ID: 1093994505

View in Genome Browser
Species Human (GRCh38)
Location 12:25627254-25627276
Sequence CTCTGAAAGGCATCCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093994505 Original CRISPR CTCTGAAAGGCATCCATGGA GGG Intronic
900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG + Intronic
900379148 1:2375294-2375316 CTGGGAAAGGCACCCAGGGAGGG - Intronic
900467065 1:2831030-2831052 CCGAGAAAGGCACCCATGGATGG - Intergenic
901202217 1:7473249-7473271 CTCTGCAGGGCTCCCATGGAGGG - Intronic
902778067 1:18687213-18687235 TTCTCAAAGCCATCCAGGGAGGG + Intronic
903256989 1:22109069-22109091 CTGTGCAAGGCCTCCCTGGAGGG - Intergenic
904622930 1:31786156-31786178 CTCTGAAGGGCATCACAGGAGGG + Intergenic
911150748 1:94595152-94595174 CTCTGAATTGCATTCAGGGAAGG - Intergenic
915100560 1:153495923-153495945 CTCTGAGAGGCCACCAGGGAAGG + Intergenic
915119155 1:153617705-153617727 CACTGGCAGGCATCCATGCAGGG - Intergenic
917427758 1:174933329-174933351 GTCAGAAAGGCATCCATGGAAGG - Intronic
917843628 1:179002634-179002656 CTGTGTAGGGCATCCATGCAGGG + Intergenic
923095348 1:230770993-230771015 ATCTGCAAGTCATCTATGGATGG - Intronic
924030919 1:239884917-239884939 ATCTGTAAGGCATCCATTGGTGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1065563769 10:26989046-26989068 CTCAGAAAGGAAGCCATAGATGG - Intergenic
1065899667 10:30194582-30194604 CCCTCAAAGTCATCCATGAAGGG - Intergenic
1066090120 10:32009307-32009329 CTCTGAATGGCATTGATAGATGG - Exonic
1068461569 10:57336628-57336650 CACTGAAAGGCATGTAAGGACGG + Intergenic
1068735351 10:60408087-60408109 CTCTGGAATAAATCCATGGAAGG + Intronic
1069070451 10:63986391-63986413 CTCTGAAAGGCTTGCAGGGGTGG + Intergenic
1070260998 10:74855673-74855695 CTGGGAAAGGCAGGCATGGAGGG + Intronic
1071273226 10:84028071-84028093 TTTTTAAAGGCATCCAAGGAGGG - Intergenic
1072806551 10:98427213-98427235 ACCTGAAGGGCATCCATGGGGGG + Exonic
1073988622 10:109238597-109238619 CTTTGAAAGGCATTCAGTGAAGG + Intergenic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1077090374 11:775671-775693 CTCTGAGCGGCTTCCCTGGAAGG - Intronic
1079781249 11:24608950-24608972 CTGTGAAAGGCCTCCATCTATGG - Intronic
1081663042 11:44900084-44900106 TTCTAGAAGTCATCCATGGATGG + Intronic
1081736855 11:45410378-45410400 CTCTGAAAGGCAACCCTGGAGGG + Intergenic
1087936393 11:104038215-104038237 CACTGAAAGGCATCCTGGGAAGG + Exonic
1089840130 11:121409708-121409730 CTCTGAAAGAAATTCAGGGAAGG - Intergenic
1089860720 11:121587999-121588021 CTCTGTAAGGGATCCAGAGAAGG - Exonic
1091744069 12:2980018-2980040 CACTGAGAGGCATCCAGTGATGG + Intronic
1092163031 12:6326536-6326558 CTCTGAGAGCCCTCCAGGGAAGG - Exonic
1093994505 12:25627254-25627276 CTCTGAAAGGCATCCATGGAGGG + Intronic
1096749520 12:53749898-53749920 CTCTGAAAGGCAATCCTGAAGGG + Intergenic
1098063573 12:66588226-66588248 CTCTGAAAGGCATAAGTGTATGG + Intronic
1104558394 12:129822507-129822529 CTCTGACAAGCTTCCATGGTAGG - Intronic
1105665761 13:22553785-22553807 GTCGGAAAGGTAACCATGGAAGG + Intergenic
1107155636 13:37164312-37164334 ATCTGAAGGGCAGCTATGGAGGG + Intergenic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1108612824 13:52100922-52100944 CTCTCAAAGGAATCCATGACAGG - Intronic
1110745724 13:79051057-79051079 CTCTGAAATGTAACCATTGAAGG - Intergenic
1111075042 13:83223346-83223368 CTCTTTTAGGCATCCATTGAGGG - Intergenic
1112524655 13:100133186-100133208 CACTGAAAAGGATACATGGATGG - Intronic
1115307461 14:31947159-31947181 CTCTGAGAGGCATGGAAGGAGGG - Intronic
1115641817 14:35340114-35340136 CTCTGAGAGGGACCCCTGGAAGG - Intergenic
1115904534 14:38191448-38191470 ATCAGAAAGGCATCCCTGCAAGG - Intergenic
1122282347 14:100630695-100630717 CTCTGAAAGTCGCCCCTGGAAGG - Intergenic
1124871147 15:33544190-33544212 CTTTGAAAAGCATTCATGAAGGG - Intronic
1127723718 15:61727199-61727221 CTGTGTAAGGCTGCCATGGACGG - Intergenic
1128455941 15:67831490-67831512 CTCTGAAATGCAAGAATGGAAGG - Intronic
1129199278 15:73989151-73989173 CTCTGAAAGGAGTCAATGAAGGG + Exonic
1135354236 16:21756325-21756347 CTCTGTGAGGGCTCCATGGAGGG - Intronic
1135452728 16:22572466-22572488 CTCTGTGAGGGCTCCATGGAGGG - Intergenic
1136518224 16:30780633-30780655 CTCTGCAAGGCCTCCAGGGATGG - Exonic
1136926960 16:34383165-34383187 CACTGAAAGGCAACCTGGGAGGG - Intergenic
1136977614 16:35028642-35028664 CACTGAAAGGCAACCTGGGAGGG + Intergenic
1138673068 16:58630668-58630690 CTCTGGAAGGCGTCTCTGGAAGG - Intergenic
1140107891 16:71977501-71977523 TTTTGAAAGACATCAATGGATGG - Intronic
1147319164 17:39635795-39635817 CTCTGAAAGGCAAGCAGAGAGGG - Exonic
1151891611 17:76954188-76954210 CTTGGAAAGGCCTACATGGATGG - Intergenic
1153951233 18:10059525-10059547 CTCTGAAATTCCACCATGGATGG + Intergenic
1156887841 18:42156292-42156314 CTCTGAAAGGGATATCTGGATGG - Intergenic
1157523218 18:48359729-48359751 CTTGGAAAGGAAGCCATGGATGG + Intronic
1157677995 18:49581635-49581657 CTCTGAAAGGCATGCCTGCCCGG - Exonic
1158272727 18:55734101-55734123 CCCTGAAGGGCATGCATGAAAGG - Intergenic
1159515736 18:69455324-69455346 CACTGAAAGGCATTCTTGCAAGG + Intronic
1162451802 19:10759538-10759560 CTCAGGAAGGTATGCATGGAAGG - Intronic
1164777072 19:30861291-30861313 CTAGGAAAGGCATCCGGGGAAGG + Intergenic
1167983801 19:53298723-53298745 CTCTGAAACTCATCTAGGGAGGG - Intergenic
925196014 2:1926389-1926411 CTCAGAAAAGCATACCTGGAAGG - Intronic
926475648 2:13318612-13318634 CTTTGAAAGGCCACCATGGCAGG - Intergenic
927250927 2:20994271-20994293 GTCTCAGAGGCATCCATGCAAGG + Intergenic
927658143 2:24969387-24969409 CTCTCATAGACATCCAAGGAAGG + Intronic
928029739 2:27768180-27768202 CTCTGAGAGGAATCTGTGGAGGG + Intergenic
929562052 2:42962131-42962153 CCCTCCAGGGCATCCATGGAGGG + Intergenic
929762240 2:44815950-44815972 TACTCAAAGACATCCATGGAAGG - Intergenic
931805699 2:65801887-65801909 CCCTGATATGCCTCCATGGAAGG - Intergenic
932731961 2:74227804-74227826 CCCTGAATGGCATCCAGGTAAGG - Exonic
933970719 2:87467902-87467924 TGCTGAAAAGCATCCGTGGAAGG - Intergenic
934219951 2:90073567-90073589 CTCTGGAAGGCTTTCTTGGATGG + Intergenic
936323009 2:111482280-111482302 TGCTGAAAAGCATCCGTGGAAGG + Intergenic
936956477 2:118027805-118027827 CTATTGAAGGCATCCCTGGATGG + Intergenic
938456837 2:131471836-131471858 TGCTGAAAGGCACCCATGGCAGG + Intronic
944734890 2:202553590-202553612 TTCAGAAAGGCATCCAGGAAAGG + Intronic
948257467 2:236578477-236578499 CTCTGAAAGCCTTCCATGGAGGG - Intronic
948601560 2:239110511-239110533 CTCAGAAAGAAAACCATGGAAGG - Intronic
948880229 2:240853066-240853088 CACTGAAGGGCTTCCATGGTTGG - Intergenic
948899473 2:240949127-240949149 CCCCGAAAGTCAGCCATGGAGGG + Intronic
1169137784 20:3208188-3208210 CCAAGAAAGGCATCCATGTAAGG + Intergenic
1171126531 20:22606776-22606798 CCCTGAAAGGCATCCACGTGTGG + Intergenic
1171752365 20:29064066-29064088 CTCTGCAAGGCAACCTCGGAGGG - Intergenic
1171857809 20:30363322-30363344 CTCTGCAAGGCAACCTGGGAGGG - Intergenic
1172457301 20:35087493-35087515 AACTGAAGGGCATCCAGGGATGG + Intronic
1173614416 20:44393453-44393475 CTCTCACTGGCATCCCTGGAAGG + Intronic
1174638602 20:52023504-52023526 CTCTAAAATGGGTCCATGGACGG + Intergenic
1176028822 20:63000409-63000431 CTCTGAGGGGCATGCATGGAAGG - Intergenic
1179033832 21:37743031-37743053 CTCTGGCAGGCTTCCAGGGAAGG - Intronic
1179715375 21:43283942-43283964 CTCTGAAATGGATGCATGGATGG - Intergenic
1180180597 21:46117180-46117202 CTCTGGGAGGCAGCCAGGGATGG + Intronic
1180390604 22:12278643-12278665 CTCTGCAAGGCAACCTGGGAGGG + Intergenic
1180409139 22:12586114-12586136 CTCTGCAAGGCAACCTGGGAGGG - Intergenic
1184618004 22:45651215-45651237 CTTTCAAAGCCATCCCTGGATGG + Intergenic
1184996721 22:48212483-48212505 CACTAAAAAACATCCATGGAAGG + Intergenic
951454054 3:22870931-22870953 TTCTGAAAGGCTTTGATGGAAGG - Intergenic
954727350 3:52624545-52624567 CTGTAAAAGGCATCCCTGAAAGG + Intronic
955981721 3:64533887-64533909 TTCTGAAAGGCACCCTCGGAGGG - Intronic
958913619 3:100023343-100023365 GTCTGAAAGTCAAACATGGATGG + Intronic
959694207 3:109232054-109232076 CATTCAAAGCCATCCATGGATGG + Intergenic
960382424 3:116980316-116980338 CTCTGAACTGCATCCAAGCAGGG - Intronic
960446382 3:117753951-117753973 GACTGAAAGGCATCCCTGCAGGG - Intergenic
962409533 3:135129106-135129128 CTCTGAAAAGCACACATGAATGG + Intronic
962597390 3:136960440-136960462 CTATGAAAGACAGCCATGGCCGG - Intronic
964925235 3:161948311-161948333 CTAAGAAAGGCATCCTTTGAAGG + Intergenic
965572978 3:170190056-170190078 GTGTGAAAGGCATCCCTGGCTGG - Intergenic
967604776 3:191432488-191432510 CTCTGCAAGGCATACACAGAGGG - Intergenic
967857218 3:194127363-194127385 CTCTGATGGGCATCCCAGGAAGG - Intergenic
969211191 4:5688604-5688626 CTCTGAAAGCCAACCAGTGAGGG + Intronic
975267607 4:72389180-72389202 CTCGGAAAGGCCTCCTTGCAAGG - Intronic
976311882 4:83621139-83621161 GTAAGAAAGGCATTCATGGAAGG - Intergenic
977029669 4:91865629-91865651 AGCTGAAAGCCATCCAGGGAAGG - Intergenic
977229409 4:94434082-94434104 CTCTGATTGGCATCCATCAACGG - Intergenic
977295735 4:95206773-95206795 GTCTGAGAGTCATCCATGGGTGG + Exonic
978200809 4:106021976-106021998 CTCTGCACAGCATCCATAGATGG - Intergenic
978890987 4:113827308-113827330 CTCTGAAAGGCATTGAGGGATGG - Intergenic
981659553 4:147149309-147149331 CTGGGAAAGGCATCCCTGCAGGG - Intergenic
986239043 5:5940540-5940562 CCCTGCAAGGAAACCATGGAAGG - Intergenic
986848770 5:11785864-11785886 GTCTGGAAGCCAGCCATGGAGGG + Intronic
987089761 5:14500356-14500378 CTCTGCAAGGCAGCCAGGGCTGG - Intronic
988543380 5:32133674-32133696 CACTGACAGGCATACATGGGAGG + Intronic
989570801 5:42944350-42944372 CTCTGAAAGGTCTCCTCGGACGG - Intergenic
989581152 5:43034324-43034346 CTCTGAAAGGTCTCCTCGGACGG - Intergenic
990771586 5:59252451-59252473 ATTTACAAGGCATCCATGGAGGG - Intronic
993845153 5:92932618-92932640 CACTGACAGACAGCCATGGAAGG - Intergenic
996023401 5:118616608-118616630 GTCTGATAGGCATCCAAGGTTGG - Intergenic
996078532 5:119227555-119227577 TTCTGTAAGGCAACCATGTAAGG + Intronic
997308656 5:132860773-132860795 TTATGAAAGGCAGCCAGGGAAGG - Intergenic
998060799 5:139117389-139117411 CTCTGCCAGGCATCCTTTGAGGG - Intronic
998536085 5:142932093-142932115 CTCTGGATGGAAGCCATGGATGG + Exonic
999835040 5:155360779-155360801 TACTAAAAGTCATCCATGGAGGG + Intergenic
1000387225 5:160686205-160686227 CTGTGGAAGACTTCCATGGAGGG + Exonic
1003095079 6:3136148-3136170 CTCTGAAAGGCCTTCTTGCAGGG - Intronic
1003157755 6:3610548-3610570 CTCTGCAAGGCCTCCATGGTAGG - Intergenic
1004981216 6:21027022-21027044 TTATGAAAGGCATCCCTAGAAGG - Intronic
1011226718 6:85115994-85116016 CACTGAAAGGCATCCAATCAGGG - Intergenic
1011802930 6:91038407-91038429 TTCTGAAAGTTATCCTTGGATGG - Intergenic
1017460254 6:154642836-154642858 CTTTGATAGGCCTGCATGGAAGG + Intergenic
1020062093 7:5160338-5160360 CTCTGAAATCCATCCGTGGAGGG + Intergenic
1020166051 7:5808339-5808361 CTCTGAAATCCATCCGTGGAGGG - Intergenic
1020715117 7:11664812-11664834 CTCTCAAGGTTATCCATGGATGG - Intronic
1021197969 7:17693507-17693529 ATCTAAATGTCATCCATGGATGG - Intergenic
1026531352 7:71200116-71200138 CTATGAAAAGCTTCCTTGGAAGG - Intronic
1030063154 7:105639119-105639141 CCCTGAAAGGCAGCCCTGGAGGG - Intronic
1031448669 7:121886795-121886817 TTCTCAAAGGTTTCCATGGATGG - Intronic
1031595765 7:123647863-123647885 ATAAGAAAGGCATCCATGAAAGG + Intergenic
1032806120 7:135356118-135356140 CCATGAAAGGAAGCCATGGAAGG + Intergenic
1034895714 7:154875253-154875275 GGCTGAAAGGCATCCATGGTGGG - Intronic
1035139483 7:156743797-156743819 CTCAGAAAAGCATCCCTGTAGGG - Intronic
1037934610 8:22907017-22907039 ATCTGGAAGGCCTCCTTGGAAGG + Intronic
1038991048 8:32868755-32868777 CTGTAAAAGACAACCATGGAAGG + Intergenic
1039294128 8:36130767-36130789 CTCTGAAAGGAATAAATGAATGG - Intergenic
1039855432 8:41408120-41408142 TTCTGAAATGCATCAAGGGAGGG - Intergenic
1043339310 8:79218424-79218446 CCCTGCAAGGCAACCATGGCAGG - Intergenic
1044452032 8:92347754-92347776 CTCTGAAAAGCACCCGTGGTTGG + Intergenic
1047624805 8:126645798-126645820 CTCCTAAAGAAATCCATGGAAGG + Intergenic
1048288757 8:133163724-133163746 CTTGAAGAGGCATCCATGGAGGG + Intergenic
1050745843 9:8875044-8875066 CTCTTTAATGCATCCATGTATGG - Intronic
1051091967 9:13420445-13420467 ATCTGAAAGTCTGCCATGGAGGG - Intergenic
1051366854 9:16327433-16327455 CTGGGGAAGGCTTCCATGGAGGG - Intergenic
1053538414 9:38948696-38948718 CTGTGATAGGCACCTATGGATGG + Intergenic
1053723911 9:40976832-40976854 CTCTGCAAGGCAACCTGGGAGGG - Intergenic
1054342053 9:63875167-63875189 CTCTGCAAGGCAACCTGGGAGGG + Intergenic
1054627724 9:67415223-67415245 CTGTGATAGGCACCTATGGATGG - Intergenic
1055059729 9:72056132-72056154 GTCTAAAAGACATCCATGGAAGG + Exonic
1055059782 9:72056842-72056864 GTCTAAAAGACATCCATGGAAGG + Exonic
1057501917 9:95602914-95602936 ATCTGAAATGGATCAATGGATGG + Intergenic
1058560638 9:106225439-106225461 TGCAGATAGGCATCCATGGAAGG + Intergenic
1061152198 9:128835289-128835311 CTCTGCCAGGCAGCCATGTATGG - Intronic
1061265257 9:129501015-129501037 CTCTGACCGGCAGACATGGATGG + Intergenic
1061960189 9:133983887-133983909 ATCTGAAAAGCCTCCTTGGAGGG - Intronic
1203451254 Un_GL000219v1:119165-119187 CTCTGCAAGGCAACCTGGGAGGG + Intergenic
1186320357 X:8417579-8417601 CTGTGGAAAGAATCCATGGAGGG + Intergenic
1187304400 X:18082431-18082453 ATCTGAAAGTCAGCAATGGAAGG - Intergenic
1190630373 X:52380363-52380385 CTCTGCAAGGGATCCTGGGACGG + Intergenic
1194610382 X:96035876-96035898 CAAAGAAAGGCAACCATGGAGGG + Intergenic
1196153109 X:112396170-112396192 CGCTGACATGCACCCATGGACGG - Intergenic
1198068145 X:133120340-133120362 CTCAGAAAGGCAACCATGTGAGG - Intergenic
1198522085 X:137463261-137463283 CTCTGAAAGTCAAGCTTGGAAGG - Intergenic
1198816918 X:140601087-140601109 CTCTGCATGGCATCCATGTTTGG + Intergenic
1202143353 Y:21752114-21752136 CTCTGAAAGTCATACACTGAGGG - Intergenic