ID: 1093989304

View in Genome Browser
Species Human (GRCh38)
Location 12:25572054-25572076
Sequence GATTTGCACTGAAACGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093989304_1093989309 29 Left 1093989304 12:25572054-25572076 CCAGATACGTTTCAGTGCAAATC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1093989309 12:25572106-25572128 CTTATGTAAAATAACTTCATAGG 0: 1
1: 1
2: 1
3: 27
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093989304 Original CRISPR GATTTGCACTGAAACGTATC TGG (reversed) Intronic