ID: 1093989304

View in Genome Browser
Species Human (GRCh38)
Location 12:25572054-25572076
Sequence GATTTGCACTGAAACGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093989304_1093989309 29 Left 1093989304 12:25572054-25572076 CCAGATACGTTTCAGTGCAAATC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1093989309 12:25572106-25572128 CTTATGTAAAATAACTTCATAGG 0: 1
1: 1
2: 1
3: 27
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093989304 Original CRISPR GATTTGCACTGAAACGTATC TGG (reversed) Intronic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
908755248 1:67463758-67463780 GATTTGCAATGAAAAGCAGCTGG - Intergenic
916856377 1:168754494-168754516 CATTTGGACTGAAAAGTATTGGG + Intergenic
918582065 1:186143063-186143085 AATTTGCACTAAAAAGTATTTGG - Intronic
919902571 1:202055142-202055164 GATTTGAACTGAGACCTGTCTGG + Intergenic
920609465 1:207423188-207423210 GCTTTGCCCGGAAACTTATCCGG + Intergenic
921945920 1:220886045-220886067 GATTGGCACTGAGACTGATCAGG - Intergenic
1078736446 11:14024919-14024941 GATTAGAACTGAAAAGAATCTGG + Intronic
1081026175 11:38018140-38018162 GATTTGCAAGGAAAAGTAACAGG + Intergenic
1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG + Intronic
1085067221 11:73507985-73508007 GATTTGAACTGAATAGTGTCTGG - Intronic
1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG + Intergenic
1087081989 11:94179834-94179856 AGTTTGCACTGAAACTGATCGGG - Exonic
1087383714 11:97442272-97442294 TATTTGTTCTGAAAAGTATCAGG - Intergenic
1090955560 11:131510478-131510500 GATTTGAACTGAAATCTGTCTGG - Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1099093150 12:78338933-78338955 GATATGCACTGTGATGTATCTGG + Intergenic
1101545869 12:105712219-105712241 GATTTGCACTCAAAGCTCTCTGG - Intergenic
1104768966 12:131348458-131348480 GACCTGCACTGAAATGCATCGGG + Intergenic
1109398804 13:61797261-61797283 GATTTTTACAGAAAAGTATCTGG + Intergenic
1116801568 14:49449674-49449696 GATTTCTACTGAAATGGATCAGG + Intergenic
1119974504 14:79010485-79010507 GTTTTTCACTGAAATATATCAGG + Intronic
1129911225 15:79228150-79228172 GATTAGCACAGAAACCTGTCTGG - Intergenic
1133532095 16:6664820-6664842 GTTTTGCAGTCAAACGGATCTGG + Intronic
1142588719 17:991088-991110 GATTTGATCTGAAAAGTATTGGG - Intergenic
1153936965 18:9935994-9936016 GATTTGCCTTAAACCGTATCTGG - Intronic
1155400351 18:25432194-25432216 GAAATGTACAGAAACGTATCAGG + Intergenic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1163839347 19:19596586-19596608 GATTTACTCTGAAAGGAATCAGG + Intronic
1167469250 19:49666258-49666280 GATTTGCCCTGAAACCTCTTGGG + Intronic
930365699 2:50436587-50436609 TATCTGCCCTGAAACCTATCTGG - Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
935708806 2:105879626-105879648 TATTTGCTCTGAAACGTACGTGG + Intronic
938422365 2:131155324-131155346 GCTTTCCACTGAAACGTGGCAGG - Intronic
943319887 2:186433371-186433393 GGTTTGCCCAGAAACTTATCTGG - Intergenic
946696194 2:222362087-222362109 GATTTTCACTGTAAAGTCTCTGG - Intergenic
1170545116 20:17429386-17429408 GATATGCAGTGAAACGAATTTGG - Intronic
1173444594 20:43106273-43106295 CATTTGCACTGAAAAGCATGGGG - Intronic
949637635 3:6000760-6000782 GCTTGGCACTGAAAAGTATCAGG - Intergenic
955819950 3:62886127-62886149 GATTTGAACCCAAACCTATCTGG - Intergenic
958664866 3:97124266-97124288 GATTAATACTGAAACGCATCTGG - Intronic
966704727 3:182899634-182899656 GATTTGAACTGAGATCTATCAGG - Intronic
973223424 4:47754725-47754747 GATTTGCACTGAAGAGAAACAGG + Intronic
979612684 4:122705790-122705812 GTTTTGGACTGCAACATATCAGG - Intergenic
988017148 5:25573849-25573871 CATTAGCAGTGAAACGGATCTGG - Intergenic
991998117 5:72408320-72408342 GATTTGCACTGAGTGGTTTCAGG + Intergenic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1008883649 6:56408906-56408928 GAATTGAACTGATATGTATCAGG + Intergenic
1013443908 6:110201406-110201428 CAGCTGCACTGAACCGTATCAGG + Intronic
1020885859 7:13818646-13818668 GGTTTGCAATGAAAGGTGTCTGG + Intergenic
1021131783 7:16920749-16920771 GTCTTGCACTGAAAAGTCTCTGG + Intergenic
1042514374 8:69644253-69644275 GATTTGAACTCAAACTAATCAGG - Intronic
1046198482 8:110892540-110892562 GCTTTGCCCGGAAACTTATCCGG + Intergenic
1047286686 8:123493325-123493347 CTTTTGCACTGCCACGTATCTGG + Intergenic
1048873567 8:138818318-138818340 GATTCCAACTGAAAAGTATCAGG - Intronic
1050652491 9:7789456-7789478 GCTTTGCCCAGAAACTTATCCGG + Intergenic
1051181151 9:14413127-14413149 GATTTGTAATGAAACTTATGAGG + Intergenic
1052087291 9:24283568-24283590 TATCAACACTGAAACGTATCAGG - Intergenic
1060238238 9:121881687-121881709 GATTTGCACTGATGCGAATGAGG + Intronic
1189381048 X:40502410-40502432 GATTTGCACTGAAATCTCTCTGG + Intergenic
1191177439 X:57519459-57519481 GATATGGTCAGAAACGTATCTGG + Intergenic
1195746150 X:108120766-108120788 GACTTGCCCTGAAATTTATCAGG + Intronic
1198215399 X:134550140-134550162 GATCTGCACTCAAACGCATGGGG - Intergenic
1199447678 X:147944775-147944797 GATTACCCCTGAAACGTCTCTGG + Intronic
1199893744 X:152113340-152113362 GATTTGCATGGAAAAGCATCTGG - Intergenic