ID: 1093984805

View in Genome Browser
Species Human (GRCh38)
Location 12:25518809-25518831
Sequence GGTCTGGTTGACCGAGTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093984803_1093984805 -8 Left 1093984803 12:25518794-25518816 CCTGAGGCTCGATTAGGTCTGGT 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1093984805 12:25518809-25518831 GGTCTGGTTGACCGAGTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 64
1093984799_1093984805 20 Left 1093984799 12:25518766-25518788 CCACTGGAACAAGCACTCTTTTA 0: 1
1: 0
2: 2
3: 10
4: 199
Right 1093984805 12:25518809-25518831 GGTCTGGTTGACCGAGTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093984805 Original CRISPR GGTCTGGTTGACCGAGTCCT GGG Exonic
902404091 1:16173696-16173718 GCTCTGTTTGCCCGAGGCCTGGG - Intergenic
907869036 1:58426243-58426265 GGTATGGTAGACAGAGCCCTGGG - Intronic
923458107 1:234183614-234183636 GGCCTGGTCGACTGAGTCCTTGG + Intronic
923578945 1:235188783-235188805 GATCTGGTTGGCCATGTCCTAGG - Intronic
1065742610 10:28810877-28810899 GATCTGATTGACCTTGTCCTTGG + Intergenic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1087844051 11:102951250-102951272 GGACTGGTTGAAAGAGTACTTGG + Intronic
1091054144 11:132402589-132402611 GGTCTAGTTGAAAGAGCCCTGGG + Intergenic
1093984805 12:25518809-25518831 GGTCTGGTTGACCGAGTCCTGGG + Exonic
1100779732 12:98011232-98011254 CTTCTGGTTGACCTAGTCATGGG + Intergenic
1104757345 12:131277397-131277419 GGACTGGTGTCCCGAGTCCTGGG - Intergenic
1104775701 12:131389077-131389099 GGACTGGTGTCCCGAGTCCTGGG + Intergenic
1111579673 13:90207112-90207134 TGCCTGGTTGATCGAGTACTAGG - Intergenic
1114721641 14:24888957-24888979 GGTCTGGCTGCCAGGGTCCTGGG - Intronic
1120048678 14:79839246-79839268 GGTCTGGTTGGCTGAGGCCTAGG + Intronic
1122523670 14:102364148-102364170 GGTCTTGTAGACAGAGTTCTGGG + Intronic
1122587624 14:102820273-102820295 GGTCTGGCTGCCCGGGTCCAAGG + Intronic
1202918178 14_KI270723v1_random:3681-3703 TGTCTGGTTGACCTAGGCCCCGG - Intergenic
1202926453 14_KI270724v1_random:30906-30928 TGTCTGGTTGACCTAGGCCCCGG + Intergenic
1126520043 15:49582609-49582631 GGTCCGTTTGACCCAGTGCTGGG - Intronic
1127793380 15:62417898-62417920 GGTGTGGTTGTCCGAATGCTTGG + Intronic
1130115728 15:81002628-81002650 GGTGTCGCTGACCGAGTGCTCGG + Exonic
1131501732 15:92973971-92973993 GGTCTGGTGGGCAGAGTTCTGGG + Intronic
1138234168 16:55366649-55366671 GGGCTGGTTGTCAGTGTCCTGGG - Intergenic
1143747051 17:9002767-9002789 TGTTTGTTTGACCGAGTGCTGGG - Intergenic
1146544774 17:33728620-33728642 GTTCTGTTTGACAGAGTACTGGG + Intronic
1153145499 18:2027214-2027236 AGAATGGTTGACTGAGTCCTAGG - Intergenic
1156228375 18:35130863-35130885 GCTCTGGGTGTCCGAGTTCTTGG + Intronic
1166685396 19:44793469-44793491 GGTCTGGCTGTCCGAGTGCTGGG - Exonic
1167145617 19:47679721-47679743 GGCCTTGTTGACCACGTCCTGGG - Exonic
934727468 2:96633228-96633250 AGTCTGGGTGACAGAGACCTCGG + Intronic
944754230 2:202743081-202743103 GGTCTGGGTAAGCTAGTCCTTGG - Intronic
947575458 2:231270143-231270165 GGTCTGGTTGCCAGGGTCCTGGG + Intronic
948691058 2:239705408-239705430 GGTCTGGGTGGCCAAGTCTTCGG - Intergenic
1168908523 20:1426435-1426457 GGTCTTGTTGACTGAGTCCCTGG - Intergenic
1171780015 20:29410007-29410029 AGTCGGGTTGGCGGAGTCCTCGG - Intergenic
1171782143 20:29428341-29428363 TGTCTGGTTGACCTAGGCCCCGG - Intergenic
1174069534 20:47889927-47889949 GGTCTGGCAGACCCAGTTCTGGG - Intergenic
1174451735 20:50624804-50624826 GGTGTGGTTGGCAGAGGCCTTGG + Intronic
1183489973 22:38110958-38110980 GGTCTGGCAGAGAGAGTCCTGGG - Intergenic
1184560388 22:45259724-45259746 GGTCTGGTTCAGGGATTCCTGGG - Intergenic
951107619 3:18763405-18763427 GATCTGGTTGACAGATTCATTGG + Intergenic
952152612 3:30608288-30608310 GGTCTGGGTAACCGAGTATTTGG + Intronic
955050660 3:55407584-55407606 GGTCTGATTGACTCAGTCCCAGG - Intergenic
955275978 3:57547118-57547140 GGGCTGGTTAACCAAGTCCATGG - Intergenic
957083345 3:75658064-75658086 TGTCTGGTTGACCTAGCCCCAGG + Intergenic
960807333 3:121596913-121596935 GTTCTCGTTGACTGAGTGCTGGG + Intronic
968599845 4:1503714-1503736 TGTCCGGGTGATCGAGTCCTGGG - Intergenic
971612307 4:28741481-28741503 GGTGTTGATGACCTAGTCCTGGG - Intergenic
983386533 4:167070240-167070262 TGGCTGGTTGACCTACTCCTTGG - Intronic
985448199 4:190038854-190038876 TGTCTGGTTGACCTAGACCCCGG - Intergenic
995145518 5:108784137-108784159 GGTCTGGTTTACCCAGCCGTTGG - Intronic
1001265760 5:170273531-170273553 GGTCTGGTTACCTGGGTCCTAGG + Intronic
1002109127 5:176896233-176896255 GGTCTGGGTTACAGACTCCTAGG - Intronic
1004555514 6:16693600-16693622 GTTCTGTTTGATCAAGTCCTGGG - Intronic
1004583798 6:16979831-16979853 GCTGTGGTTGACAGAGTCCTAGG - Intergenic
1017546981 6:155462948-155462970 GCTCTGGGAGCCCGAGTCCTAGG + Intergenic
1022817910 7:33931060-33931082 GGTCTGCTTACCCAAGTCCTGGG + Intronic
1023247007 7:38215830-38215852 GGTCTGGGTGGCCCAGGCCTGGG + Intronic
1033171734 7:139090865-139090887 CTCCTGGTTGACAGAGTCCTTGG - Intronic
1035602582 8:905530-905552 GGTCTGATTGCCTGAGTCCAGGG + Intergenic
1035906509 8:3516438-3516460 GGCCTGGTTGAGTGAGTCATTGG + Intronic
1038066357 8:23967595-23967617 AGTCTGGTTGACTTATTCCTTGG - Intergenic
1039621030 8:38997124-38997146 GGCCTGGTGGGCCCAGTCCTCGG + Exonic
1052508203 9:29381757-29381779 GGTCAGGTAGACCCAGGCCTGGG - Intergenic
1053425535 9:38007594-38007616 GGGCTGGTCCACAGAGTCCTGGG - Intronic
1057849742 9:98556205-98556227 TGTCTGGTTGAGTGATTCCTTGG - Intronic
1060984248 9:127810485-127810507 GGTTTGGTTGAAGGAGTCATTGG + Intronic
1060998838 9:127890816-127890838 GGTCCGGTTGACAAACTCCTGGG + Exonic
1187669981 X:21657933-21657955 GGTCTGGATGAAGGAGCCCTGGG - Exonic
1197567197 X:128101853-128101875 GGTTTTGTTGACCGGGTCCACGG - Intergenic