ID: 1093989304 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:25572054-25572076 |
Sequence | GATTTGCACTGAAACGTATC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 65 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 61} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1093989304_1093989309 | 29 | Left | 1093989304 | 12:25572054-25572076 | CCAGATACGTTTCAGTGCAAATC | 0: 1 1: 0 2: 0 3: 3 4: 61 |
||
Right | 1093989309 | 12:25572106-25572128 | CTTATGTAAAATAACTTCATAGG | 0: 1 1: 1 2: 1 3: 27 4: 343 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1093989304 | Original CRISPR | GATTTGCACTGAAACGTATC TGG (reversed) | Intronic | ||