
984205985 4:176788549-176788571 ATTAAATATATTTTCAACTCAGG - Intronic
984230107 4:177086125-177086147 TTTTTATATGTATTCATCTTTGG - Intergenic
984424036 4:179560716-179560738 TTTTTATATAATTTCACATTAGG + Intergenic
984455278 4:179958549-179958571 TATATATATATCTTCAACTCTGG - Intergenic
984838516 4:184045646-184045668 AATATATATATTTTTACCTTTGG + Intergenic
985397839 4:189563631-189563653 TTTGTGTATTTTTTGACCTTAGG - Intergenic
986420775 5:7579261-7579283 TTTTTATAGATTTTGGCCTTAGG + Intronic
986823363 5:11493850-11493872 TCTATAAATATTTTCAACATAGG + Intronic
986831235 5:11581001-11581023 TTTATATATGATTTCACATATGG + Intronic
987609521 5:20184106-20184128 TTCAAAAATATTTTCACCTGAGG + Intronic
987799932 5:22681696-22681718 TTTATATATAGTGACACTTTTGG - Intronic
987906241 5:24081386-24081408 TATATTTATATTTTCACCAATGG + Intronic
987941379 5:24543110-24543132 TTTACTTTTATTTTCACCATTGG + Intronic
988037447 5:25845857-25845879 TTTGTATATATTTTTTGCTTTGG - Intergenic
988180850 5:27789763-27789785 TTAAAATGTATTTTCACCTGTGG + Intergenic
988332843 5:29864819-29864841 TCTAAAAATATTTTCCCCTTTGG - Intergenic
989012507 5:36889075-36889097 TTTGAATATATTTTCAGTTTGGG + Intronic
989079801 5:37606757-37606779 TTTATTCATATTTTTACATTTGG + Intronic
989283578 5:39672900-39672922 TTTATATATATTTTAATGTGTGG + Intergenic
989568270 5:42923209-42923231 TTTATATATTTTTTTATTTTTGG + Intergenic
989738155 5:44733500-44733522 TTAATATAGATTTTTTCCTTTGG - Intergenic
989810696 5:45669564-45669586 TCTATGTATAGTTTCCCCTTTGG - Intronic
989972150 5:50537262-50537284 TATATATATATTTTTAATTTGGG - Intergenic
990029873 5:51244930-51244952 TTTATATATATTTTTACTATTGG - Intergenic
990104042 5:52233958-52233980 TTTATTAATATTTTCCTCTTAGG - Intergenic
990405128 5:55482054-55482076 TATATTTATATTTCCCCCTTTGG - Intronic
990405129 5:55482128-55482150 TATATTTATATTTCCCCCTTTGG + Intronic
990801152 5:59605221-59605243 TGAATACTTATTTTCACCTTTGG - Intronic
990821263 5:59843074-59843096 TTTATTTATTTTTTTACCTCAGG + Intronic
990999381 5:61767524-61767546 TTTTTATGTATTTTCCCCTTAGG - Intergenic
991147095 5:63319579-63319601 TTTATATATCATTTAATCTTTGG - Intergenic
991376621 5:65974755-65974777 TCTATATATACTCACACCTTTGG - Intronic
992553050 5:77877317-77877339 TTTAGATATACTTTCACTTTCGG - Intergenic
992628460 5:78656990-78657012 TTTATATATATTTTTTCTTTTGG - Intronic
992927160 5:81600184-81600206 TTTATAGATATTTCTACCTGTGG + Intronic
993230956 5:85235599-85235621 TTCAAATATTTTTTCTCCTTTGG - Intergenic
993571589 5:89546652-89546674 TTTCAATATATTTTCAACTTGGG - Intergenic
993996705 5:94731920-94731942 TTTATTTATTCTTTTACCTTAGG + Intronic
994013339 5:94935133-94935155 TATATATATATCTTCACATCTGG + Intronic
994149139 5:96428252-96428274 TATATATATATTTTCCCCCTGGG + Intronic
994278191 5:97865271-97865293 TTTATATATAATTTTACTTCAGG - Intergenic
994384276 5:99110948-99110970 TTTATATCTATTGCTACCTTAGG + Intergenic
994465326 5:100121240-100121262 TTTATATTTTTCTTGACCTTAGG + Intergenic
994498988 5:100550403-100550425 TATATATAAATTATCACCCTTGG - Intronic
994533064 5:100991219-100991241 TTCATATATGTTTTTATCTTGGG + Intergenic
994631416 5:102293050-102293072 TTGAAATATATTTTCAGCTACGG - Intronic
994649692 5:102511004-102511026 TGTATATATATTTTTAACTTAGG - Intergenic
994676451 5:102828854-102828876 GTCATATATATTTTCAGCCTAGG - Intronic
994942367 5:106341133-106341155 TTCACATATATTTTCACGGTTGG + Intergenic
995082745 5:108073004-108073026 TTTACACATATTTTTACCTCAGG + Intronic
995299529 5:110561900-110561922 TTTAAAAATATTTACACATTGGG - Intronic
995314566 5:110753538-110753560 TTTAGATATATTTACATGTTTGG + Intronic
995555159 5:113320329-113320351 TTTCTATATATTTGCCACTTAGG - Intronic
995591889 5:113708028-113708050 TCCATATATATTCTTACCTTTGG - Intergenic
995637097 5:114205708-114205730 ATTAAATATGTTTTCACCTAAGG + Intergenic
996115762 5:119616448-119616470 ATTATATATACTTTTATCTTGGG + Intronic
996252785 5:121357690-121357712 TTTAAACATATTTTAACATTAGG - Intergenic
996260030 5:121455801-121455823 TTTATATTAATATTCAACTTAGG - Intergenic
996315254 5:122153814-122153836 TTTATCTAAAGTTTCACCATGGG + Intronic
996809087 5:127494256-127494278 ATTATATGTATTTATACCTTTGG - Intergenic
997161006 5:131609287-131609309 TTTACATATATTTTCACCTTGGG - Intronic
997378035 5:133411533-133411555 TTTATTTCTATTTTCACTCTAGG - Intronic
997555098 5:134790448-134790470 TTTATTTTTCTTTTCATCTTAGG + Exonic
997635732 5:135403771-135403793 TTTAAATATTTTTTCCCCTGAGG + Intergenic
997739706 5:136242897-136242919 TGTATATTTATTCACACCTTGGG + Intronic
997891431 5:137680419-137680441 TTAATATATATTATTATCTTTGG - Intronic
997911961 5:137883738-137883760 TATATATATATTTTTTCCTGTGG - Intronic
998816632 5:146021146-146021168 AATATATATATTTTTTCCTTTGG + Intronic
998816639 5:146021211-146021233 AATATATATATTTTTTCCTTTGG + Intronic
998909247 5:146940538-146940560 TTTTTAGATATGTTCTCCTTGGG - Intronic
998938845 5:147259235-147259257 TTTATATATTTTTTGACTTAGGG + Intronic
999446851 5:151646968-151646990 TTTCTATACATTGTCACCTAAGG + Intergenic
999487666 5:152015222-152015244 TATATATATATTTTTTTCTTTGG + Intergenic
999857886 5:155614881-155614903 TATATATATATTTTAAATTTTGG + Intergenic
1000622289 5:163499567-163499589 TTTATTGATATTTTCCCTTTTGG + Intergenic
1000907979 5:166986594-166986616 TTCATATATACTTTCAAATTTGG - Intergenic
1002126553 5:177049804-177049826 TCTACATATATTTTCTCCTTTGG - Intronic
1002179133 5:177420938-177420960 TATATATATGTTGCCACCTTGGG - Intronic
1002382909 5:178843016-178843038 CTTATAAATATTTACACCTATGG - Intergenic
1002951756 6:1819786-1819808 TATATATATATATCTACCTTGGG + Intronic
1003103701 6:3197247-3197269 TTTATTTATATTTGCACCCCTGG + Intergenic
1003105873 6:3215349-3215371 TATATATAGATTTTCAACTAGGG - Intergenic
1003272286 6:4618048-4618070 ATTATATATATTTTTTCCTGTGG - Intergenic
1003454079 6:6264557-6264579 TTTATCTATATTTTCTCCCTAGG + Intronic
1003612254 6:7624386-7624408 GTTATACATATTTTCACCCAGGG - Intergenic
1003666020 6:8112203-8112225 TTTATATAAATTTTCACTGTAGG + Intergenic
1003808968 6:9758526-9758548 TTTATATCTATTTTCTCGGTGGG - Intronic
1004248629 6:14003681-14003703 TATATATATATATCCACGTTGGG + Intergenic
1004288070 6:14341069-14341091 TTTATATCTGTTTTCCCCTATGG + Intergenic
1004885159 6:20044146-20044168 TCTATTTATACTTTCACCCTGGG - Intergenic
1005086258 6:22009972-22009994 GTTATATATAGTTTCACTTAAGG - Intergenic
1005212712 6:23486425-23486447 TTTATATATCCATTCATCTTGGG - Intergenic
1005219847 6:23573874-23573896 TTAATATATGTTGTTACCTTAGG - Intergenic
1005339001 6:24825706-24825728 CTTCTGTATATTTTTACCTTGGG - Intronic
1005679112 6:28188075-28188097 TTTATATATTTTTTCACCTGTGG - Intergenic
1005682385 6:28219376-28219398 TTTATATATAATTTTGCCCTGGG - Intergenic
1005771724 6:29080390-29080412 TTTATAAATATTTATACTTTGGG - Intergenic
1006262787 6:32890171-32890193 CTTAAATATATATGCACCTTAGG - Intergenic
1007196464 6:40065750-40065772 TTTATATATAGCTTCAACATTGG - Intergenic
1007912602 6:45530889-45530911 TTTATTTTTACTCTCACCTTTGG - Intronic
1008968757 6:57342006-57342028 AATAAATATATTTTTACCTTAGG + Intronic
1009157739 6:60243824-60243846 AATAAATATATTTTTACCTTAGG + Intergenic
1009247377 6:61255931-61255953 TTTTTATATATTTCCAATTTAGG + Intergenic
1009543446 6:64995639-64995661 TTTAAATATATTTTAACATAAGG - Intronic
1009590614 6:65664660-65664682 CTTATAAATTATTTCACCTTAGG + Intronic
1009887078 6:69636358-69636380 TTTATATTTCTTTTCATCATAGG - Intergenic
1009897677 6:69773424-69773446 TTTTTATGTATTTTGAACTTAGG - Intronic
1009930298 6:70169356-70169378 TTTGTATATATTTTAACCTTTGG + Intronic
1010067692 6:71704269-71704291 TTTATATATCTTTTCATGTCTGG - Intergenic
1010098433 6:72074664-72074686 ATGATATATTTTTTCCCCTTTGG - Intronic
1010165293 6:72907305-72907327 TTTATTTGAATTTTTACCTTAGG - Intronic
1010256859 6:73768389-73768411 TACATATATATTTTCACTTGTGG + Intronic
1010315473 6:74443946-74443968 TTGAGAAATATTTTCAGCTTGGG + Intergenic
1010488178 6:76441220-76441242 TTTATATGTATTTTAAAATTTGG + Intergenic
1010579747 6:77580944-77580966 TTTATAAATATTTTTACATTAGG - Intergenic
1010713585 6:79203803-79203825 TTCATAACTATTTTCACCCTGGG + Intronic
1010778558 6:79916147-79916169 TGTATACACATTTTCAGCTTTGG + Exonic
1010823423 6:80443673-80443695 TTTATATATTTTTTAACTGTAGG + Intergenic
1011046039 6:83084110-83084132 ACTATTTATATTTTCACTTTAGG - Intronic
1011111897 6:83847655-83847677 TTTATTTATTTTTTAATCTTTGG - Intergenic
1011762219 6:90579520-90579542 TTTAAATATATCTTGAGCTTGGG - Intronic
1012023345 6:93955078-93955100 TTTATAAATATTCTTACCTATGG + Intergenic
1012046732 6:94285304-94285326 TTTATATATTAATTCACCTATGG + Intergenic
1012238040 6:96839945-96839967 TATATATATATATTCAACTTGGG + Intergenic
1012304698 6:97639388-97639410 TTTATTTAGTTTTTCATCTTAGG + Intergenic
1012811110 6:103959464-103959486 TTTCTATTTATTAGCACCTTAGG - Intergenic
1012979319 6:105813015-105813037 TTTATTTATATTTTTATTTTGGG - Intergenic
1013010023 6:106111773-106111795 TTTCTAGATATTTTTTCCTTGGG + Intergenic
1013051646 6:106541616-106541638 TACATATATATTTTTACCTTTGG - Exonic
1013259401 6:108426028-108426050 TTTATAAATATTCTAAACTTTGG - Intronic
1013501708 6:110758656-110758678 AATATATATATTTTTATCTTTGG - Intronic
1013958515 6:115869187-115869209 TTTAAATATATTGTCTCTTTAGG + Intergenic
1013971677 6:116027437-116027459 TTTCTGTATCTTTTCACCTTTGG - Intronic
1014016817 6:116540715-116540737 TTAATTTATATTGTCAACTTTGG - Intronic
1014366187 6:120545053-120545075 TTTATTTATTTTTTCTTCTTTGG - Intergenic
1014570940 6:123006545-123006567 TTTATATATTTATACATCTTTGG - Intronic
1015027259 6:128550417-128550439 TTTACTTACATTTTCACTTTTGG - Intergenic
1015203414 6:130607798-130607820 TTTAAATATATTTTAACATTAGG + Intergenic
1015314412 6:131802043-131802065 TTTATCAATATTTTCTCCTATGG - Intergenic
1015412138 6:132905537-132905559 TTTATATTTATTTTAGACTTTGG - Intergenic
1015451274 6:133369463-133369485 TTTGTATATATTTTCATCTGAGG - Intronic
1015470175 6:133596421-133596443 TTTATAGAAATTTTCTCCTATGG + Intergenic
1015555639 6:134458938-134458960 TTTATTTATATTTTTTACTTGGG + Intergenic
1015563017 6:134536877-134536899 TTTATTAATAATTTAACCTTGGG - Intergenic
1016514175 6:144875282-144875304 TTTATATATTTTATCTCCTTTGG + Intergenic
1018104479 6:160469609-160469631 TTTTTATCTATTTTCAACTGAGG + Intergenic
1018194276 6:161341092-161341114 TATATATATATTTTTTCTTTTGG - Intergenic
1018302024 6:162413550-162413572 ATTATCTGTATTTTCACTTTTGG + Intronic
1018351938 6:162969166-162969188 TTGGTATAGATTTTCATCTTAGG + Intronic
1018538251 6:164847353-164847375 TGTATATTTATTTTCTTCTTTGG + Intergenic
1018900111 6:168047036-168047058 TCTATGTATAATTTCACTTTAGG - Intergenic
1019317309 7:393159-393181 TTTCAATGTATTTGCACCTTTGG + Intergenic
1020427660 7:8087587-8087609 TTTATATTTAGTTTCTCCCTTGG + Exonic
1020540934 7:9460720-9460742 TGGTTAGATATTTTCACCTTTGG - Intergenic
1021075264 7:16296135-16296157 TTTATATGTATTTTCATTTATGG - Intronic
1021182245 7:17520197-17520219 TGTATATATATTTTCTGTTTGGG + Intergenic
1021188559 7:17593971-17593993 TTTCTATTTATTTTCCCCTTGGG - Intergenic
1021968712 7:25947462-25947484 TTTATAAATATTATAAACTTAGG - Intergenic
1022546578 7:31194673-31194695 TTGATATGTATTTTACCCTTTGG + Intergenic
1022898179 7:34774043-34774065 TATACATATATTCACACCTTAGG + Intronic
1023393937 7:39734939-39734961 TTTATATATAGATTTACCCTAGG + Intergenic
1023517468 7:41016239-41016261 TTTATTTTTATTTTTACGTTTGG + Intergenic
1023749104 7:43353139-43353161 TATATTTATATTTTCAAGTTTGG - Intronic
1024491766 7:49994109-49994131 TTAATATATAATTTCACATCTGG + Intronic
1024734048 7:52284344-52284366 TTTGCATATATTTTCCCATTTGG + Intergenic
1024757221 7:52549041-52549063 TTTATACCTTTTTTCTCCTTTGG + Intergenic
1024770773 7:52720284-52720306 CTTAAATATATTTTCGTCTTCGG - Intergenic
1024895954 7:54262406-54262428 TTACTGTATATTTTCACATTGGG + Intergenic
1025096974 7:56103592-56103614 CTTTTAAATATTTTCACTTTTGG - Intronic
1025138717 7:56444201-56444223 TTTGTATACATTTTAATCTTTGG - Intergenic
1025148622 7:56526973-56526995 GTTATCTATATTATAACCTTAGG + Intergenic
1025240944 7:57273459-57273481 TTTATATATATTGTAACATTTGG + Intergenic
1025274913 7:57571925-57571947 TTTCTATGAATTTTCATCTTTGG - Intergenic
1025526976 7:61826483-61826505 TTTATATTGTTTTTCACCATTGG + Intergenic
1025550297 7:62238424-62238446 TTTATTTACTTTTTCACCATAGG - Intergenic
1025584081 7:62759705-62759727 CTTCCTTATATTTTCACCTTTGG + Intergenic
1025612521 7:63089043-63089065 TTGGTATATATTTTAACGTTTGG - Intergenic
1025934612 7:66025273-66025295 TTGATATGTATTTTCACGTCTGG + Intergenic
1026046865 7:66911868-66911890 TTTATATATATTTTCAGAGACGG + Intergenic
1026141272 7:67709018-67709040 GATATATAGATTTTCAGCTTAGG - Intergenic
1026475895 7:70734973-70734995 TTTATATTTATCTTGACCTTGGG - Intronic
1026480853 7:70778080-70778102 TTTGTCTATATTTTCATCATAGG + Intronic
1027529192 7:79309371-79309393 AATATATATAATATCACCTTAGG - Intronic
1027534766 7:79384179-79384201 TTTGCATAAATATTCACCTTTGG - Intronic
1027709187 7:81576317-81576339 TTTATAATTAGTCTCACCTTAGG + Intergenic
1027803294 7:82783013-82783035 GTTAGACATATTTTCTCCTTTGG + Intronic
1027817439 7:82994582-82994604 TTTATATATATTTTTATTTTGGG + Intronic
1028094385 7:86742216-86742238 TTTCTAAAGATGTTCACCTTTGG - Intronic
1028162679 7:87503960-87503982 TTTGTTTATATTTTCCCATTTGG - Exonic
1028292878 7:89089423-89089445 TATATGTATATATTAACCTTTGG + Intronic
1028407346 7:90490694-90490716 TAAATATATATTTTCTTCTTAGG + Intronic
1028418987 7:90611170-90611192 TTTCTAGATACTTTCACCATAGG + Intronic
1028664366 7:93323901-93323923 TTTATATTAATTTTAAGCTTTGG + Intronic
1029064296 7:97833544-97833566 TTTAAATATATTTTCACTGTAGG - Intergenic
1029936103 7:104425713-104425735 TATATTTACATTTTCACATTTGG + Intronic
1030244154 7:107362461-107362483 TATATATATATATTTGCCTTTGG - Intronic
1030401791 7:109060556-109060578 TTTATATATATGTTCAAATATGG + Intergenic
1030460124 7:109824832-109824854 TTTAGATATATTTTCAACCAGGG + Intergenic
1030539661 7:110814387-110814409 GTCATATACATTTTCATCTTAGG - Intronic
1030577270 7:111304489-111304511 TTTATATATATACACACCTATGG - Intronic
1030708589 7:112721954-112721976 TTAATATCTGTTTTCACCATTGG + Intergenic
1030728929 7:112961244-112961266 TTTATATATATTTTCCCCTAAGG - Intergenic
1030836909 7:114299058-114299080 TTTATTTTTATTTTCACTATAGG + Intronic
1030877164 7:114828249-114828271 TTTATTTATTCATTCACCTTTGG - Intergenic
1030916609 7:115322099-115322121 TTTATATTTCTTTTCTCCTATGG - Intergenic
1030959463 7:115898247-115898269 TTTGTATATAATTTTACCATTGG - Intergenic
1031590551 7:123586480-123586502 TTTGTAAATATTTTCTCCCTTGG + Intronic
1031685030 7:124722732-124722754 TTTATGTTTATTTTCACTTCTGG + Intergenic
1031710040 7:125034210-125034232 ATTATATATATTATAACCTCTGG + Intergenic
1031722745 7:125197279-125197301 TTTATTTATTTTTTCATTTTTGG + Intergenic
1031724786 7:125224367-125224389 TTTATTTACACTTACACCTTTGG - Intergenic
1031792613 7:126127571-126127593 TTTTATTATATTCTCACCTTTGG - Intergenic
1031857907 7:126943961-126943983 TTAATATACATTTTCATCTCAGG - Intronic
1032503054 7:132414418-132414440 TTGATAAATATTTTCCCCTCCGG - Intronic
1032742322 7:134751238-134751260 TGTATATCTCTTTTCATCTTGGG - Intronic
1032792005 7:135249269-135249291 TTTATATATATTTTTTCATATGG - Intronic
1032811678 7:135425877-135425899 TTTATTGATATTCTGACCTTGGG - Intronic
1033095691 7:138428912-138428934 TTTATCTATTTTTTAACTTTTGG - Intergenic
1033721615 7:144065305-144065327 TTTACATTTATTATCACCTGTGG - Intergenic
1033813137 7:145040981-145041003 TTTAAAGAAATTTTCACATTAGG + Intergenic
1033934961 7:146573013-146573035 TTAATATATAATGTCAACTTAGG + Intronic
1034611638 7:152375820-152375842 TATATATATATTTTTTCCTTTGG + Intronic
1034637915 7:152581921-152581943 TATATATATATATACCCCTTGGG - Intergenic
1035178414 7:157071043-157071065 TTAATATATATTGACAGCTTGGG - Intergenic
1035243600 7:157548089-157548111 TTTATTTATATTTTTTGCTTGGG + Intronic
1036160919 8:6387940-6387962 TTTATATATATGCTTACCTCAGG + Intergenic
1036210447 8:6836151-6836173 TTTATATATATTTACAGATATGG + Intergenic
1038385169 8:27137266-27137288 TTTATATTTATATTCATATTTGG - Intergenic
1038946428 8:32366003-32366025 TTTATGTATATTTTTAACATTGG + Intronic
1039005349 8:33030409-33030431 TGTATATATATTTACAACTGCGG - Intergenic
1039378314 8:37060007-37060029 TATATATATATCTTCACATCAGG + Intergenic
1039670930 8:39597474-39597496 TTTATTTATTTTTTTACGTTTGG + Intronic
1039945432 8:42124771-42124793 TATATATATATTTTCCCAGTTGG - Intergenic
1040114427 8:43599451-43599473 TTTATTTAGTTTTTCACCATGGG - Intergenic
1040351122 8:46569758-46569780 TTTAAATATATTTTCACCATAGG - Intergenic
1040355628 8:46615616-46615638 TGAATATATATTTTTTCCTTAGG - Intergenic
1040696928 8:50010964-50010986 GGTATATATATTTTCAATTTAGG - Intronic
1040696964 8:50011612-50011634 TTTTTTTTTAATTTCACCTTGGG - Intronic
1040765465 8:50904557-50904579 TTTATATTTATTTTCCACTCTGG - Intergenic
1041918113 8:63156310-63156332 TTTAGAAATATTTTCACCAGGGG + Intergenic
1041962046 8:63629183-63629205 ATTCTATATATTTTCCTCTTGGG + Intergenic
1042057067 8:64775619-64775641 TTAATATATATTATCTCCTCTGG - Intronic
1042132406 8:65600582-65600604 TTTATCTAAATTTTCTCCCTTGG - Intergenic
1042217447 8:66440108-66440130 TTGGTCTCTATTTTCACCTTAGG + Intronic
1042243921 8:66692073-66692095 TTTATTTATCTATTCACCTAGGG - Intronic
1042754790 8:72198883-72198905 TATATATATTTTTTCCCTTTGGG + Intergenic
1043006506 8:74825633-74825655 TTTTTACATATTTTAACCTAAGG + Intronic
1043095434 8:75964176-75964198 TTTATATTTTTTCTCACTTTAGG - Intergenic
1043296798 8:78673807-78673829 TTTATATATATCTTTATTTTGGG + Intronic
1043372407 8:79610635-79610657 TTCATATTTTCTTTCACCTTTGG - Intergenic
1043649418 8:82571345-82571367 TTTATCTATATATTCAAATTTGG - Intergenic
1043721901 8:83555137-83555159 TATATATATATATACACCATGGG - Intergenic
1043744070 8:83851531-83851553 TTAATAAATATTTTGAACTTAGG - Intergenic
1043874592 8:85470449-85470471 TTTATTTATATTTTGGACTTAGG + Intronic
1043936791 8:86151591-86151613 TTTATATATTTTCTTACTTTGGG + Intronic
1044105879 8:88206263-88206285 TCTATATATAGTTTCAGTTTGGG - Intronic
1044130282 8:88514554-88514576 TTTATATTAATTTTGACATTTGG - Intergenic
1044293375 8:90499163-90499185 TATATATATATTTTTATTTTCGG - Intergenic
1044368280 8:91376912-91376934 TTTATATAGACTTTGTCCTTTGG + Intronic
1044517160 8:93153143-93153165 TTTATATACATGTCCACATTGGG - Intronic
1044552145 8:93524478-93524500 TTTGTATATATTCTCACCTCAGG + Intergenic
1044872871 8:96637640-96637662 TCTAAATATATGTTCACCTTGGG - Intergenic
1045085109 8:98673931-98673953 TGTATATTTATTTTAATCTTTGG - Intronic
1045355196 8:101380923-101380945 TTTATGTATATTTTACCCTAAGG + Intergenic
1046350780 8:113007942-113007964 TTTATATATAATTTTACATAAGG - Intronic
1046365088 8:113218109-113218131 TATATATATATTTTAATATTGGG + Intronic
1046374256 8:113355209-113355231 TTTATATATATACCCACATTAGG - Intronic
1046514306 8:115238907-115238929 TTTAGAAATATTTTCCCCTTTGG - Intergenic
1047596479 8:126382746-126382768 AGTATATATATATTCCCCTTAGG - Intergenic
1047826984 8:128587302-128587324 TTCATATAAATTTTCATATTTGG - Intergenic
1047830530 8:128624575-128624597 TTAATAAATATTTTCAACTCAGG - Intergenic
1048419823 8:134267082-134267104 TTCATATATATTCTAAACTTAGG + Intergenic
1048750802 8:137672025-137672047 TTTATACATGTTTTTATCTTAGG - Intergenic
1048790256 8:138096947-138096969 GGTATTTATGTTTTCACCTTTGG - Intergenic
1049650518 8:143765651-143765673 TTTATATGGTTTTTCACTTTTGG + Intergenic
1049868595 8:144956268-144956290 TGTTTAGATACTTTCACCTTTGG - Intergenic
1049897974 9:128596-128618 TTTTTATATATCTTTACATTGGG + Intronic
1050488398 9:6160530-6160552 TTTAAATATATCTTTATCTTTGG + Intergenic
1050529845 9:6579136-6579158 TATATATATATTTTTTCCTTAGG + Intronic
1050576151 9:6997666-6997688 TTTATATGTTTTTTGACTTTGGG + Intronic
1050940717 9:11453484-11453506 ATCATATATATTTTAACCTCAGG - Intergenic
1051493358 9:17691951-17691973 TTTATAGATATTGTCAAATTAGG - Intronic
1051711873 9:19939616-19939638 TTTATAAATACTGTCAACTTAGG + Intergenic
1051746754 9:20302118-20302140 TTTATTTATCTATTCACCTATGG + Intergenic
1051782378 9:20703548-20703570 CTTATGTATATTCTAACCTTGGG + Intronic
1051833105 9:21303033-21303055 TTTATTTTTATTTACACCTGAGG + Intergenic
1051866650 9:21691053-21691075 TTTACATATATTGTCTCTTTAGG - Intergenic
1051999628 9:23261626-23261648 GTTCTATTTATTTTCTCCTTGGG - Intergenic
1052026704 9:23581615-23581637 TTTATATACATTATTTCCTTCGG + Intergenic
1052107085 9:24532271-24532293 TTTACATATAATTTCACCTTTGG - Intergenic
1052467783 9:28851885-28851907 TGTATATATATAATCACATTTGG + Intergenic
1052585040 9:30415940-30415962 TTTATATATGCTTTCCCTTTGGG + Intergenic
1052595395 9:30551364-30551386 TTTTTTGACATTTTCACCTTAGG - Intergenic
1053183278 9:35992625-35992647 TTTGTATGTTTTTTCCCCTTGGG + Intergenic
1054957524 9:70929517-70929539 TTTATTTATTTTTACATCTTTGG + Intronic
1055427654 9:76212814-76212836 TTTATATTTTTTTGCACCTATGG + Intronic
1055690955 9:78830191-78830213 ATTTTATATATTTTTTCCTTTGG + Intergenic
1055850516 9:80623181-80623203 TTCTTATATATTTTCCCATTTGG + Intergenic
1056094156 9:83233595-83233617 TATATATATATATTCCCCATTGG - Intergenic
1056188379 9:84160123-84160145 TTTACATATATTTTAAAATTTGG + Intergenic
1057542892 9:95991965-95991987 TTAATAGATATTTTCAGATTTGG - Intronic
1057709841 9:97429599-97429621 TTAATTTATATCTTCTCCTTAGG - Intronic
1057771500 9:97972181-97972203 TTTATATGTATTTTTCCTTTAGG + Intergenic
1058310900 9:103501240-103501262 TTTAAAAATATTTTCTGCTTGGG + Intergenic
1058516847 9:105784715-105784737 TATATAGATATTTTCATTTTAGG + Intergenic
1059145991 9:111900173-111900195 CTTTTATACAATTTCACCTTAGG - Intronic
1059259785 9:112964448-112964470 TGAATATATAGTATCACCTTTGG + Intergenic
1059263415 9:113002352-113002374 TTTAGTTATATTTTCTCCTTAGG - Intergenic
1059496695 9:114715891-114715913 TTTATATAGGTTTTCTACTTTGG + Intergenic
1059704743 9:116812003-116812025 TTTGTATATATTTTTACATGTGG + Intronic
1059843061 9:118240439-118240461 TTTATATATTTTTTCATCTTGGG - Intergenic
1062475468 9:136724709-136724731 TCCATATAGATTTTCCCCTTGGG + Intergenic
1062475707 9:136725984-136726006 TTTATACATATCTACACCTCAGG + Intergenic
1203426535 Un_GL000195v1:45400-45422 TTTGTTTTTTTTTTCACCTTAGG + Intergenic
1203439657 Un_GL000195v1:176894-176916 TTTATTTATGTTTTAACTTTTGG - Intergenic
1203626176 Un_KI270750v1:25768-25790 TTTCTATGAATTTTCATCTTTGG - Intergenic
1185531773 X:825653-825675 TTTATATATATTTTAAGTTTAGG + Intergenic
1185963161 X:4568515-4568537 TGTATATATATTTTCACATATGG + Intergenic
1186098177 X:6126022-6126044 TTTAAATATATATTCAATTTCGG - Intronic
1186106349 X:6211370-6211392 TTTATATATTTTTTGACATTTGG - Intronic
1186173730 X:6903928-6903950 TATATATATTTTTTAAACTTGGG - Intergenic
1186376534 X:9008601-9008623 TTTATATATATACACACATTAGG - Intergenic
1186786434 X:12960198-12960220 TTTTTAAAAATTTTCTCCTTTGG + Intergenic
1187138308 X:16569783-16569805 GTTATGTATATTTTCATGTTTGG - Intergenic
1187655402 X:21466011-21466033 TTTATGAATATTTTCTCATTAGG + Intronic
1188189149 X:27152941-27152963 TTTATATATATTTTTTCATAAGG + Intergenic
1188385145 X:29547604-29547626 TTTAAAAATACTTTCATCTTCGG + Intronic
1188726916 X:33596651-33596673 ATGATAAATATTTTCAACTTGGG + Intergenic
1188767858 X:34118529-34118551 TATATATTTATTTTCATGTTTGG + Intergenic
1189537796 X:41954588-41954610 GTTATATTTATTTGCACATTTGG - Intergenic
1191265946 X:58393906-58393928 TTTATTTCCTTTTTCACCTTAGG - Intergenic
1191269085 X:58439035-58439057 GATATTTACATTTTCACCTTTGG + Intergenic
1192003326 X:67180910-67180932 TTTATAAATTTTTCCACCTCAGG + Intergenic
1192845045 X:74897918-74897940 TGTATATTTATTTTAAACTTTGG - Intronic
1192894355 X:75425178-75425200 TTTATATATAATGTTTCCTTGGG + Intronic
1193170623 X:78331731-78331753 TTTATGAATATTTTCTCTTTTGG - Intergenic
1193551361 X:82896932-82896954 TTTATAGTTGTATTCACCTTTGG + Intergenic
1193845918 X:86469806-86469828 TATACATATATTTCCACATTAGG - Intronic
1194043681 X:88973889-88973911 TTTTTATATATTTATACCGTGGG + Intergenic
1194261546 X:91701708-91701730 TTTATTTAAATTTTCTCATTTGG - Intergenic
1194449173 X:94021792-94021814 TTTATTTATATTTTCATTTATGG + Intergenic
1194506616 X:94741664-94741686 TTTTTATTTTGTTTCACCTTTGG + Intergenic
1194515634 X:94849896-94849918 TTCATGTATATTATCACTTTTGG - Intergenic
1194796422 X:98216566-98216588 TTTATCCATGTTTTCCCCTTGGG - Intergenic
1195083509 X:101392521-101392543 TTTTTATACCTTTTCACATTCGG + Intronic
1195468540 X:105208589-105208611 GTAATGTATATTTCCACCTTGGG + Intronic
1195525595 X:105885862-105885884 TTTATATATGTTATCCCATTTGG + Intronic
1195702891 X:107717990-107718012 TTTATATAAATGTATACCTTTGG - Intronic
1195792746 X:108606932-108606954 TTTATAGAAATTGACACCTTTGG + Intronic
1196238427 X:113310169-113310191 TTTCTCTATATTGTGACCTTAGG - Intergenic
1196279033 X:113801045-113801067 GTTAAATATATTTTCACTCTTGG + Intergenic
1196380986 X:115089193-115089215 TCTCTATATACTTTCTCCTTTGG - Intergenic
1196624739 X:117865257-117865279 TTTAGAAATATTTTCAGCTGAGG - Intergenic
1196707938 X:118731981-118732003 TTTGTATATATTTAAACATTTGG + Intronic
1197171500 X:123439799-123439821 TTTTTATTTATTTTCATTTTAGG + Intronic
1197611638 X:128645577-128645599 TATATATATATTTTTTCCTCTGG + Intergenic
1197625850 X:128801621-128801643 TTTATATATATATTTAGGTTTGG - Intergenic
1197653758 X:129093766-129093788 TTTATAGATTTTTTTTCCTTTGG + Intergenic
1197675101 X:129321162-129321184 TTTAAATATATTTTCTAGTTGGG + Intergenic
1197810848 X:130441769-130441791 TGCATATATATTTTCAACTATGG - Intergenic
1198146353 X:133861383-133861405 TTTATGTAAAGTTTCAACTTTGG + Intronic
1198186224 X:134256518-134256540 TTCATAAATATTTTAACCTCAGG + Intergenic
1198390885 X:136172610-136172632 TTTACATTTATTTTCATTTTAGG - Intronic
1198569630 X:137941231-137941253 TATATCTATAGATTCACCTTGGG + Intergenic
1199189919 X:144959031-144959053 TTTACAGATATTTTCTCCTGTGG - Intergenic
1199331603 X:146566942-146566964 TTTATATAAATTTTGACTTAAGG + Intergenic
1200479977 Y:3689669-3689691 TATGTATTGATTTTCACCTTGGG - Intergenic
1200536815 Y:4408027-4408049 TTTATATCTTTTTTCAAATTTGG + Intergenic
1200580197 Y:4940515-4940537 TTTATTTAAATTTTCTCATTTGG - Intergenic
1200621924 Y:5460087-5460109 TTTCTATGTATTTTCTCCTTAGG - Intronic
1201332459 Y:12839662-12839684 TATTTATATATTTTTAGCTTTGG + Intronic
1201855975 Y:18542648-18542670 TATATAAATATTTTAAGCTTTGG + Intergenic
1201877346 Y:18777737-18777759 TATATAAATATTTTAAGCTTTGG - Intronic
1201886075 Y:18883168-18883190 TGTATATATAATTTCACATATGG + Intergenic
1201930670 Y:19342360-19342382 TTTATATATATTTTTTCTTTTGG + Intergenic
1202077111 Y:21047660-21047682 TTTAAAAATATTTTTACCTAAGG - Intergenic
1202164281 Y:21969964-21969986 TTTATTTTTATTTTTACTTTTGG + Intergenic
1202227075 Y:22616408-22616430 TTTATTTTTATTTTTACTTTTGG - Intergenic
1202241285 Y:22772648-22772670 TATATATATATTTTTAATTTTGG - Intergenic
1202316047 Y:23579246-23579268 TTTATTTTTATTTTTACTTTTGG + Intergenic
1202394271 Y:24406391-24406413 TATATATATATTTTTAATTTTGG - Intergenic
1202476514 Y:25263701-25263723 TATATATATATTTTTAATTTTGG + Intergenic
1202554718 Y:26090821-26090843 TTTATTTTTATTTTTACTTTTGG - Intergenic
1202581354 Y:26384425-26384447 TTTAGGTATATTTTCGCCTAAGG - Intergenic