ID: 1093981652

View in Genome Browser
Species Human (GRCh38)
Location 12:25481391-25481413
Sequence CCTAGCACAGAGAACATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 465}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093981648_1093981652 -8 Left 1093981648 12:25481376-25481398 CCAGTCCAGGATCTCCCTAGCAC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1093981652 12:25481391-25481413 CCTAGCACAGAGAACATAGCAGG 0: 1
1: 0
2: 0
3: 39
4: 465
1093981646_1093981652 1 Left 1093981646 12:25481367-25481389 CCCTTGGCACCAGTCCAGGATCT 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1093981652 12:25481391-25481413 CCTAGCACAGAGAACATAGCAGG 0: 1
1: 0
2: 0
3: 39
4: 465
1093981647_1093981652 0 Left 1093981647 12:25481368-25481390 CCTTGGCACCAGTCCAGGATCTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1093981652 12:25481391-25481413 CCTAGCACAGAGAACATAGCAGG 0: 1
1: 0
2: 0
3: 39
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093981652 Original CRISPR CCTAGCACAGAGAACATAGC AGG Intronic
900590820 1:3458943-3458965 CCTCACACAGAGAACAAAGTAGG + Intronic
901662544 1:10807628-10807650 CATAGCAAAGAGAACATGGAAGG - Intergenic
902168622 1:14592894-14592916 CCTAGCTCAGAGACCAGAGGCGG - Intergenic
903980903 1:27187454-27187476 CCTAGAACAGACAACAGACCAGG + Intergenic
905283219 1:36862373-36862395 CCGAGGACATAGAACATAGAGGG - Intronic
906004063 1:42454108-42454130 CCTAGCAGAGAGAACAGACTGGG + Intronic
906572032 1:46850871-46850893 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
906586164 1:46980679-46980701 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
906682702 1:47740798-47740820 CTAAGCACAAAGAACAAAGCTGG + Intergenic
906895177 1:49763315-49763337 CTGAGCAGAGAGAACAAAGCTGG - Intronic
906900515 1:49831049-49831071 CCAAGCAAAAAGAACAAAGCTGG - Intronic
907374919 1:54028734-54028756 CCAAGCACAGAGCACATAGGAGG - Intergenic
907982301 1:59495924-59495946 CTAAGCACAAAGAACAAAGCTGG - Intronic
908503848 1:64774617-64774639 CTAAGCAAAGAGAACAAAGCTGG - Intronic
909437604 1:75661037-75661059 CTGAGCACAAAGAACAAAGCTGG + Intergenic
909992050 1:82235556-82235578 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
910605254 1:89076528-89076550 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
910660327 1:89664583-89664605 CTTAGCAAAAAGAACAAAGCTGG - Intronic
910748486 1:90600549-90600571 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
912853481 1:113147055-113147077 CCTAGCACTGAGCACACTGCAGG + Intergenic
913407621 1:118513222-118513244 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
915488434 1:156238217-156238239 CTGAGCACAAAGAACAAAGCTGG - Intronic
915751500 1:158214515-158214537 TCAAGCACAAAGACCATAGCAGG + Intergenic
917393167 1:174561558-174561580 CTAAGCAAAGAGAACAAAGCTGG + Intronic
917439797 1:175057227-175057249 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
917601723 1:176581402-176581424 CCGAGCAAAAAGAACAAAGCTGG - Intronic
917945315 1:179963779-179963801 CCAAGCAAAAAGAACACAGCAGG - Intronic
918089861 1:181280530-181280552 CTTAGCCAAGAGAACAAAGCTGG + Intergenic
918501032 1:185196427-185196449 CTAAGCAAAGAGAACAAAGCTGG - Intronic
918652047 1:186977472-186977494 CCTAGCAAGGAGTACATTGCTGG + Intronic
918827187 1:189339216-189339238 CCAAGCAAAAAGAACAGAGCTGG + Intergenic
918975200 1:191475076-191475098 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
919274186 1:195391167-195391189 CCGAGCAAAAAGAACAAAGCTGG - Intergenic
919748389 1:201022482-201022504 CCCAGCACAAAGAACACAGATGG + Intronic
919952079 1:202374353-202374375 CCTAGCACTGTGAATATAGTAGG + Intronic
920553331 1:206884136-206884158 CAAAGCACAGAGAAGAGAGCTGG - Intergenic
921881451 1:220259282-220259304 CTAAGCAAAAAGAACATAGCTGG + Intronic
922384452 1:225068389-225068411 CCAATCAAAGAGAACAAAGCTGG - Intronic
922679039 1:227575184-227575206 CCTTGCAAAAAGAACAAAGCTGG - Intronic
923047455 1:230365976-230365998 CCTAGCACAGGGATGACAGCAGG + Intronic
923540272 1:234883831-234883853 CCTAGTACAGAGCACATACTAGG - Intergenic
924649519 1:245912555-245912577 CCGAGCAAAAAGAACAAAGCTGG + Intronic
1064632711 10:17333441-17333463 CTAAGCAAAGAGAACAAAGCTGG + Intronic
1065275687 10:24083317-24083339 CATGGCACAGAGGACATTGCTGG + Intronic
1065723571 10:28649307-28649329 CCTAGCAAAAAGAACGAAGCTGG - Intergenic
1066509376 10:36079034-36079056 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1066518942 10:36194780-36194802 TCCAGCACAGATAATATAGCAGG - Intergenic
1069421362 10:68249483-68249505 CCCAGGAGAGAGAACATAGCTGG + Intergenic
1070236837 10:74636575-74636597 CCAAGTACATAGAACATAGTAGG - Intronic
1070663266 10:78323739-78323761 CCGAGCAAAAAGAACAAAGCTGG - Intergenic
1071196658 10:83168644-83168666 CCTAGCATAGAAAAAATAGCAGG + Intergenic
1071410434 10:85386885-85386907 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1071953664 10:90733310-90733332 CCTAGCATTGAGAAAAAAGCAGG + Intergenic
1074041059 10:109789231-109789253 CCTAGGACTGAGCACATAGTTGG - Intergenic
1074408863 10:113206381-113206403 CCAAGCACAAAGAACAAAACTGG + Intergenic
1074795061 10:116934609-116934631 CAAAGCAAAGAGAACAAAGCTGG - Intronic
1075903703 10:126063303-126063325 CCAAGTACAGAGGACATCGCTGG + Intronic
1077655192 11:4012165-4012187 CTAAGCAAAGAGAACAAAGCTGG - Intronic
1077841321 11:5978146-5978168 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1077951884 11:6968226-6968248 CCAAGCAAAAAGAACAAAGCTGG - Intronic
1078835179 11:15020985-15021007 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1079690354 11:23409269-23409291 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1080418844 11:32092661-32092683 CCTTGCACAGAGGACCCAGCAGG + Intronic
1081058991 11:38448847-38448869 CTAAGCACAAAGAACAAAGCCGG - Intergenic
1081959386 11:47123447-47123469 TCTGGGACAGAGAATATAGCTGG - Intronic
1082292117 11:50388548-50388570 CCTAGCCAAAAGAACAAAGCTGG + Intergenic
1082860636 11:57852542-57852564 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1085511741 11:77091673-77091695 CCTGGCCCAGGGAACAGAGCAGG - Intronic
1085745918 11:79114052-79114074 CCTGGAACAGAGAACAGAGGAGG - Intronic
1085773362 11:79343923-79343945 GCTGGCACAAAGAACATAGATGG + Intronic
1086219469 11:84425048-84425070 CCTAGGATAGGGACCATAGCTGG + Intronic
1086664108 11:89458108-89458130 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1086866686 11:91987997-91988019 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1087310164 11:96532293-96532315 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1089171525 11:116515015-116515037 CCTAGCACCAAGCACATAGCAGG + Intergenic
1089499671 11:118924964-118924986 CCTAGCGCAGAGAACAAGGCCGG - Intronic
1089959626 11:122604443-122604465 CCTGGTACAGAGAAGAAAGCTGG + Intergenic
1090133126 11:124166755-124166777 CTTAGCAAAAAGAACACAGCTGG - Intergenic
1090176778 11:124656940-124656962 CCCACCACAGAGAATACAGCTGG + Intronic
1090573764 11:128077534-128077556 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1090576604 11:128111791-128111813 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1090758989 11:129819183-129819205 CCTAGCACAGTGCCCATAGCAGG + Intronic
1091804127 12:3343774-3343796 ACCAGCACATAGCACATAGCAGG - Intergenic
1091966674 12:4748662-4748684 CCTAGCAAAAAGAACAAAACTGG - Intronic
1092152200 12:6257138-6257160 CATACCTCAGAGAACATTGCAGG + Intergenic
1092327504 12:7548634-7548656 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1092516422 12:9219171-9219193 CTAAGCAAAAAGAACATAGCGGG + Intergenic
1092519373 12:9251903-9251925 CTAAGCAAAAAGAACATAGCTGG + Intergenic
1093063999 12:14637487-14637509 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1093905393 12:24685313-24685335 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1093981652 12:25481391-25481413 CCTAGCACAGAGAACATAGCAGG + Intronic
1095130517 12:38536834-38536856 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1095586600 12:43857002-43857024 TCTAGGAGAGAGAACATAACAGG - Intronic
1096512698 12:52140433-52140455 CCGAGGGCAGAGACCATAGCTGG + Intergenic
1096867039 12:54570757-54570779 CCTTGCACAGAGACCAGAACTGG - Intronic
1097536979 12:60884614-60884636 CCTAGCAAAAAGAACAAACCTGG - Intergenic
1097702678 12:62836293-62836315 CCTAGAATACAGCACATAGCAGG + Intronic
1097824968 12:64166145-64166167 CTAAGCACAAAGAACAAAGCTGG + Intergenic
1098182753 12:67865355-67865377 CTAAGCAAAAAGAACATAGCTGG - Intergenic
1099275538 12:80571025-80571047 CTTAGCAAAAAGAACAAAGCTGG - Intronic
1099820045 12:87697711-87697733 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1100085889 12:90909993-90910015 CTTAGCAAAAAGAACAAAGCTGG + Intronic
1100740508 12:97586377-97586399 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1101733022 12:107442161-107442183 CCTAGCACAGGGTGCATGGCTGG + Intronic
1104937125 12:132371944-132371966 CCCAGCAAAAAGAACAAAGCTGG - Intergenic
1107244815 13:38280869-38280891 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1108629524 13:52268267-52268289 CCAAGCAAAAAGAACAAAGCAGG - Intergenic
1108655436 13:52527496-52527518 CTAAGCACAAAGAACAAAGCTGG + Intergenic
1108656533 13:52538221-52538243 CCAAGCAAAAAGAACAAAGCAGG + Intergenic
1108715286 13:53072607-53072629 ACTGGCAGAGAGAACATATCTGG + Intergenic
1109204454 13:59466213-59466235 CCAAGCACAGAGAGGACAGCAGG + Intergenic
1110939241 13:81328731-81328753 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1111164837 13:84446094-84446116 CCCACCACTGAAAACATAGCTGG - Intergenic
1111370096 13:87306177-87306199 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1111391727 13:87605284-87605306 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1111496532 13:89057655-89057677 CTTAGCAAAAAGAACATAACTGG - Intergenic
1111846168 13:93511616-93511638 CTTAGCAAAAAGAACAAAGCTGG - Intronic
1112363245 13:98736041-98736063 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1113409959 13:110076550-110076572 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1115035303 14:28849915-28849937 CTAAGCACAAAGAACAAAGCTGG + Intergenic
1116033051 14:39596119-39596141 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1116212328 14:41964246-41964268 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1116224015 14:42124967-42124989 CTAAGCACAGAGAACAAAGCTGG + Intergenic
1116362695 14:44021981-44022003 CCTAGCAAAAAGAACAAAGCTGG - Intergenic
1116489663 14:45491402-45491424 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1116572020 14:46530512-46530534 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1116680980 14:47969590-47969612 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1117829646 14:59737711-59737733 CCTAAGACAAAGAACAAAGCTGG + Intronic
1118662015 14:68024279-68024301 CCAAGCAAAAAGAACAAAGCTGG - Intronic
1118752666 14:68818016-68818038 CCTAGTGCAGAGCACATAGTAGG - Intergenic
1119993138 14:79222195-79222217 CCAAGCAAAAAGAACAAAGCTGG - Intronic
1121413300 14:93762454-93762476 CAGGGCACAGAGAAGATAGCTGG - Intronic
1122126976 14:99584488-99584510 CCTTGCACAGAGACCAAAGAAGG + Intronic
1124889354 15:33717891-33717913 GATAGCACAGAGAACAAACCAGG - Intronic
1125274185 15:37973234-37973256 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1126361127 15:47847003-47847025 CCTAGGAGAGGGAACAAAGCAGG - Intergenic
1126994788 15:54428713-54428735 TCTAGCACAGAGACCATACCAGG - Intronic
1127024057 15:54782887-54782909 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1127074785 15:55314962-55314984 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1128559758 15:68656750-68656772 ACTTGCCCAAAGAACATAGCTGG - Intronic
1129442335 15:75590666-75590688 CCTAGAACCTAGAACATAGTAGG + Intergenic
1130045560 15:80441812-80441834 CGTAACACAGAAAACATATCTGG - Intronic
1130575113 15:85085207-85085229 TGGAGCACAGAGAACAAAGCAGG - Intronic
1130619642 15:85448805-85448827 CTTAGCAAAAAGAACAAAGCTGG - Intronic
1130692738 15:86098754-86098776 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1131903136 15:97111062-97111084 CTAAGCAAAAAGAACATAGCTGG + Intergenic
1131984361 15:98026594-98026616 CTAAGCAAAGAGAACACAGCTGG + Intergenic
1132425150 15:101709741-101709763 CCCAGCACAGAGCACACAGCAGG + Intronic
1135134520 16:19877737-19877759 CCTGGCACAGGGAAGACAGCAGG + Intronic
1135187052 16:20324109-20324131 CGAAGCACAGAGAACTCAGCAGG - Exonic
1135795020 16:25433472-25433494 AGGAGCACAGTGAACATAGCAGG - Intergenic
1138776301 16:59728384-59728406 CTTAACCCAGAGAACATAACAGG - Intronic
1140975000 16:80051223-80051245 GCTAACACAGAGCACAGAGCAGG - Intergenic
1142958052 17:3534767-3534789 CCTGGCACAGAGGTCAGAGCTGG + Intronic
1144278417 17:13699489-13699511 CATAGCACAGAAACCATGGCAGG - Intergenic
1144399332 17:14880349-14880371 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1147143996 17:38474845-38474867 CCTCGCACAGTGCACATGGCTGG - Intronic
1149130162 17:53290893-53290915 CCTAGCAAAGTGACCAAAGCTGG + Intergenic
1149246115 17:54710466-54710488 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1149279191 17:55083395-55083417 CCTAGCACAAAAAACATACTCGG + Intronic
1150977750 17:70108197-70108219 CACAGTACAGGGAACATAGCTGG + Intronic
1155693934 18:28661129-28661151 CCTAACCCAAAGAACAAAGCTGG + Intergenic
1155764768 18:29614641-29614663 CCTAGCAAAAAGAACAAAGCTGG + Intergenic
1156124643 18:33888860-33888882 CCAAGCAAAAAGAACAAAGCTGG - Intronic
1156776457 18:40794766-40794788 CCTAGCAAAAAGAACAAAGCTGG + Intergenic
1157296001 18:46444667-46444689 GCTAGCCCAGAAAACATAGTGGG - Intronic
1157447682 18:47757689-47757711 CATATCACAGAGAAAAGAGCTGG + Intergenic
1157957669 18:52116400-52116422 CATATCACAGAGCACATAGATGG + Intergenic
1159382663 18:67682167-67682189 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1159385847 18:67724876-67724898 CCTAGCAAAAAGAACAAAGATGG - Intergenic
1160154402 18:76422632-76422654 CCTAGCACAGAGCAAATAAATGG + Intronic
1161421069 19:4176119-4176141 CGGAGCACAGAAAACAAAGCAGG + Intronic
1162800290 19:13106403-13106425 CCCAGCACTGAGAACAATGCAGG - Intronic
1162985592 19:14267329-14267351 CCTGGCACACAGCACATACCTGG + Intergenic
1163187427 19:15648922-15648944 CAGAGCACAGAGGACAGAGCTGG + Intronic
1164110843 19:22156962-22156984 CCAAGCCAAGAGAACAAAGCTGG - Intergenic
1166121933 19:40691505-40691527 CCTAGCGCAGAGAAAAGAGCTGG + Intergenic
1166176536 19:41075962-41075984 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1168479239 19:56704613-56704635 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
925116611 2:1384158-1384180 CCTAAGCCAAAGAACATAGCTGG - Intronic
925457911 2:4032845-4032867 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
925462960 2:4080391-4080413 CCTAGCCAAAAGAACAAAGCTGG - Intergenic
926238278 2:11066358-11066380 TCTCTCACAGGGAACATAGCAGG + Intergenic
926373159 2:12200859-12200881 CCAAGCAGAGAGAACAGAGAAGG + Intergenic
926981713 2:18579339-18579361 CTTAGCAAAAAGAACAAAGCTGG + Intronic
927624738 2:24703081-24703103 CCTAGCATGGAGTACATATCAGG - Intronic
930410202 2:51015922-51015944 CCAAGCAAAAAGAACAAAGCTGG + Intronic
930917161 2:56706856-56706878 ACTTGCCCAGAGTACATAGCTGG - Intergenic
930954294 2:57186331-57186353 CCAAGCAAAAAGAACATAGCTGG + Intergenic
930987339 2:57606482-57606504 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
931779950 2:65570701-65570723 CCAAGCAAAATGAACATAGCTGG - Intergenic
931836701 2:66106894-66106916 CATAGTACTGAGGACATAGCAGG - Intergenic
931886293 2:66621480-66621502 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
931971664 2:67593590-67593612 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
931985752 2:67740404-67740426 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
932037959 2:68267382-68267404 CTGAGCACAAAGAACAAAGCTGG + Intergenic
932874340 2:75434526-75434548 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
933421132 2:82046372-82046394 CTAAGCAAAGAGAACAGAGCTGG + Intergenic
933463684 2:82622709-82622731 ATTAGCATAGAGAACATAGAAGG + Intergenic
933534333 2:83553438-83553460 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
933986562 2:87596651-87596673 CCCAGCACAGAAAAAATGGCAGG + Intergenic
934862626 2:97777056-97777078 CCCAGCACACAGAACACTGCTGG - Intronic
935443741 2:103135023-103135045 CATGGTACAGAGAACAGAGCAGG + Intergenic
936143058 2:109957646-109957668 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
936179746 2:110255612-110255634 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
936201630 2:110413821-110413843 CCAAGCAAAAAGAACAAAGCTGG - Intronic
936307275 2:111354150-111354172 CCCAGCACAGAAAAAATGGCAGG - Intergenic
936825110 2:116572418-116572440 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
937442980 2:121932646-121932668 CCTAGCACTGAGGACAGAGTGGG + Intergenic
937655006 2:124364913-124364935 CTTGGCACATAGCACATAGCTGG + Intronic
937865022 2:126743937-126743959 CCTAGTTCAGAGAGCAGAGCAGG + Intergenic
937950219 2:127380147-127380169 CCTAGCACAGTGCAGACAGCAGG - Intronic
938951840 2:136261869-136261891 CCTAGCAAAAAGAACAAAGCTGG - Intergenic
939912807 2:148004312-148004334 CTAAGCAAAGAGAACAAAGCTGG + Intronic
940629852 2:156224364-156224386 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
941995697 2:171600228-171600250 ACTAGTACAGAGTACAGAGCAGG + Intergenic
942473679 2:176291401-176291423 CCTAGAACCTAGCACATAGCAGG - Intronic
942724918 2:178995716-178995738 AATAGCAAAGAGAACAGAGCTGG - Intronic
942752630 2:179304960-179304982 CTTGGCACAGAGAATATACCAGG - Intergenic
943109792 2:183590875-183590897 CCTAGCCAAAAGAACAAAGCTGG + Intergenic
943312099 2:186338660-186338682 CTAAGCAAAGAGAACAAAGCAGG - Intergenic
943545452 2:189271207-189271229 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
944275587 2:197833865-197833887 CCCAGCAAAAAGAACAAAGCTGG + Intronic
944765403 2:202859464-202859486 CATAGCACCCAGAACAAAGCTGG - Intronic
947238215 2:227966173-227966195 CTAAGCACAAAGAACAAAGCTGG - Intergenic
947263250 2:228248894-228248916 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
947275502 2:228387155-228387177 CTAAGCACAAAGAACAAAGCTGG - Intergenic
947320319 2:228910120-228910142 CCAAGCAAAAAGAACAAAGCTGG - Intronic
947688142 2:232109106-232109128 CCAAGCAAAAAGAACAAAGCTGG + Intronic
948324710 2:237104890-237104912 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
948644412 2:239394847-239394869 CCAAGCACAGGGTACAGAGCAGG + Intronic
948847094 2:240688289-240688311 CCAAGCAAAGCCAACATAGCAGG - Intergenic
1169177078 20:3526635-3526657 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1169384774 20:5138952-5138974 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1169635573 20:7687986-7688008 CTAAGCAAAAAGAACATAGCTGG - Intergenic
1169645806 20:7808296-7808318 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1169746192 20:8945526-8945548 CCTAGTACAGAGCACATAGTAGG - Intronic
1170490851 20:16872706-16872728 CTAAGCAAAAAGAACATAGCTGG - Intergenic
1170754579 20:19188508-19188530 CTAAGCACAGAGAACAAAGCTGG - Intergenic
1171228617 20:23463252-23463274 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1173245127 20:41331642-41331664 TCTGGCACAGACAGCATAGCAGG + Intergenic
1175554870 20:59843398-59843420 CTTAGCAAAAAGAACAAAGCTGG + Intronic
1176966790 21:15219876-15219898 CACAGCACAGAGCACATAGCAGG + Intergenic
1177099563 21:16883483-16883505 CCAAGCAAAAAGAACAAAGCAGG + Intergenic
1177104575 21:16938649-16938671 CTGAGCAAAGAGAACAAAGCTGG - Intergenic
1180024178 21:45149250-45149272 CCCAGTACAGAGGACAGAGCTGG - Intronic
1180509957 22:16072536-16072558 CCTAGCCAAAAGAACAAAGCTGG - Intergenic
1181632091 22:24156690-24156712 CCTAGCCCAGCGCACATAACGGG - Intronic
949640005 3:6025790-6025812 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
949667941 3:6363196-6363218 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
950881524 3:16326445-16326467 CCTAGCACAAGGCACATAGTAGG + Intronic
950905046 3:16530463-16530485 CCTAGCACAGGGAGCACAGGTGG - Intergenic
951181477 3:19664255-19664277 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
951254612 3:20433580-20433602 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
951380776 3:21982004-21982026 CTAAGCACAAAGAACAAAGCTGG - Intronic
951443621 3:22750813-22750835 CTAAGCACAAAGAACAAAGCCGG - Intergenic
951722576 3:25716306-25716328 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
951748036 3:26001012-26001034 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
951793768 3:26515995-26516017 CCAAGCAAAGAGAACAAAACTGG - Intergenic
952947379 3:38487477-38487499 CCGAGCACACAAAGCATAGCAGG - Exonic
953155670 3:40370435-40370457 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
953661572 3:44894795-44894817 CCTTGCACAGAGCACACAGTGGG - Intronic
953955478 3:47228519-47228541 CCCAGCACAGAGAACACATTTGG - Exonic
954434058 3:50486610-50486632 ACAAGCCCAGAGAACAAAGCTGG - Intronic
955575559 3:60359054-60359076 CCCAGCACTGAGAATACAGCAGG + Intronic
955622787 3:60883415-60883437 CCCAGCAAAAAGAACAAAGCTGG + Intronic
957008091 3:74973543-74973565 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
958021958 3:88008380-88008402 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
958759163 3:98287110-98287132 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
959747947 3:109799419-109799441 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
959860862 3:111213135-111213157 CCAAGCAGAGAGCACTTAGCAGG - Intronic
960305424 3:116054442-116054464 CTTAGCCCAGAGAATAAAGCAGG + Intronic
962675596 3:137755396-137755418 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
962692362 3:137911983-137912005 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
963260726 3:143188589-143188611 CATAGCAAAGACAACATAGCTGG - Intergenic
963356718 3:144217304-144217326 CATATCACTGAGCACATAGCAGG + Intergenic
964571744 3:158114438-158114460 CTTAGCAAAAAGAACAAAGCTGG - Intronic
965726027 3:171717148-171717170 CCAAGCAAAAAGAACAAAGCTGG - Intronic
967359782 3:188616527-188616549 CCAAGCAAAAAGAACAAAGCTGG - Intronic
967382297 3:188872652-188872674 CCTTGCACACAGAACATCGCGGG - Exonic
967455270 3:189678525-189678547 CTTAGCAAAAAGAACAAAGCCGG - Intronic
968696047 4:2027953-2027975 CTAAGCAAAGAGAACAAAGCTGG - Intronic
968871447 4:3244797-3244819 CCTGGCACAGACAGCAGAGCAGG - Intronic
969399721 4:6946185-6946207 CATAGCACCTAGAACATAGTTGG + Intronic
971344754 4:25801799-25801821 CCCAGCAGGGGGAACATAGCTGG + Intronic
972124491 4:35746111-35746133 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
972128209 4:35797197-35797219 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
972651685 4:41023880-41023902 CCAAGCAAAAAGAACAAAGCTGG + Intronic
972730176 4:41787199-41787221 ACAAGCACAGAGGACATAGGGGG - Intergenic
973020784 4:45203758-45203780 CTAAGCACAAAGAACAAAGCTGG - Intergenic
973547742 4:51998924-51998946 CCTAGCACCTAGTACATAGCAGG + Intronic
974360800 4:60876535-60876557 CCAAGCACAAAGAATAAAGCTGG - Intergenic
974562869 4:63544224-63544246 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
974872179 4:67657232-67657254 CTAAGCAAAGAGAACAAAGCTGG + Intronic
975026482 4:69555242-69555264 CGTCGTACACAGAACATAGCTGG - Intergenic
975110338 4:70616472-70616494 CCTAGCACCTAGAGCACAGCAGG - Intergenic
975178353 4:71313476-71313498 CCAAGCAAAAAGAACAAAGCTGG + Intronic
975896686 4:79101123-79101145 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
976120799 4:81779016-81779038 CCAAGCAAAAAGAACAAAGCTGG - Intronic
976438712 4:85048252-85048274 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
976672772 4:87672875-87672897 CTAAGCAAAAAGAACATAGCTGG + Intergenic
976979468 4:91208660-91208682 CTTAGCAAAAAGAACAAAGCTGG - Intronic
977236459 4:94513172-94513194 CTTAGCACAAAGAACAAAACTGG - Intronic
977502308 4:97856108-97856130 CTAAGCAGAAAGAACATAGCTGG - Intronic
977631064 4:99243663-99243685 CTAAGCACAAAGAACAAAGCTGG - Intergenic
977679032 4:99778697-99778719 CTAAGCACAAAGAACAAAGCTGG + Intergenic
977911679 4:102544767-102544789 CCTATCACACAGATAATAGCTGG + Intronic
978114943 4:105008190-105008212 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
978305767 4:107327053-107327075 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
979007010 4:115311993-115312015 CCCAGCAAAAAGAACAAAGCTGG + Intergenic
979062408 4:116079959-116079981 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
979182237 4:117744434-117744456 CATATCACAGAGAACAGTGCTGG - Intergenic
979294057 4:119010614-119010636 CATAGCACATAGCACATAGCAGG - Intronic
979310921 4:119202354-119202376 CTAAGCACAAAGAACAAAGCTGG + Intronic
980858619 4:138471361-138471383 CTAAGCACAAAGAACAAAGCTGG - Intergenic
981426055 4:144604410-144604432 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
981469119 4:145109869-145109891 CCTAGCACCTAGGACATAGAAGG - Intronic
981851220 4:149232488-149232510 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
981931588 4:150195070-150195092 ACTAGCACAGATAACGTAACAGG - Intronic
982218969 4:153108408-153108430 CCAAGCAAAGGGAACAAAGCTGG + Intergenic
983669728 4:170222132-170222154 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
983755794 4:171333880-171333902 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
984053109 4:174891693-174891715 CCTTGCAGAGAGAAGATAGTGGG + Intronic
984237654 4:177180220-177180242 CCTCTCACAGACAACAAAGCTGG - Intergenic
985290682 4:188384039-188384061 CTAAGCACAAAGAACAAAGCTGG - Intergenic
985332188 4:188850357-188850379 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
986066441 5:4239218-4239240 CTAAGCAAAAAGAACATAGCTGG - Intergenic
986152798 5:5142749-5142771 AATAGCAAAGAGAACAAAGCTGG + Intronic
986642057 5:9881557-9881579 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
986971452 5:13341847-13341869 CCTAACAAAAAGAACAAAGCTGG + Intergenic
987670107 5:20995677-20995699 CTTAGCAGAGAGAACAAAGCTGG + Intergenic
988307198 5:29507574-29507596 CCAAGCACAGTGAACATAAAAGG + Intergenic
989482619 5:41949764-41949786 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
989728952 5:44624795-44624817 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
990434051 5:55769714-55769736 CCAAGCACAAAGAACAAAGCTGG + Intronic
990898105 5:60721256-60721278 CCAAGCAAACAGAACAAAGCTGG + Intergenic
991264949 5:64706668-64706690 CCTATCAAAGAGAAAATAGGGGG + Intronic
991287956 5:65000767-65000789 CCGAGCACAAAGAACAAAGCTGG - Intronic
991579811 5:68142982-68143004 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
992437393 5:76768474-76768496 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
993403112 5:87477249-87477271 CCTAGCAAATAGAACAAAGCTGG + Intergenic
993741691 5:91549389-91549411 CTAAGCAAAAAGAACATAGCTGG + Intergenic
993793225 5:92233296-92233318 TCTAGCAAAAAGAACAAAGCTGG - Intergenic
993797464 5:92285071-92285093 CTAAGCACAAAGAACAAAGCTGG + Intergenic
993896054 5:93536485-93536507 CTTAGCATAAAGAACAAAGCTGG + Intergenic
993967813 5:94379541-94379563 CCTAGCAAAAAGAACAAAGCTGG - Intronic
994429131 5:99633305-99633327 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
994908198 5:105868011-105868033 CCTAGCACTGCAGACATAGCTGG - Intergenic
995302615 5:110601845-110601867 CTAAGCAAAGAGAACAAAGCTGG + Intronic
995450802 5:112298068-112298090 CTAAGCAAAAAGAACATAGCTGG - Intronic
996049115 5:118911791-118911813 CCAAGTACAGAGATAATAGCTGG - Intronic
996399788 5:123049159-123049181 ACAAGCAAAGAGAACAAAGCTGG - Intergenic
996648412 5:125844119-125844141 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
996784239 5:127221255-127221277 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
996970800 5:129365566-129365588 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
997100216 5:130959871-130959893 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
997178402 5:131802516-131802538 CCTAGCACTTGGAACATAGTAGG - Intergenic
997807172 5:136929726-136929748 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
998275492 5:140748860-140748882 CCAAGCAAAAAGAACAAAGCAGG - Intergenic
998972351 5:147606624-147606646 CCTAGCAAAAAGAACAAAGCTGG - Intronic
1000373677 5:160560226-160560248 CCAAGCACTGGGAACACAGCAGG + Intergenic
1000584319 5:163077900-163077922 CTAAGCAGAAAGAACATAGCTGG + Intergenic
1000819787 5:165969106-165969128 CCTAGCAAAAAGAACAAAGCTGG - Intergenic
1001148814 5:169208484-169208506 CCAAGCAAAGAGAACAAAGCTGG + Intronic
1001372205 5:171216343-171216365 CTTAGCAAAAAGAACAAAGCTGG - Intronic
1002336385 5:178481786-178481808 CCTATGACTGAGAACATAGGTGG - Intronic
1005151915 6:22761458-22761480 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1006340558 6:33444104-33444126 CATAGCACATGGCACATAGCAGG - Intronic
1006644812 6:35508897-35508919 CCTGGCACAGAAAACATGGTGGG + Intronic
1007949819 6:45861310-45861332 TCAGGCACAGAGAACACAGCTGG - Intergenic
1008785569 6:55163325-55163347 CTAAGCAAAAAGAACATAGCTGG + Intronic
1009279337 6:61726972-61726994 CTAAGCAAAGAGAACAAAGCTGG + Intronic
1009316463 6:62226965-62226987 CCTAGCAAAAAGAACAAAGCTGG - Intronic
1009597310 6:65752286-65752308 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1010348678 6:74844872-74844894 CTTAGCACAGAGAAAATCCCAGG - Intergenic
1010399672 6:75434130-75434152 CTAAGCAAAGAGAACAAAGCTGG - Intronic
1010819762 6:80399794-80399816 CCTAGCAAAAAGAACAAAGCTGG + Intergenic
1010961437 6:82150563-82150585 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1010994428 6:82516966-82516988 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1011412321 6:87078732-87078754 CCTAGCACAGAGAAAAAAGTAGG + Intergenic
1014421461 6:121251277-121251299 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1015002114 6:128230454-128230476 CCTGGCACAGAGCACATGGACGG + Intronic
1015707119 6:136100215-136100237 CTAAGCAAAGAGAACAAAGCTGG - Intronic
1016554279 6:145318002-145318024 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1017285872 6:152675767-152675789 CTAAGCACAAAGAACAAAGCTGG + Intergenic
1017636256 6:156445941-156445963 CCTAGCACATAGCAAATAGTAGG + Intergenic
1017930607 6:158951094-158951116 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1017946796 6:159102539-159102561 CCTGGCACAGAGATCAATGCTGG - Intergenic
1017968248 6:159285945-159285967 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1018253313 6:161894023-161894045 TATAGCACATAGAACTTAGCTGG - Intronic
1019130801 6:169872402-169872424 CTGAGCACAAAGAACAAAGCTGG - Intergenic
1020357988 7:7298445-7298467 TATAGCAAAAAGAACATAGCTGG - Intergenic
1020520094 7:9174180-9174202 CCTAGCACAGAGAGCATCCCTGG - Intergenic
1020923800 7:14298255-14298277 CTTAGCAAAAAGAACAAAGCTGG + Intronic
1022808855 7:33849505-33849527 CCTAGAACTGAGAACACAGTTGG + Intergenic
1024217043 7:47256519-47256541 CCAAGTACAGAGAACAAAACAGG + Intergenic
1025789388 7:64674047-64674069 CCAAGCAAAAAGAACAAAGCTGG - Intronic
1026822717 7:73560409-73560431 CCTAGCACAGTGGACACTGCAGG + Intergenic
1027667322 7:81056246-81056268 CCTAGCCAAAAGAACAAAGCTGG + Intergenic
1028644576 7:93081082-93081104 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1029919335 7:104245860-104245882 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1030414650 7:109227549-109227571 CCTAGCACATAGAACACACCAGG + Intergenic
1030612158 7:111701384-111701406 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1030701151 7:112642529-112642551 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1030736515 7:113055056-113055078 CCTTGCAGAGAGAACATCTCAGG + Intergenic
1030794591 7:113771936-113771958 CATAGCCCAGGCAACATAGCAGG - Intergenic
1031099608 7:117463180-117463202 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1031260612 7:119514695-119514717 GCTAGTACTGAGAACAGAGCAGG + Intergenic
1031542720 7:123014616-123014638 TCAAGCAAAGAGAACAAAGCTGG - Intergenic
1031581210 7:123477138-123477160 CTAAGCAAAGAGAACAAAGCTGG + Intronic
1032249766 7:130245574-130245596 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1032579625 7:133092203-133092225 CCCATGAGAGAGAACATAGCTGG - Intergenic
1032883035 7:136110344-136110366 CATAGCAAAAAGAACAAAGCTGG - Intergenic
1032940760 7:136787732-136787754 CTGAGCAAAGAGAACAAAGCTGG - Intergenic
1032942769 7:136814128-136814150 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1034814314 7:154158836-154158858 TCTTGCCCAGGGAACATAGCTGG + Intronic
1036160766 8:6386337-6386359 CCTAGCCAAAAGAACAAAGCTGG + Intergenic
1036925870 8:12904992-12905014 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1037556389 8:20027903-20027925 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1039008408 8:33066707-33066729 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1039252750 8:35684618-35684640 TCTACCACAGCGAACATTGCAGG - Exonic
1039555833 8:38474235-38474257 CCTAGACCAGCGACCATAGCTGG - Intergenic
1041051241 8:53936794-53936816 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1041424784 8:57708081-57708103 CCAAGCAAAAAGAACACAGCTGG + Intergenic
1041580145 8:59449265-59449287 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1043233734 8:77834408-77834430 CTTAGCAAAAAGAACAGAGCTGG + Intergenic
1044047365 8:87453179-87453201 CTGAGCACAGAGAACATAGTAGG + Intronic
1044124013 8:88435974-88435996 CTGAGCACAAAGAACAAAGCTGG + Intergenic
1046011415 8:108552891-108552913 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1046145365 8:110151322-110151344 CCAAGCAGAAAGAACAAAGCTGG - Intergenic
1046296100 8:112220444-112220466 CTAAGCAAAAAGAACATAGCTGG + Intergenic
1047853615 8:128885721-128885743 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1048188390 8:132265120-132265142 CATAGCACACAGCACATAGTAGG + Intronic
1050000029 9:1067598-1067620 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1050852485 9:10304958-10304980 CTAAGCAAAGAGAACAAAGCTGG + Intronic
1050879774 9:10684696-10684718 CCTAGAAAAGAGATCAAAGCAGG - Intergenic
1050968672 9:11841048-11841070 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1052594340 9:30539188-30539210 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1052793174 9:32896916-32896938 CTAAGCACAAAGAACAAAGCTGG - Intergenic
1052800469 9:32962507-32962529 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1052896661 9:33753687-33753709 CCTAGCACAGTGCCCATAGCAGG + Intronic
1053528936 9:38858904-38858926 CCTAGAACACAGAACACAGTAGG - Intergenic
1053791377 9:41688585-41688607 AGCAGCACAGAGAACACAGCGGG + Intergenic
1054201164 9:62083339-62083361 CCTAGAACACAGAACACAGTAGG - Intergenic
1054637195 9:67505025-67505047 CCTAGAACACAGAACACAGTAGG + Intergenic
1055748053 9:79472583-79472605 CCTATCACAGAGAACTAAACAGG - Intergenic
1056967024 9:91171997-91172019 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1058303080 9:103399911-103399933 CTTAGCAAAGAGAACAGAGTTGG - Intergenic
1058614728 9:106813871-106813893 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1059613945 9:115928768-115928790 CCTAGCACAGAAAACAAAGAGGG + Intergenic
1060441292 9:123642044-123642066 GCTAGCAGAGAGACCATGGCTGG + Intronic
1061117151 9:128621100-128621122 CCTAGCCCACAACACATAGCAGG + Intronic
1061580293 9:131531789-131531811 CCTGGCACAGAGAACGTGACAGG + Intergenic
1061652978 9:132066076-132066098 CCTGGCACTGAGTACAGAGCAGG - Intronic
1061981345 9:134105680-134105702 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1062110474 9:134779531-134779553 CCTAGCACCCAGCACACAGCAGG - Intronic
1062573212 9:137194909-137194931 CCTGGCACAGCCAACAGAGCAGG + Intronic
1062643095 9:137531961-137531983 GCCAGCCCAGACAACATAGCAGG - Intronic
1203441515 Un_GL000219v1:13248-13270 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1203512324 Un_KI270741v1:132156-132178 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1186061605 X:5714190-5714212 CTAAGCAAAAAGAACATAGCTGG + Intergenic
1186670609 X:11764152-11764174 CCCAGCATAGAGAACTTAGGTGG + Intronic
1187584536 X:20645572-20645594 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1188586526 X:31782761-31782783 TCCAGCAGAGAGAACACAGCTGG + Intronic
1188804659 X:34571852-34571874 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1189126090 X:38448287-38448309 CTTAGCAGAAAGAACAAAGCTGG - Intronic
1189722623 X:43936044-43936066 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1191001770 X:55667405-55667427 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1191111591 X:56807255-56807277 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1191139318 X:57099307-57099329 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1191652069 X:63550160-63550182 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1191653259 X:63565212-63565234 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1191664924 X:63691755-63691777 CCGAGCAAAAAGAACAAAGCTGG + Intronic
1192758783 X:74073439-74073461 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1193153058 X:78144592-78144614 CTAAGCAAAGAGAACAAAGCTGG - Intergenic
1193281093 X:79651838-79651860 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1193391474 X:80934041-80934063 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1193493908 X:82187218-82187240 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1193568204 X:83106517-83106539 CCTAGCACATAGAACATGTATGG + Intergenic
1193577914 X:83226561-83226583 CTAAGCATAGAGAACAAAGCTGG - Intergenic
1193639050 X:83989235-83989257 CCAAGCAAAGAGAACAAAGCTGG + Intergenic
1193675344 X:84445445-84445467 TACAGCACAGAGAACATTGCTGG + Intronic
1193907179 X:87258314-87258336 CTAAGCAAAGAGAACAAAGCTGG + Intergenic
1193955782 X:87860226-87860248 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1193967739 X:88009191-88009213 CTTAGCAAAAAGAACAAAGCTGG - Intergenic
1194324904 X:92502422-92502444 CATAGCAAAAAGAACAAAGCAGG + Intronic
1194363043 X:92978379-92978401 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1194790967 X:98149112-98149134 CTTAGCAAAAAGAACAAAGCTGG + Intergenic
1194889251 X:99356923-99356945 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1196092030 X:111754970-111754992 CCAAGCAAAAAGAACAAAGCTGG + Intronic
1196280699 X:113820635-113820657 CCAAGCAAAAAGAACAAAGCTGG - Intergenic
1196305071 X:114092405-114092427 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1196534238 X:116823031-116823053 CATAGCAAAAAGAACAAAGCTGG + Intergenic
1197141882 X:123126432-123126454 CTTAGCAAAAAGAACAAAGCGGG + Intergenic
1197680293 X:129375577-129375599 CTAAGCACAAAGAACAAAGCTGG + Intergenic
1197736698 X:129855091-129855113 CTAAGCAAAAAGAACATAGCTGG - Intergenic
1197781719 X:130166415-130166437 CCAAGCACAGAAACCACAGCAGG - Intergenic
1198060524 X:133041821-133041843 CCTAGGACAGAGCACGTAGGAGG - Intronic
1199434690 X:147800396-147800418 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1199852436 X:151735279-151735301 CCTACCAAAGAGAACAGAGATGG - Intergenic
1200295168 X:154912642-154912664 CTGAGCAAAGAGAACAAAGCTGG - Intronic
1200633636 Y:5621597-5621619 CATAGCAAAAAGAACAAAGCAGG + Intronic
1200671285 Y:6094625-6094647 CCAAGCAAAAAGAACAAAGCTGG + Intergenic
1201229503 Y:11850399-11850421 CTTAGCAAAAAGAACAAAGCTGG + Intergenic