ID: 1093989309

View in Genome Browser
Species Human (GRCh38)
Location 12:25572106-25572128
Sequence CTTATGTAAAATAACTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093989304_1093989309 29 Left 1093989304 12:25572054-25572076 CCAGATACGTTTCAGTGCAAATC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1093989309 12:25572106-25572128 CTTATGTAAAATAACTTCATAGG 0: 1
1: 1
2: 1
3: 27
4: 343
1093989308_1093989309 -3 Left 1093989308 12:25572086-25572108 CCATTGATTTGCTATGAGAACTT 0: 1
1: 0
2: 2
3: 32
4: 324
Right 1093989309 12:25572106-25572128 CTTATGTAAAATAACTTCATAGG 0: 1
1: 1
2: 1
3: 27
4: 343
1093989307_1093989309 0 Left 1093989307 12:25572083-25572105 CCTCCATTGATTTGCTATGAGAA 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1093989309 12:25572106-25572128 CTTATGTAAAATAACTTCATAGG 0: 1
1: 1
2: 1
3: 27
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093989309 Original CRISPR CTTATGTAAAATAACTTCAT AGG Intronic
903928711 1:26849930-26849952 CTTATTTATAATAACTGGATTGG - Intronic
909265792 1:73557016-73557038 CTGATTTAAACTCACTTCATAGG - Intergenic
909324151 1:74328338-74328360 CATGAGTAAAATAACTTGATAGG + Intronic
910018814 1:82559827-82559849 ATTATTTAAAATATCATCATGGG + Intergenic
910574435 1:88744193-88744215 CTAATCTAAAATAAATTCATGGG - Intronic
910905258 1:92170334-92170356 CTTATGCATAATTACTTCATTGG + Intronic
911529437 1:99026603-99026625 ATTATTTAAAATAACTTTAATGG - Intergenic
912944240 1:114071280-114071302 GTTATGCAAAATAAATGCATTGG - Intergenic
917297149 1:173532383-173532405 CTTATGTAATGCAACTCCATTGG + Intronic
917621453 1:176800776-176800798 CTTGTTTAAAATAACTGCCTGGG + Intronic
918690691 1:187475529-187475551 TTTTTGTAAAACAACTTCAGGGG - Intergenic
919413044 1:197270819-197270841 CTTATGCATTATCACTTCATGGG - Intronic
920574377 1:207047902-207047924 ATTATTTAAAATAACTTTAGTGG + Exonic
921990608 1:221362079-221362101 TTTCTGTAAAAAAACCTCATTGG + Intergenic
922451237 1:225739113-225739135 CTTATGTAAAAGAATTCCAGGGG - Intergenic
922671679 1:227512905-227512927 CTTCTATACAATGACTTCATGGG - Intergenic
923089902 1:230732100-230732122 CATAAGTAATATAATTTCATGGG - Intergenic
923885984 1:238156355-238156377 CTTATCTCCATTAACTTCATTGG - Intergenic
924016311 1:239727994-239728016 ATTATGTAAATTAGCTTGATTGG - Intronic
924197857 1:241627109-241627131 TTTATATATAATACCTTCATTGG - Intronic
924646232 1:245879595-245879617 CTGATGAAGAATAACTTCTTTGG - Intronic
1063060826 10:2550564-2550586 TTTAGGAAAAATAACTTCTTAGG + Intergenic
1063895314 10:10675231-10675253 CTACTGAAAAATAACTTCACAGG + Intergenic
1064897225 10:20250951-20250973 CTTATATAAAATACTTACATGGG + Intronic
1065613852 10:27500379-27500401 CTGCTGTAAAATAAGTTCCTTGG + Intergenic
1068145613 10:53066716-53066738 ATTATGTAAAATGACTTCCCGGG + Intergenic
1068753387 10:60622796-60622818 CATGTGAAAAATAACTTGATAGG - Intronic
1068778482 10:60893243-60893265 CTACCATAAAATAACTTCATCGG - Intronic
1068879165 10:62030429-62030451 CTTACTTAAAATACCTGCATTGG - Intronic
1069021295 10:63491310-63491332 CTGATTCAAAATAATTTCATGGG + Intergenic
1069471697 10:68697909-68697931 CTAATGTAAATTTACTCCATTGG + Intergenic
1071879836 10:89884661-89884683 CTTATGTAGAATGACTTGATAGG - Intergenic
1073621551 10:105054647-105054669 CTTATGTAAAAAACCGTCAGAGG - Intronic
1074050115 10:109874140-109874162 ATTTTTTAAAATAACTTCATTGG - Intronic
1074291938 10:112144186-112144208 ATTATGTAAAATTATTTCCTGGG + Intergenic
1074442246 10:113488229-113488251 CTTATTTCTAATAAGTTCATAGG - Intergenic
1076380453 10:130021622-130021644 CTTATTTAACGGAACTTCATAGG - Intergenic
1077800602 11:5532272-5532294 CATATGTAAAACAATTACATAGG + Intronic
1078581526 11:12542875-12542897 CTTGAGTAAAATAATGTCATTGG - Intergenic
1078664188 11:13310803-13310825 TTTATCCAAAATAACTTCAATGG - Intronic
1078770223 11:14343128-14343150 CTCATGTCAGACAACTTCATTGG + Intronic
1079154762 11:17935548-17935570 CATCTGTAAAATAAAATCATTGG - Intronic
1079435817 11:20448196-20448218 CCTATCTAAAACAAATTCATAGG - Intronic
1079770964 11:24459226-24459248 TTTATGGAACATAACTTCATTGG + Intergenic
1079956023 11:26865606-26865628 CTTGTGTGAAACAACCTCATGGG + Intergenic
1080474668 11:32578974-32578996 CTTATGTAAAATAAATTCATGGG + Intergenic
1083286556 11:61662994-61663016 CATATGTGAAATAAATTCATTGG + Intergenic
1084281827 11:68101246-68101268 TTTATGTAAAATAACCTCTTTGG - Intronic
1086239592 11:84673241-84673263 CTTATGTAAAATACATTTAGAGG - Intronic
1086588796 11:88486979-88487001 CTTATGTAAAAAACCTACAAAGG + Intergenic
1087418199 11:97885450-97885472 AATAGGTAAAATAACTTCAAGGG - Intergenic
1089023917 11:115247978-115248000 CTGATGTTAAAGAATTTCATGGG - Intronic
1090304967 11:125683471-125683493 CTTATTTAAAATAGCTTCAGGGG + Intergenic
1091949944 12:4584459-4584481 TTTATGCAAAATAACTACAAAGG - Intronic
1093748892 12:22776180-22776202 CTTATTTAGAATGAGTTCATGGG + Intergenic
1093989309 12:25572106-25572128 CTTATGTAAAATAACTTCATAGG + Intronic
1094555165 12:31492205-31492227 CTTACATAAAATAACCTCAGGGG + Intronic
1095524881 12:43113591-43113613 ATTATGTAATATAATTTCAGAGG - Intergenic
1095694401 12:45128370-45128392 CTTGTGGAAAATCACTTGATGGG - Intergenic
1096091066 12:48901680-48901702 CATATTTAAAACAACTTTATTGG + Intergenic
1096280474 12:50248528-50248550 ATAATGTAAAATAATTTTATTGG - Intronic
1096943963 12:55383240-55383262 TTTATGTAAAAAAAATTCAATGG - Intergenic
1097911597 12:64975910-64975932 TTTCTGTAAACTGACTTCATAGG - Intergenic
1097918236 12:65042461-65042483 CTTAAAAAAAATAACTTTATTGG + Intergenic
1098227127 12:68335866-68335888 CTTAAATAAAATAACTCCATTGG + Intergenic
1099676042 12:85761587-85761609 AATATGAAAAATAAATTCATTGG + Intergenic
1100880862 12:99015390-99015412 ATCATGAAAAATAACTTAATGGG + Intronic
1101701034 12:107174116-107174138 CTTATGGCAAATAAATTCTTTGG + Intergenic
1106514579 13:30442238-30442260 CTCAAGTAAATTAAATTCATTGG - Intergenic
1108284831 13:48896429-48896451 CTTATGTCCAATAGCTTCCTGGG - Intergenic
1110038630 13:70720870-70720892 ATGATGGAAAATAAATTCATAGG - Intergenic
1110195082 13:72779947-72779969 TTTATGTAATATAACGTAATAGG + Intronic
1110283974 13:73728175-73728197 CTTTTGTTAAATATGTTCATAGG + Intronic
1110589016 13:77232174-77232196 CTAATTTAAAAAAATTTCATAGG - Intronic
1110837207 13:80096840-80096862 ATTATGTAAAATAACCTCCATGG - Intergenic
1111211129 13:85081939-85081961 CTTATATTAACTAACTTCAGAGG - Intergenic
1112064334 13:95776487-95776509 CCTATTTAAAAGAATTTCATTGG - Intronic
1112096580 13:96138755-96138777 CTTTTGAAAAATAATTACATGGG + Intronic
1112296811 13:98195089-98195111 ATTATGTAAAATCACTTTGTGGG + Intronic
1112912641 13:104507363-104507385 CTTTTTTAAAATAGATTCATCGG + Intergenic
1114397574 14:22380719-22380741 CTCATGTAAAATTAGCTCATTGG - Intergenic
1116087488 14:40258975-40258997 CTTATATAAAATTCCTTTATAGG - Intergenic
1117984296 14:61372560-61372582 CTTATGAGAAAGAACTTTATTGG + Intronic
1118415819 14:65535504-65535526 CTAATGTTAAAGAACTTCTTTGG + Intronic
1120279741 14:82423537-82423559 ATAATGTAAAAAAACTTCTTAGG - Intergenic
1120332647 14:83113460-83113482 ATCATGTTAAATAACTTCAAAGG + Intergenic
1120387342 14:83863088-83863110 ACTATGTTAAATAATTTCATAGG + Intergenic
1120731762 14:88011202-88011224 CTTAGGAAAAAAAACTTCAAAGG - Exonic
1120737612 14:88071083-88071105 CTTTTGAAGAATAATTTCATGGG - Intergenic
1123773274 15:23550612-23550634 TTTCTGTAAAATAATGTCATTGG + Intergenic
1124154489 15:27213714-27213736 CTTTGGAAATATAACTTCATGGG - Intronic
1125318336 15:38456090-38456112 GTCATGTAAAATAAATTAATGGG + Intronic
1127423422 15:58831829-58831851 ATTATGTGAACTAACTTCAACGG + Exonic
1129944139 15:79524562-79524584 GCTATGCAAAATAACTTCAGGGG + Intergenic
1131210645 15:90492939-90492961 CTTTTGCAAAATATCTTCTTGGG + Intronic
1131545207 15:93310039-93310061 CTTCTGTAAAGTCACTCCATTGG + Intergenic
1133080594 16:3316067-3316089 CTTATCTAAAATAGCTTTACAGG + Intronic
1136751537 16:32640426-32640448 ATTGTGTAAAATAAAATCATGGG + Intergenic
1137069866 16:35894634-35894656 CTTAGGTCAAATAACTTTATTGG + Intergenic
1138123489 16:54419975-54419997 CTTATTTCAATTAACTTAATTGG - Intergenic
1139232578 16:65298754-65298776 CTTTTGAAGAATAATTTCATAGG - Intergenic
1139897042 16:70295897-70295919 CATATGGAAAATAATTTCAGAGG + Intronic
1140128452 16:72137097-72137119 CTTTTTTAAAAAAATTTCATTGG - Intronic
1203053672 16_KI270728v1_random:899681-899703 ATTGTGTAAAATAAAATCATGGG + Intergenic
1143799320 17:9365586-9365608 CTTTTTTAATTTAACTTCATGGG - Intronic
1149380790 17:56091958-56091980 CTTATGGAAACAAACTTAATTGG + Intergenic
1150245980 17:63675648-63675670 TCTGTGTAAAATACCTTCATGGG + Intronic
1153541661 18:6162320-6162342 CTTATCTATGATAACTTTATTGG - Intronic
1154347577 18:13555905-13555927 CTTATTTTTAATAGCTTCATTGG + Intronic
1156274035 18:35564424-35564446 CTTTTTTAAAATAAGTTCACTGG + Intergenic
1156284824 18:35681922-35681944 ATTATGCATAATAACTTCATAGG + Intronic
1156319133 18:36001878-36001900 CTTTTGAAGAATAATTTCATTGG + Intronic
1156598901 18:38580420-38580442 CATGGGTAAAATAACTTCACAGG - Intergenic
1156750132 18:40442945-40442967 TTTTGGTAAAATAATTTCATTGG + Intergenic
1156998942 18:43500819-43500841 ATTATGTAAAATAGCTTCTAAGG + Intergenic
1158029685 18:52948192-52948214 TTTGTGTACAATAGCTTCATAGG + Intronic
1158179167 18:54693859-54693881 TTTATATAAAATAACAACATAGG + Intergenic
1158322548 18:56279476-56279498 CATCTGTAAAATGACTACATTGG - Intergenic
1158364231 18:56713122-56713144 CTAATGAAAAATCTCTTCATCGG + Intronic
1159829086 18:73250734-73250756 CTTTTGAAAGATAATTTCATTGG - Intronic
1161735566 19:5990370-5990392 CTCAAGTAAATTACCTTCATCGG - Intergenic
1164151585 19:22557788-22557810 CTTTTGAAAAATAAATCCATTGG + Intergenic
1166780456 19:45339982-45340004 GTTATATAAAATAACTTTAGGGG + Intronic
1167905277 19:52655367-52655389 TTTATGTAAAACCACTCCATAGG + Intronic
925722271 2:6840839-6840861 CTGATGTAATATAAAATCATTGG + Intronic
926402830 2:12516245-12516267 ATTATGTAAAATATATTCAGTGG + Intergenic
926875269 2:17469465-17469487 TTTCTGTAAAATAATGTCATTGG + Intergenic
927268218 2:21177050-21177072 TTTAGGTAAATTAGCTTCATAGG - Intergenic
927345689 2:22036220-22036242 CTTATGTTAATTTAATTCATAGG - Intergenic
928643814 2:33329548-33329570 CATATGCAAAAAAACTTCAGGGG - Intronic
928929362 2:36608320-36608342 GTTATATAAATTAACTTCACTGG + Intronic
930275646 2:49307961-49307983 GTTATGTAAAATAACTTTACTGG + Intergenic
930846301 2:55908251-55908273 CTTCTGTAAAATAAGATCAAGGG - Intronic
931565165 2:63608546-63608568 CTTATTTAAAATTACTACTTTGG + Intronic
931796793 2:65718685-65718707 ATTATGTAAGATAGCCTCATGGG - Intergenic
932919099 2:75889324-75889346 CTTATATAAAAGCACTTAATAGG - Intergenic
933009807 2:77046164-77046186 TTTATGTGAAAACACTTCATAGG + Intronic
933364674 2:81335706-81335728 CTTTTGTAGAATAATTTCACAGG - Intergenic
933530685 2:83506790-83506812 GTGGTGAAAAATAACTTCATAGG - Intergenic
934123293 2:88861326-88861348 CTAAATCAAAATAACTTCATTGG - Intergenic
934571987 2:95378432-95378454 CTTCTTTAAAATATTTTCATTGG + Intronic
935681275 2:105639453-105639475 CTTTTAAAAAATAACTCCATAGG - Intergenic
936720715 2:115249558-115249580 TTTATCTGAAATAATTTCATTGG + Intronic
937708991 2:124956857-124956879 CATCTGCAAAATAACTTCCTGGG - Intergenic
939133606 2:138267631-138267653 CTTATGTATAATGAAATCATGGG - Intergenic
939546867 2:143565500-143565522 TCTATATAAAATAACTTCATTGG + Intronic
939708613 2:145486529-145486551 CTACTGAAAAATAACTCCATTGG + Intergenic
940155655 2:150653559-150653581 CTTAAGTAATATAACTCCTTGGG + Intergenic
940353547 2:152716227-152716249 CTTATGTGTAATAACATCATTGG + Intronic
941135048 2:161705340-161705362 CATCTGTAAAATAAGTGCATTGG + Intronic
941255511 2:163226213-163226235 ATTATGCAACATAATTTCATGGG + Intergenic
941417245 2:165236086-165236108 CTTATTTAAAATATCTGCATTGG - Intergenic
941714605 2:168750579-168750601 CTTCTATAATATAATTTCATTGG + Intronic
941788990 2:169530024-169530046 CTTATGTAAACTAATTTCATAGG - Intronic
943267267 2:185748810-185748832 CAATTGTAAAATAACTCCATTGG - Intronic
943435716 2:187864334-187864356 CTTATGTCAATTTAATTCATAGG - Intergenic
944514206 2:200495522-200495544 CTTTTGGAAAATAACTTGTTAGG - Intronic
945791924 2:214316056-214316078 CTTCTGTATAACAACTTCTTTGG + Intronic
946039435 2:216771144-216771166 TTTATGTAAAATAAACTAATAGG - Intergenic
1169847101 20:10005804-10005826 CTTAAGTAAACTAATTTCACCGG + Intronic
1170057575 20:12223563-12223585 CCTCTGTAAAATTACTCCATGGG - Intergenic
1170913700 20:20601622-20601644 GTTATCTAAAATAAATTTATAGG - Intronic
1174978460 20:55362423-55362445 GTTATGTAACATATCATCATTGG + Intergenic
1175371079 20:58492608-58492630 CTTTTGTAAGTTAACTTTATAGG + Intronic
1175580133 20:60092222-60092244 CTTATGTATGATATCTACATAGG + Intergenic
1175757786 20:61540489-61540511 CTTCTGTCACATAACTTCAGGGG + Intronic
1176447734 21:6833966-6833988 CATACGTAAAAAAACTTCTTAGG + Intergenic
1176825903 21:13698992-13699014 CATACGTAAAAAAACTTCTTAGG + Intergenic
1177020416 21:15848898-15848920 TTTCTGTAAGATAGCTTCATAGG + Intronic
1177284512 21:19032347-19032369 CTTAGCTAAAATAATTTCCTTGG - Intergenic
1178204315 21:30445257-30445279 TTTATGTAAAATAATTTTACAGG - Intergenic
1178804955 21:35831560-35831582 CCAAAGTCAAATAACTTCATGGG + Intronic
1178854005 21:36236045-36236067 CTTAGATCAAATAACTTCTTTGG - Intronic
1179776505 21:43667061-43667083 CTTTTGTAAGAATACTTCATAGG + Intronic
1182248333 22:28978893-28978915 CCTATGTGATATAACTACATTGG - Intronic
1182734384 22:32520899-32520921 CATTTGTAAAATAAGGTCATTGG + Intronic
1184405026 22:44295949-44295971 CTTAAGGAAAAGAACTGCATGGG + Intronic
949250978 3:1983623-1983645 CTTTTGTAAAATAAGGTCAGAGG - Intergenic
950296127 3:11832918-11832940 CCTATGTAGAACAACTTCCTTGG - Intronic
950856952 3:16114754-16114776 CTAATGAAAAATGACTTCTTTGG - Intergenic
952087643 3:29845771-29845793 CCTTTTTAAAATAAATTCATAGG - Intronic
952441252 3:33331647-33331669 CAAATGTAAAACAACTTTATAGG + Intronic
952472356 3:33668991-33669013 CTTATCAGAATTAACTTCATAGG - Intronic
955629651 3:60959326-60959348 ATTATGGGAAATAACTTCAAAGG - Intronic
956762036 3:72452077-72452099 CTTGTTTATAATACCTTCATTGG - Intergenic
957010625 3:75001755-75001777 CTTTTGTAAAATGATTTCAGTGG + Intergenic
957134284 3:76264940-76264962 TTTATGGAAAAAAACTGCATGGG - Intronic
957397022 3:79654407-79654429 CTTATGTAAAATGACAGCATTGG - Intronic
957759378 3:84535009-84535031 CATATATAAAATAAATTTATTGG + Intergenic
958085951 3:88807243-88807265 CATTTATAAAATAACTTTATTGG + Intergenic
958120643 3:89283559-89283581 CATATGTAAAATGTCATCATTGG - Intronic
958130612 3:89416590-89416612 ATAATTTAAAATAACTGCATTGG - Intronic
959396697 3:105848928-105848950 CTTATGTAGAAACATTTCATGGG + Intronic
959407166 3:105974576-105974598 CTTATGTAAAATCACAACATGGG - Intergenic
959727543 3:109561027-109561049 CCTATGTAACATAACCCCATTGG - Intergenic
960102981 3:113764441-113764463 ATTATGTAAAAAAAATTAATTGG + Intronic
960343418 3:116502879-116502901 CCTATGTAACAAACCTTCATAGG + Intronic
960483358 3:118220718-118220740 TATTTGTAAAATAATTTCATTGG - Intergenic
960512030 3:118561384-118561406 ATTTTGTAAAATAACTTTTTCGG + Intergenic
961912392 3:130332198-130332220 TTTCTGTAAAAAAAATTCATTGG - Intergenic
961913870 3:130349827-130349849 CTTATGTAAAATAAGTCCACAGG + Intronic
962551866 3:136501756-136501778 CGTATGAATAATAACTTAATGGG - Intronic
965050336 3:163638715-163638737 GTTATGCAAAATAAATGCATTGG - Intergenic
965233664 3:166087312-166087334 CTTATAAAAAATAACTACTTAGG - Intergenic
966033744 3:175383720-175383742 CTTAAGTAAAAGAACTTCTCTGG - Intronic
966525622 3:180916048-180916070 GTTATATAAAATAACATTATAGG + Intronic
966544778 3:181133803-181133825 CATCTGTAAAATGAATTCATGGG - Intergenic
966675607 3:182584367-182584389 TTTATATAAAATAACTATATAGG - Intergenic
967183261 3:186924642-186924664 ATTAGTTAAAATAACTTTATGGG + Intergenic
968399268 4:277179-277201 TTTATTTCAAATAACTTTATAGG - Intronic
969960800 4:10943228-10943250 ATGATATAAAATAATTTCATAGG - Intergenic
970130792 4:12868120-12868142 CTTATGTAAAACAAATACACAGG + Intergenic
970746353 4:19301236-19301258 TTTAAGTTAAATAACTTCAGTGG + Intergenic
971897388 4:32615396-32615418 GTTATGCAAAATATCTGCATTGG + Intergenic
971985936 4:33823933-33823955 CATATATAAAATAAATTGATAGG - Intergenic
972037167 4:34539442-34539464 CATAATTCAAATAACTTCATAGG - Intergenic
973118911 4:46493237-46493259 CTAATGTTAAATATCCTCATTGG - Intergenic
974310262 4:60198224-60198246 CTTACATGAAATAAATTCATTGG - Intergenic
974731056 4:65866972-65866994 CTTAAGTAAAATAAATACTTAGG - Intergenic
975611808 4:76211351-76211373 CTTACGTCAAATAACTTACTTGG - Intronic
976016784 4:80564931-80564953 CTTTTGTAAAGTAAATTCCTAGG - Intronic
977859750 4:101942510-101942532 CTTATGGAAAATAAATAAATGGG + Intronic
978051954 4:104211964-104211986 CTTATATAAAATATCTAAATAGG - Intergenic
978451138 4:108835456-108835478 TGTATGTAGAATAACATCATTGG - Intronic
978468684 4:109037523-109037545 CCTATGTAAAAGAAATTGATTGG - Intronic
979801472 4:124914277-124914299 TTTATATAAAATTACTTAATGGG - Intergenic
981036128 4:140170583-140170605 CTTATTTGAAATGACTTCGTGGG + Intergenic
981194464 4:141902680-141902702 GTTATGTAAATAAACTTCACAGG - Intergenic
981775013 4:148356607-148356629 ATTGTGAAAAATAATTTCATAGG - Intronic
983128334 4:163982589-163982611 CATATATCAAATCACTTCATTGG + Intronic
983405160 4:167319329-167319351 CTTATGTGAAATAAATCAATAGG - Intergenic
983780269 4:171661966-171661988 TTCATGTAAATTAAATTCATAGG - Intergenic
983947000 4:173597720-173597742 CATATGTAAAATAAGTTAAAAGG + Intergenic
984273796 4:177582685-177582707 CTTTTGTAAAACAACTTTTTTGG + Intergenic
984315457 4:178124487-178124509 TTTGAGAAAAATAACTTCATCGG + Intergenic
984527001 4:180869457-180869479 CTTATGTTAAATAAATTATTGGG + Intergenic
984656174 4:182321322-182321344 TTCATCTAAAATAACTTCTTGGG + Intronic
985268119 4:188168872-188168894 CTTATGTTTAATAGCTTGATAGG + Intergenic
985968379 5:3354951-3354973 CTTCTGTAAAACAACTTCCTGGG + Intergenic
986851030 5:11814198-11814220 TTTATGTAAAAAATCTACATTGG - Intronic
986867490 5:12007404-12007426 CTTCTGCAAAATGATTTCATGGG - Intergenic
988243482 5:28645446-28645468 CTTTTGAAAGATAATTTCATAGG - Intergenic
988340857 5:29969252-29969274 TTTATGTAAACTCATTTCATGGG - Intergenic
988600225 5:32632733-32632755 CTTAAGTATAATAGCTACATAGG - Intergenic
989498164 5:42133465-42133487 CTTATGTAGAATAACTTTGCTGG - Intergenic
989538818 5:42595222-42595244 CTTATGATAAAAAATTTCATAGG - Intronic
990005368 5:50938901-50938923 CCTCTGTAACATAACCTCATTGG + Intergenic
990171743 5:53058904-53058926 CGTATGTACAAAAACCTCATGGG - Intronic
990463237 5:56048518-56048540 CTGATGTAAAATATATTCTTCGG + Intergenic
992470521 5:77048101-77048123 ACTATGAAAAAGAACTTCATAGG - Intronic
992656342 5:78913582-78913604 CTTTTGTAAAATAAAATGATAGG - Intronic
993776814 5:92010461-92010483 CTTATTTAAAATGTCTTCAAGGG - Intergenic
994253225 5:97561883-97561905 TTTATGTCAAATGATTTCATAGG + Intergenic
994678277 5:102852738-102852760 CTTATGTAAATTATCTTGCTGGG - Intronic
994922719 5:106070281-106070303 TTTATGGAAAACAACTTTATAGG - Intergenic
995156581 5:108921555-108921577 TTTATGTAAAATAATCTCCTAGG + Intronic
995430774 5:112073924-112073946 TTTATATAAAAAAACTTTATTGG + Intergenic
996307836 5:122070325-122070347 CTTATTTTAAAGAACTTCAGGGG - Intronic
996582803 5:125050078-125050100 GACATCTAAAATAACTTCATGGG - Intergenic
996689426 5:126322952-126322974 CTTATGTAAAACAACATCAGTGG + Intergenic
997705230 5:135944235-135944257 CTCATGTAAATTACCTTGATTGG + Intronic
998300634 5:141016126-141016148 CTTATCCAGAATAATTTCATGGG + Intergenic
998540155 5:142973663-142973685 CTTAATTAAAATAAATCCATGGG + Intronic
999744400 5:154580745-154580767 CTTATATAAAATAAACTTATGGG - Intergenic
1001538303 5:172515676-172515698 CTTTTGAAGAATAATTTCATAGG - Intergenic
1004864875 6:19843354-19843376 CTTATTAAAAAAAATTTCATGGG - Intergenic
1005614841 6:27562519-27562541 CTTATGAAAAACAACTTTCTGGG + Intergenic
1007356484 6:41321555-41321577 ATTATAAAAAATAAATTCATGGG - Intergenic
1008124410 6:47652665-47652687 CTTATGTAACATATATTTATTGG + Intergenic
1009234131 6:61102468-61102490 CTTATTTAAAAGACCTTGATGGG - Intergenic
1009388329 6:63113663-63113685 ATTATTAAAAATAAATTCATTGG + Intergenic
1011178960 6:84597150-84597172 CTGATTTAAATTATCTTCATGGG + Intergenic
1011645181 6:89450800-89450822 CTTATTTAAAAATACTTTATTGG - Intronic
1012447169 6:99318602-99318624 TGTATGTAACACAACTTCATTGG - Intronic
1012708664 6:102569050-102569072 CTTAATTAAAATTACTTAATTGG + Intergenic
1013117392 6:107114113-107114135 CTTGTTTAAAATAGCTACATAGG + Exonic
1014398333 6:120954331-120954353 CTTATCTAAGAGAACTTCAAGGG - Intergenic
1014405890 6:121049985-121050007 TTTATGTAGTATAACTTCAGAGG + Intergenic
1014566214 6:122952170-122952192 CTTTTGGAAAAAAATTTCATTGG - Intergenic
1014918748 6:127186865-127186887 CTGATTTAAAATAATTTTATAGG + Intronic
1015253507 6:131152217-131152239 ATTATTTAGAGTAACTTCATTGG - Intronic
1016130921 6:140469370-140469392 CCTAAGTAAAATATCTTGATGGG + Intergenic
1016291858 6:142535979-142536001 CTTATAGAAAATAACCCCATTGG - Intergenic
1017178599 6:151528152-151528174 CTAATCTAAAATTGCTTCATGGG + Intronic
1017240322 6:152161094-152161116 CTTTTATAAAATAACTGAATTGG - Intronic
1017584080 6:155900846-155900868 CTTCTGTAAAATAAGTTATTGGG - Intergenic
1018331309 6:162730209-162730231 TTTATACAAAATAACTTCAGTGG + Intronic
1018342448 6:162866257-162866279 CTCATGTAAAATAATTTTAAAGG + Intronic
1018352846 6:162979863-162979885 CTTAAATAAAATAAATTCACAGG + Intronic
1018649703 6:165983096-165983118 CATGTGTCAAATAACTTCAATGG + Intronic
1018692655 6:166361323-166361345 CTTTGTTACAATAACTTCATGGG - Intergenic
1018776358 6:167020589-167020611 CTTAAGTAAATTAATTTCCTAGG - Intronic
1020874843 7:13679553-13679575 CTTCTGGAAGATAATTTCATAGG - Intergenic
1021353144 7:19620280-19620302 CCTTTGTAAAATAATTACATAGG + Intergenic
1021387711 7:20052011-20052033 CATTTGTAAAATGACTGCATGGG + Intergenic
1022270967 7:28807726-28807748 CTCTTGTAAAACAACTTTATAGG + Intronic
1023730730 7:43189625-43189647 ATTATGAAAAATAAATACATGGG + Intronic
1025005549 7:55351618-55351640 CTTCTGTAACATAATTTTATTGG - Intergenic
1026227486 7:68455360-68455382 CTTATGAAAAAAATCTTCAGTGG + Intergenic
1027443819 7:78248622-78248644 CTTAGATAAAATAGATTCATTGG + Intronic
1028083891 7:86613708-86613730 TTTCTGTAAAAAAAATTCATTGG - Intergenic
1028223257 7:88220404-88220426 CTTATTTTAAACAACTTTATTGG + Intronic
1029260762 7:99301376-99301398 CTTATGTTAGATAACTTCCTGGG + Intergenic
1031737011 7:125377858-125377880 ATTATTTAAAAAAATTTCATGGG - Intergenic
1032273766 7:130436582-130436604 CTCATGTAAAATATAATCATTGG + Intronic
1032727288 7:134602515-134602537 CTTTTTTAAAATAACTTTTTTGG - Intergenic
1034301695 7:150021344-150021366 CTAATTTAAATTAAATTCATAGG - Intergenic
1034752345 7:153582626-153582648 CATATTTAAAATAACTACAATGG + Intergenic
1034804351 7:154075923-154075945 CTAATTTAAATTAAATTCATAGG + Intronic
1036286651 8:7448918-7448940 CTTATGTAAAATTTCTCCAAAGG - Intronic
1036334827 8:7862605-7862627 CTTATGTAAAATTTCTCCAAAGG + Intronic
1037064490 8:14559931-14559953 CTTATGTTACATAACATAATGGG - Intronic
1037074998 8:14703714-14703736 CTTGTGTAAAATGACTTTAGTGG + Intronic
1037243246 8:16802113-16802135 CTTATGTGATTTATCTTCATAGG + Intergenic
1038181573 8:25233652-25233674 ATTATGGAAAATATCTTCAATGG + Intronic
1038654916 8:29441273-29441295 CTTATTTAAAATAAAATTATTGG + Intergenic
1039149462 8:34487572-34487594 TTTATGTAAATTAATTGCATTGG + Intergenic
1040672776 8:49712559-49712581 CATAGGTAAAATAATGTCATAGG - Intergenic
1041202907 8:55468489-55468511 CTTATTTAAAAAAAATACATTGG + Intronic
1043235717 8:77863274-77863296 CTTCTGTAAAAAAATGTCATTGG - Intergenic
1044343317 8:91072219-91072241 ATTATGTATACTTACTTCATAGG - Intronic
1044411618 8:91890272-91890294 CATATGTAAAATAAGATAATTGG + Intergenic
1044541609 8:93414435-93414457 GTTATTTAAAATTACTTCATAGG - Intergenic
1046041624 8:108912827-108912849 CTTGTGTAAAATAACTTTCAAGG + Intergenic
1046354146 8:113056937-113056959 TAAATGTAAAATTACTTCATGGG - Intronic
1047044642 8:121038317-121038339 CTTATGTAAATTAATTTCTAAGG + Intergenic
1048212278 8:132465346-132465368 CTTATTTAAAATAACTCTCTTGG + Intronic
1048554938 8:135466464-135466486 CTTTTGTCAAATAACTTGTTAGG + Intronic
1048598409 8:135891971-135891993 CTTAAGAAAAAGAAGTTCATAGG - Intergenic
1050361251 9:4833132-4833154 CTTTTCTGAAATAATTTCATAGG + Exonic
1051700885 9:19822704-19822726 CTAATGGAAAATAAGTTTATGGG + Intergenic
1052003056 9:23311172-23311194 CTCAAGCTAAATAACTTCATTGG + Intergenic
1052109726 9:24566491-24566513 TTTATATAAAATAGCTTCCTAGG + Intergenic
1052175450 9:25456914-25456936 GTAATGTAAAATGACTACATTGG - Intergenic
1052412664 9:28142432-28142454 CTTTTCTATAAAAACTTCATAGG + Intronic
1052980573 9:34445674-34445696 CTGATGTAGAAGAACTTAATTGG + Intronic
1053624709 9:39856909-39856931 TTTTTGTAAAATAATTTTATAGG + Intergenic
1053880161 9:42586319-42586341 TTTTTGTAAAATAATTTTATAGG - Intergenic
1053892503 9:42707993-42708015 TTTTTGTAAAATAATTTTATAGG + Intergenic
1054219187 9:62393789-62393811 TTTTTGTAAAATAATTTTATAGG - Intergenic
1054231527 9:62515384-62515406 TTTTTGTAAAATAATTTTATAGG + Intergenic
1054956981 9:70922830-70922852 CTTTTGAAAAATAACCTCTTTGG - Intronic
1055216979 9:73876354-73876376 CTCATATAAAAAAACTTGATTGG - Intergenic
1055254685 9:74354835-74354857 CTTATGTAATATCACTCGATTGG + Intergenic
1056334606 9:85554671-85554693 ATTATGTATAAAAACTTCAGAGG - Intronic
1056905249 9:90641874-90641896 AATATGTAAAATAAATTCCTAGG + Intronic
1057983321 9:99683968-99683990 ATTATGTAAAAAAACTTCTATGG - Intergenic
1058227396 9:102382198-102382220 CATAACTAAAATACCTTCATCGG + Intergenic
1059370924 9:113834487-113834509 CCAATTTAAAATAACTCCATAGG + Intergenic
1059494438 9:114697818-114697840 CTTCTGTAAAATAAAGTCTTTGG + Intergenic
1059567225 9:115395004-115395026 CTTATGTCAAATAATATGATGGG - Intronic
1059578431 9:115517331-115517353 CTTATTGAAATTAACATCATGGG - Intergenic
1059812891 9:117876215-117876237 ATTATTTAAAATAATTTCACAGG + Intergenic
1060261800 9:122082164-122082186 CTTCTGTAGAATAAATTCCTAGG - Intronic
1060655581 9:125370577-125370599 CCCATGTAAAATAACTGCATTGG + Intergenic
1203521457 Un_GL000213v1:50565-50587 CATACGTAAAAAAACTTCTTAGG - Intergenic
1186253418 X:7693782-7693804 CTTATCTAAAAGAGCTTCAATGG + Intergenic
1187078421 X:15960014-15960036 CTTAACCAAATTAACTTCATTGG + Intergenic
1188166328 X:26868967-26868989 TTTAAATAAAATAACTTAATTGG - Intergenic
1190489171 X:50964155-50964177 CATATGAAAAAAAACTTCATAGG + Intergenic
1192697740 X:73435915-73435937 CTTTTGAAAGATAATTTCATAGG - Intergenic
1194225473 X:91251103-91251125 ATTAGCTAAAATAACTTCATGGG - Intergenic
1194294964 X:92115986-92116008 CTCATGTAACATAGCTTCAGTGG + Intronic
1194794005 X:98187583-98187605 CCTATGTAACATAAGTTCACAGG - Intergenic
1197060913 X:122180482-122180504 CTTTTGTAAAAGATTTTCATGGG + Intergenic
1197155039 X:123261407-123261429 CTTATGGAAAATACCTTTATAGG - Intronic
1198232852 X:134708941-134708963 GTTATGTAAAATATAATCATGGG + Intronic
1199516754 X:148686269-148686291 CATATGTAAAATAAGATCAATGG - Intronic
1199803357 X:151272965-151272987 CTTGTCTAAAACAACTGCATGGG - Intergenic
1200562012 Y:4716012-4716034 ATTAGCTAAAATAACTTCATGGG - Intergenic
1200612458 Y:5340506-5340528 CTCATGTAACATAGCTTCAGTGG + Intronic
1200882801 Y:8236889-8236911 TTTATTTAAAATATCTTCTTAGG + Intergenic
1201470212 Y:14325109-14325131 CTTATCTAAAAGAGCTTCAATGG + Intergenic