ID: 1093994904

View in Genome Browser
Species Human (GRCh38)
Location 12:25630888-25630910
Sequence TCTTATCTTTCGCAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 29, 3: 127, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093994900_1093994904 15 Left 1093994900 12:25630850-25630872 CCATTGAGTAGACATCACAGGCA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1093994904 12:25630888-25630910 TCTTATCTTTCGCAGCTGGGAGG 0: 1
1: 0
2: 29
3: 127
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093994904 Original CRISPR TCTTATCTTTCGCAGCTGGG AGG Intronic
900524337 1:3121184-3121206 GCTGATCTTACGCAGCTCGGGGG - Intronic
902816802 1:18921114-18921136 TCTTGGCTTTTGCAGGTGGGAGG - Exonic
906054016 1:42900201-42900223 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
907349092 1:53811338-53811360 TCTTTTCTCTCCCAGCTGGGAGG + Intronic
907663567 1:56415319-56415341 TCTGATCCTTGGCAGCTGAGTGG - Intergenic
908054564 1:60269532-60269554 TCTGATATTTAGTAGCTGGGGGG - Intergenic
910077553 1:83298755-83298777 CCTTTTCTTTCACAACTGGGAGG + Intergenic
910739042 1:90494945-90494967 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
911159292 1:94668373-94668395 TCTTCTTTTTTGCAGCTGTGAGG + Intergenic
911678944 1:100691970-100691992 CATTTTCTTTAGCAGCTGGGAGG - Intergenic
913339787 1:117747273-117747295 TATTTGCTTTCACAGCTGGGAGG - Intergenic
914455597 1:147833573-147833595 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
914927116 1:151898154-151898176 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
916116951 1:161493440-161493462 TCTTATCATTTGCAGCTTGGTGG + Intergenic
917057933 1:171004166-171004188 CTTTTTCTTTTGCAGCTGGGAGG - Intronic
917318939 1:173758940-173758962 CCTTTTCTCTTGCAGCTGGGAGG + Intronic
917898541 1:179517375-179517397 TCTTTTCTTTTGCAGCTGGGAGG - Intronic
918158307 1:181872476-181872498 CCTTTTCTTTTGCAGCTGAGAGG + Intergenic
918256339 1:182752094-182752116 TCTTATGTTTCTCAGCTGTGGGG - Intergenic
918872781 1:189997943-189997965 TCATATCTTTCGCAGCAGTATGG + Intergenic
920512023 1:206558529-206558551 TGTTATATTTCGCAGGTGTGTGG + Intronic
921409858 1:214823807-214823829 CCTTTTTTTTCACAGCTGGGAGG - Intergenic
921455638 1:215367582-215367604 TCTAATCTATCACAGTTGGGTGG - Intergenic
922673449 1:227532635-227532657 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
923154527 1:231266353-231266375 TTCGATCTTTGGCAGCTGGGAGG + Exonic
923648167 1:235845553-235845575 CCTTTTCTTTCGTAGCTGAGAGG + Intronic
923874636 1:238034476-238034498 CCTTTCCTTTTGCAGCTGGGAGG + Intergenic
1064908186 10:20370449-20370471 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1065471031 10:26081489-26081511 ACTTTTCTTTTGCAGCTGGGAGG - Intronic
1068096669 10:52499707-52499729 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1068480733 10:57585497-57585519 CCATTTCTTTCACAGCTGGGAGG + Intergenic
1071777326 10:88803919-88803941 TCTCCTCTTTCTCACCTGGGAGG - Intronic
1074465969 10:113680936-113680958 TCTTGCCTCTAGCAGCTGGGAGG - Intronic
1074985858 10:118658952-118658974 CCTTTTCTTTCGCAGCTGGGAGG - Intergenic
1075946762 10:126440120-126440142 CCTTTTCTTTCACAGCTGGGCGG + Intronic
1076706088 10:132302395-132302417 TCTTCTCCTTCCCAGCTGTGAGG - Intronic
1078041935 11:7873669-7873691 TTTTATCTTTTATAGCTGGGAGG - Intergenic
1078288539 11:9983135-9983157 ACTTTTCTTTCACAGCTGGGAGG + Intronic
1078302742 11:10149546-10149568 TCTTACCTTTGGCAACTTGGAGG - Intronic
1079291339 11:19190944-19190966 TCTTGTCTTTCCCAGGTAGGAGG - Intronic
1079952207 11:26819442-26819464 TAATTTCTTTTGCAGCTGGGAGG - Intergenic
1080153086 11:29076510-29076532 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1080324082 11:31050069-31050091 CCTTTTCTGTCACAGCTGGGAGG + Intronic
1080672598 11:34395008-34395030 CCTTTCCTTTCACAGCTGGGAGG - Intergenic
1082903854 11:58285163-58285185 TATTTGCTTTCACAGCTGGGAGG + Intergenic
1083072805 11:60003754-60003776 TCTTTTCTTTCACAGCTGGGAGG + Intergenic
1083274979 11:61591716-61591738 TCTGATTTTTCCCAGATGGGAGG - Intergenic
1083528581 11:63396129-63396151 CCTTTTCTCTTGCAGCTGGGAGG - Intronic
1084270926 11:68028770-68028792 TCCTATCTTTCTCAGTGGGGTGG + Exonic
1086582059 11:88410766-88410788 TCTTCTATTTGGCACCTGGGAGG - Intergenic
1086825477 11:91490118-91490140 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1087619437 11:100525389-100525411 CCTTTTCTTTCACAACTGGGAGG + Intergenic
1088206367 11:107397231-107397253 CCTTTTCTCTCGCAGCTGGAAGG + Intronic
1090752987 11:129763721-129763743 TCACAGCTTTCACAGCTGGGAGG + Intergenic
1090757269 11:129803564-129803586 CATTTTCTTTCACAGCTGGGAGG + Intergenic
1091194169 11:133717837-133717859 ATTTATCTTTCACAGCCGGGAGG + Intergenic
1091210571 11:133854732-133854754 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1092360347 12:7831393-7831415 TCATCTCTTGCACAGCTGGGTGG + Intronic
1092373000 12:7932775-7932797 TCATCTCTTGCACAGCTGGGTGG + Intronic
1093389544 12:18602103-18602125 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1093488791 12:19681595-19681617 CCTTTCCTTTCACAGCTGGGAGG - Intronic
1093994904 12:25630888-25630910 TCTTATCTTTCGCAGCTGGGAGG + Intronic
1094362060 12:29640836-29640858 CCTTTTCTTATGCAGCTGGGAGG + Intronic
1094501306 12:31023333-31023355 CCTTTTCTTTGGCAGCTGGGAGG + Intergenic
1094722321 12:33077113-33077135 TACTTGCTTTCGCAGCTGGGGGG - Intergenic
1095248227 12:39946785-39946807 CCTTTTCTTTCACAACTGGGAGG - Intronic
1095665132 12:44788726-44788748 TCTGTTCTTTTGCAGCTGGGAGG + Intronic
1095732642 12:45522171-45522193 CCTTTTCTTTCGCAGCTGGGAGG + Intergenic
1095892727 12:47249837-47249859 CCTTTTCTTTCACAGCTGTGAGG + Intergenic
1095932032 12:47636904-47636926 CCTGTTCTTTTGCAGCTGGGAGG + Intergenic
1097067148 12:56328980-56329002 TCTTATGTTTCACATCTGGGAGG + Intronic
1097295432 12:57957949-57957971 TCTTTTCTTTCACAGCTGGGAGG + Intergenic
1097386031 12:58950685-58950707 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1097760493 12:63459243-63459265 CCTTTTCTTTTGCAGCTGGGTGG + Intergenic
1098960970 12:76739413-76739435 CCTTTTGTTTCACAGCTGGGAGG - Intergenic
1099393002 12:82103019-82103041 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1099473076 12:83074789-83074811 CCTTTTCCTTCACAGCTGGGAGG - Intronic
1100088181 12:90936865-90936887 CCTTTTCTTTCACAGCTGGGAGG - Intronic
1100291046 12:93215165-93215187 TTTTTTCTCTTGCAGCTGGGAGG - Intergenic
1101635325 12:106535693-106535715 CCCTTTCTTTCACAGCTGGGAGG - Intronic
1102027691 12:109722972-109722994 ACTTTTCTTTCCCAGCTTGGAGG + Intronic
1102916796 12:116760273-116760295 CCTCTTCTTTGGCAGCTGGGAGG - Intronic
1103423599 12:120811454-120811476 TTTTAGCTTTGGCAGCTGAGGGG - Intronic
1103761164 12:123251263-123251285 CCTTTTCTTTCGCTGCTGGGAGG - Intronic
1104270135 12:127276052-127276074 TCTTATCTATGGCTGGTGGGTGG - Intergenic
1105908200 13:24834890-24834912 CCTTTTCTTTCCCAGCTGGGAGG + Intronic
1105930714 13:25049215-25049237 CCTTTTCTTTCGCAGCTGGGAGG + Intergenic
1107666282 13:42694087-42694109 CCTTTTCTTTTGCAGCTGGTAGG - Intergenic
1108469834 13:50756641-50756663 TGTGTTCTTTCACAGCTGGGAGG - Intronic
1108605932 13:52038607-52038629 TTTTATTTTTAGCAGCTAGGAGG + Intronic
1108817051 13:54305121-54305143 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1108825491 13:54407977-54407999 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1109047984 13:57437905-57437927 CCTTTTCTTTCGCAGCTGGGAGG - Intergenic
1109581427 13:64342605-64342627 TCTTATCTTTCGCATTTCTGTGG + Intergenic
1110661254 13:78061222-78061244 CTTTCTCTTTCACAGCTGGGAGG - Intergenic
1110852676 13:80262922-80262944 TGGTTTCTTTCACAGCTGGGAGG - Intergenic
1110881496 13:80577864-80577886 CCTTTTCTTTCACAGCTGGAAGG + Intergenic
1111165809 13:84455777-84455799 CCTTTACTTTCGCAGCTGGAAGG - Intergenic
1111748562 13:92298247-92298269 TATTTACTTTCGCAGCTGGGAGG - Intronic
1112738040 13:102443205-102443227 CCTTTTCTTTCGCAGCTGGAAGG + Intergenic
1113329903 13:109317675-109317697 CCTTTTCTTTTGCTGCTGGGCGG + Intergenic
1114440963 14:22747352-22747374 TCATGACTTTCGCAGCGGGGAGG - Intergenic
1115265116 14:31492838-31492860 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1115680271 14:35730450-35730472 CCATTTCTTTCACAGCTGGGAGG + Intronic
1116049079 14:39781444-39781466 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1117510838 14:56449062-56449084 ACTTTTCTCTCACAGCTGGGAGG - Intergenic
1118162267 14:63302138-63302160 CCTTTTCTTTGGAAGCTGGGAGG + Intergenic
1121516656 14:94556654-94556676 CCTATTCTTTCGCAGTTGGGAGG - Intergenic
1124380677 15:29162374-29162396 CCCTTTCTTTTGCAGCTGGGAGG + Intronic
1124667860 15:31609286-31609308 CCTTTTCTTTTGCATCTGGGAGG + Intronic
1125008019 15:34839662-34839684 TCATTTCTTTTGCAGCTGGTAGG + Intergenic
1126426599 15:48534049-48534071 TCTTATGCTTTGCAGTTGGGGGG - Intronic
1126460847 15:48913526-48913548 CCTTTACTTTTGCAGCTGGGAGG - Intronic
1128612455 15:69084886-69084908 AATTAACTCTCGCAGCTGGGTGG - Intergenic
1129097642 15:73225715-73225737 CCTTTTCTTTCACAGCTGGGAGG - Intronic
1129562805 15:76589609-76589631 TCCTTGCTTTCTCAGCTGGGAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132210339 15:100017290-100017312 CCTTTTCTTTCACAGCTGGGAGG - Intronic
1135901533 16:26464620-26464642 CCTTTTATTTCACAGCTGGGAGG + Intergenic
1138880965 16:61014620-61014642 TATTTGCTTTCACAGCTGGGAGG + Intergenic
1140253829 16:73318017-73318039 TCTTATCCTCTGTAGCTGGGAGG - Intergenic
1141788134 16:86215309-86215331 CCTTGTCTCTCACAGCTGGGTGG + Intergenic
1142500871 17:332239-332261 TCTTACCTGTCCCAGCTGGTAGG - Intronic
1142841097 17:2631295-2631317 CCTTTTCTTTCACCGCTGGGAGG - Intronic
1143427856 17:6854199-6854221 CCTTTTCTTTCACAGGTGGGAGG + Intergenic
1144139732 17:12336814-12336836 CCTTTTCTTTTGCAGCTTGGAGG - Intergenic
1146583345 17:34059557-34059579 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1147974739 17:44240280-44240302 TCTAATCTCTCCCAGCTGAGTGG - Intergenic
1152193980 17:78905372-78905394 TCCCATCTTACGCAGCTGGATGG + Intronic
1153065399 18:1039572-1039594 TATTTGCTTTCACAGCTGGGAGG + Intergenic
1153069531 18:1089481-1089503 CCTTTTCTTTGGCAGCTGAGAGG - Intergenic
1153400431 18:4678822-4678844 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1154094041 18:11393642-11393664 CCTTTTCTCTCACAGCTGGGAGG + Intergenic
1155098595 18:22585356-22585378 TCTCATCATTTGCAGTTGGGAGG + Intergenic
1156011432 18:32501613-32501635 ACTTTTCTTTTGCAGCTGGGAGG - Intergenic
1157861139 18:51141491-51141513 TCTTAATTTTAGCTGCTGGGTGG + Intergenic
1158002568 18:52636399-52636421 CCTTTACTTTAGCAGCTGGGAGG + Intronic
1158331564 18:56368291-56368313 CTTTTTCTTTCGCAGTTGGGAGG - Intergenic
1158829709 18:61263882-61263904 CCTTTTATTTTGCAGCTGGGAGG + Intergenic
1160292433 18:77607011-77607033 TCTCATCCTTCCCATCTGGGTGG + Intergenic
1160507432 18:79434987-79435009 TCTGACCTTTCCCACCTGGGAGG - Intronic
1160602462 18:80024143-80024165 TCCAATGTTTCTCAGCTGGGGGG + Intronic
1163546321 19:17943253-17943275 TCTTGGCTTTCTCGGCTGGGCGG - Exonic
1164237794 19:23352107-23352129 CCTGTTCTTTCCCAGCTGGGAGG + Intronic
1166604310 19:44126964-44126986 CCTTTTCTTTTGCAGCTGAGAGG - Intronic
1167707601 19:51090768-51090790 TCCTATCTTTGGAAGCTGGGGGG + Intergenic
926872796 2:17441474-17441496 CCTTGTCTTTCGCAGCTGGGAGG - Intergenic
926916056 2:17893343-17893365 CCCTTTCTTTCTCAGCTGGGAGG - Intronic
928733690 2:34261453-34261475 CCTTTTCTTTCCCAGCTGGGAGG + Intergenic
928772589 2:34719900-34719922 CCTTTTCTTTCGCAGCTGGGAGG - Intergenic
929805965 2:45145258-45145280 CCTTCTCTTTTGCAGCTGGGAGG + Intergenic
930293765 2:49528806-49528828 TCTTCTCTTTTCCAGCTGAGAGG - Intergenic
930486551 2:52018064-52018086 CCTTTTCTTTCACAGCTGAGAGG - Intergenic
931054451 2:58453421-58453443 TCTTATCTTTTGGATCTGGCAGG - Intergenic
931525270 2:63145682-63145704 CCTTTTCTTTTGCAGCTGGGAGG - Intronic
931547826 2:63408616-63408638 CCTTTTCTTTCACAGCTAGGAGG + Intronic
931992966 2:67809531-67809553 CCTTTTCTCTGGCAGCTGGGAGG + Intergenic
933121311 2:78541787-78541809 CCTTTTGTTTAGCAGCTGGGAGG + Intergenic
934739226 2:96707145-96707167 TCTTGTCTCTAGCAGCTGGTTGG - Exonic
936673921 2:114692110-114692132 TCTTGTCTTTTCCAGCTGTGGGG + Intronic
937057804 2:118954132-118954154 CCTTGTCTTTGGCAGCTGGGAGG + Intronic
937069309 2:119050558-119050580 TCTTTTCTTTCACAGCTGGGAGG - Intergenic
937275858 2:120683721-120683743 TCACATCTCTGGCAGCTGGGAGG - Intergenic
937521737 2:122720698-122720720 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
938216689 2:129523528-129523550 TGTTTGCTTTCTCAGCTGGGAGG - Intergenic
938598318 2:132811695-132811717 TTTTTTCTTTCTCAGCTGGGTGG - Intronic
939043305 2:137218809-137218831 TCTTATTTTTTACAGCTGGTTGG + Intronic
939769526 2:146298599-146298621 CCTTTTCTCTCACAGCTGGGAGG + Intergenic
940172418 2:150843308-150843330 CCTTTTCTTACGCAGCTGGGAGG - Intergenic
940431302 2:153593140-153593162 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
940618729 2:156084056-156084078 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
940709435 2:157144243-157144265 CCTTTTCTTTCGCAGCTGGCAGG - Intergenic
943621199 2:190150142-190150164 TCTTTTCTTTTGCAGCTGGGAGG - Intronic
943891298 2:193290176-193290198 CCTTTTATTTAGCAGCTGGGAGG - Intergenic
943909281 2:193542452-193542474 TCCTTACTTTTGCAGCTGGGAGG + Intergenic
944874094 2:203944067-203944089 CCTTTTCTTTCACAGCTGGGAGG - Intronic
945075273 2:206032251-206032273 CCCTCTCTTTTGCAGCTGGGAGG + Intronic
945482629 2:210361093-210361115 CCTTTTCTTTCACAGCTGGAAGG - Intergenic
945825590 2:214716903-214716925 CCTTTTCTTTCCCAGCTGGGAGG + Intergenic
1169336248 20:4759743-4759765 CCTTTTCTCTCCCAGCTGGGAGG - Intergenic
1169401279 20:5282705-5282727 TCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1170245819 20:14220456-14220478 TCTTATCTTTCAAAGCTAGGAGG - Intronic
1170375872 20:15699675-15699697 CCCTTTCTTTCGCAGCTGGGAGG - Intronic
1170721071 20:18879558-18879580 CATTTTCTTTCCCAGCTGGGAGG - Intergenic
1170863206 20:20128108-20128130 CCTTTTCTTTCTCAGCTGGGAGG - Intronic
1172996952 20:39077975-39077997 TGTTCTCTTTGGCTGCTGGGGGG - Intergenic
1174369440 20:50076704-50076726 TCTGATGTTATGCAGCTGGGTGG - Intergenic
1175069013 20:56316259-56316281 CCTTCTCTTTCGCAGCTGGGAGG + Intergenic
1177195637 21:17901116-17901138 CCTTTTCGTTCCCAGCTGGGAGG - Intergenic
1177847369 21:26306196-26306218 TCCTTTCTTTCATAGCTGGGAGG + Intergenic
1178801628 21:35801134-35801156 CCTTTTCTTTCACAGCTGGGAGG + Intronic
1178958987 21:37047085-37047107 CCTTTTCTTTCGCAGCTGGGAGG + Intergenic
1179939462 21:44628467-44628489 TCTTTACTTCCCCAGCTGGGGGG + Intronic
1180100646 21:45582500-45582522 TCTTATCTTTCCAAGTTTGGTGG - Intergenic
1183048496 22:35241349-35241371 CCTTTTCTTTCCCAGCTGGGAGG - Intergenic
949604092 3:5634619-5634641 CCTTTTCTCTCACAGCTGGGAGG - Intergenic
949814198 3:8040839-8040861 CCTTTTCTTTCACAGCTGAGAGG + Intergenic
950538298 3:13594583-13594605 TCTTGGTTTTCCCAGCTGGGTGG + Intronic
950603598 3:14058048-14058070 TCTTTTCTTTCCCAGCTGGGAGG - Intronic
951183744 3:19688520-19688542 TATTTGCTTTCACAGCTGGGAGG + Intergenic
952097239 3:29968268-29968290 CCTTTTCCTTTGCAGCTGGGAGG - Intronic
953185250 3:40631540-40631562 TGTTTGCTTTCTCAGCTGGGAGG + Intergenic
953723999 3:45381817-45381839 CCTTTTCCTTCGCAGCTGGGAGG - Intergenic
955416272 3:58694986-58695008 TTTTTTCTTTTGCAGCTGTGAGG + Intergenic
955461669 3:59189930-59189952 CTTTTTCTTTTGCAGCTGGGAGG - Intergenic
956950219 3:74273875-74273897 CCTTTTCTTTCCCAGCTGGGAGG + Intronic
957016442 3:75069727-75069749 CCCTTTCTTTCACAGCTGGGAGG - Intergenic
957427858 3:80063681-80063703 CCTTCTCTTTGGCAGCTGAGAGG + Intergenic
958480830 3:94643675-94643697 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
958647158 3:96888017-96888039 CCTTTTCTTTCACAGCTGGGAGG - Intronic
958969992 3:100600894-100600916 CCTTTTCTTTCCAAGCTGGGAGG - Intergenic
959262457 3:104098986-104099008 TGTGATCTTTGTCAGCTGGGAGG - Intergenic
959275274 3:104269903-104269925 CCTTTTCTTTCGCAGCTGGGAGG - Intergenic
959757017 3:109911094-109911116 CCTTTTCTTTCACAGCTTGGAGG - Intergenic
959997220 3:112693193-112693215 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
964188945 3:153980144-153980166 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
964643774 3:158936702-158936724 CCTTTTCTTTCGCAGCTGGAAGG + Intergenic
965216926 3:165875118-165875140 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
965874429 3:173299710-173299732 TATTTGCTTTTGCAGCTGGGAGG - Intergenic
966421305 3:179737126-179737148 TCTTCTCTTTAGCAGCTAGTAGG + Intronic
967257563 3:187609258-187609280 CCTGTTCTTTCGAAGCTGGGAGG - Intergenic
967399892 3:189049209-189049231 CCTTTTCTCTTGCAGCTGGGAGG + Intronic
968024232 3:195425750-195425772 TTTTGGCTTTAGCAGCTGGGTGG - Intronic
970549357 4:17163829-17163851 TACTTGCTTTCGCAGCTGGGAGG - Intergenic
971183175 4:24349726-24349748 CCTTTTCTCTCGCAGTTGGGAGG - Intergenic
972189113 4:36568866-36568888 CCTTTCCTTTCACAGCTGGGAGG - Intergenic
973298323 4:48551980-48552002 TCTTGCCTCTTGCAGCTGGGTGG + Intronic
973782354 4:54300499-54300521 CCTTTTCTCTCCCAGCTGGGAGG + Intergenic
974165038 4:58190973-58190995 TGTTTGCTTTCTCAGCTGGGAGG + Intergenic
974474493 4:62361821-62361843 CCTGGTCTTTTGCAGCTGGGAGG - Intergenic
975033766 4:69656942-69656964 CCTTTTCTTTGGCAGCCGGGAGG + Intergenic
975243836 4:72094739-72094761 CCTTTTCTTTCTCAGCTAGGAGG - Intronic
975517215 4:75260055-75260077 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
975680142 4:76868088-76868110 CCTTTTCTTTCGCAGCTGGGAGG + Intergenic
976661492 4:87544978-87545000 TCTTTTCTTTGACTGCTGGGAGG + Intergenic
976856427 4:89609989-89610011 CCTTTTCTTTCCCAGCTGGGAGG + Intergenic
977020046 4:91747168-91747190 CCTTTTCTCTCACAGCTGGGAGG - Intergenic
977283426 4:95070385-95070407 TTTTCACTTTGGCAGCTGGGTGG + Intronic
977543512 4:98347837-98347859 TGCTATCTTTCACAGCTGGCTGG - Intronic
977733174 4:100379711-100379733 CCCTTTCTTTTGCAGCTGGGAGG + Intergenic
978670647 4:111244183-111244205 CCTTTTCTTTCCCAGGTGGGAGG + Intergenic
978726742 4:111977885-111977907 CCTTTTCTTTCGCAGCTGAGTGG - Intergenic
979498479 4:121411590-121411612 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
979704800 4:123709071-123709093 ACCTTTCTTTTGCAGCTGGGAGG + Intergenic
979794941 4:124834590-124834612 CCTTTTCTTTTGCACCTGGGAGG - Intergenic
979995426 4:127425934-127425956 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
980087238 4:128403834-128403856 CCTTTTCTTTAGCAGCTGGGAGG - Intergenic
980195115 4:129578373-129578395 TATTTGCTTTCACAGCTGGGAGG - Intergenic
980237778 4:130131388-130131410 TATTTGCTTTTGCAGCTGGGAGG + Intergenic
980523486 4:133960633-133960655 TCTTTTCTTTTGCAGCTGGGAGG + Intergenic
981346588 4:143683727-143683749 CCCTTTCTTTCGCAGCTGGGAGG + Intronic
982189982 4:152843842-152843864 CCTTTTCTTTCGCAGCTGGAAGG - Intronic
982680197 4:158419314-158419336 CCTTTTCTTTCGCAGCTGGGAGG - Intronic
983449738 4:167895195-167895217 CCTTTTCTGTGGCAGCTGGGAGG + Intergenic
984266748 4:177505657-177505679 CCTTTTCTTTGGCAGCGGGGAGG - Intergenic
984323524 4:178224126-178224148 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
984475030 4:180224964-180224986 TACTTGCTTTCGCAGCTGGGAGG - Intergenic
984527600 4:180875681-180875703 CCTTTTCTTCTGCAGCTGGGAGG - Intergenic
984721632 4:182978154-182978176 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
985092833 4:186381686-186381708 CTTTTTCTCTCGCAGCTGGGAGG + Intergenic
985217822 4:187672161-187672183 CTTTTTCTCTCGCAGCTGGGAGG - Intergenic
985700945 5:1372122-1372144 TTTTATCTTTCTCACCAGGGAGG - Intergenic
988271240 5:29020611-29020633 TCTTAGCTTTCCCAGATGTGAGG - Intergenic
988344553 5:30020838-30020860 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
988712632 5:33793841-33793863 CCTTTTCTCTCACAGCTGGGAGG - Intronic
988902179 5:35745385-35745407 CCTTTTCTTTCACAGCTCGGAGG + Intronic
989557655 5:42816132-42816154 TCTTGTCTCTCACAGCAGGGAGG + Intronic
990712880 5:58604730-58604752 CTTTTTCTTTCACAGCTGGGAGG - Intronic
991386906 5:66100918-66100940 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
991923827 5:71684142-71684164 TACTTTCTTTCCCAGCTGGGAGG + Intergenic
993883923 5:93395002-93395024 CCTTTACTTTTGCAGCTGGGAGG - Intergenic
994051353 5:95365900-95365922 TATTTACTTTCACAGCTGGGAGG - Intergenic
994568423 5:101483182-101483204 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
994875261 5:105413715-105413737 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
995317949 5:110797580-110797602 CCTTTACTTTCACAGCTGGGAGG - Intergenic
996010705 5:118478910-118478932 CCTTTTCTTTCGCAGCTGGGAGG + Intergenic
996288988 5:121829277-121829299 CCTTTTCTTTCGCAGCTGCGAGG - Intergenic
996504838 5:124257440-124257462 CCTTTTCTTTTGCAACTGGGAGG - Intergenic
997267990 5:132508701-132508723 TCTCCTCTTTCCCAGCTTGGTGG + Intergenic
997433055 5:133854620-133854642 TCTAATCAGTCTCAGCTGGGAGG + Intergenic
998777528 5:145619107-145619129 CTTTTTCTTTCACAGCTGGGAGG - Intronic
999484906 5:151985586-151985608 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1000757962 5:165184398-165184420 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1000875132 5:166627761-166627783 TCTTATTTTTTTCAACTGGGGGG + Intergenic
1001814760 5:174659014-174659036 TCTTAAATTGCCCAGCTGGGAGG - Intergenic
1003029476 6:2589495-2589517 CCTTCTCTCTCACAGCTGGGAGG - Intergenic
1003063101 6:2877446-2877468 TCTTTTCTTTCTCAGCTAGGAGG + Intergenic
1003450828 6:6230158-6230180 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1003581902 6:7347642-7347664 CCTGTTCTTTCACAGCTGGGAGG + Intronic
1003711967 6:8602621-8602643 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1005072444 6:21874386-21874408 CTTTTTCTTTTGCAGCTGGGAGG + Intergenic
1005191473 6:23228747-23228769 CCTTTTCTTGCCCAGCTGGGAGG - Intergenic
1005760225 6:28960994-28961016 TACTTTCTTTCACAGCTGGGAGG + Intergenic
1006452351 6:34112503-34112525 TCTTATCTGATGCAGCTGGGGGG + Intronic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1008121506 6:47622263-47622285 CCTTTTCTTTCGCAGCTAGAAGG - Intronic
1008856292 6:56091934-56091956 TTTTATCTTGGGCAGCTAGGTGG - Intronic
1009453124 6:63824971-63824993 CCTTTTCTTTTGCAGCTGGGAGG + Intronic
1009798472 6:68502660-68502682 TATTTGCTTTCCCAGCTGGGAGG + Intergenic
1009968725 6:70604407-70604429 TCTTTTCTTTCACAGCTGGGAGG + Intergenic
1010009005 6:71028469-71028491 CCTTTTCTTTTGCAGCTAGGAGG - Intergenic
1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG + Intergenic
1010707805 6:79135295-79135317 TATTTGCTTTCACAGCTGGGAGG - Intergenic
1011133194 6:84072999-84073021 CCTTTTCTTTTGCAGCTGCGGGG - Intronic
1011168581 6:84479227-84479249 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1012308419 6:97689232-97689254 CCATGCCTTTCGCAGCTGGGAGG + Intergenic
1012793692 6:103734107-103734129 CCTCTTCTTTCACAGCTGGGAGG + Intergenic
1013721088 6:113028618-113028640 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1013852690 6:114534864-114534886 CCTTTTCTTTCCCAGCTGGGAGG - Intergenic
1013877829 6:114855702-114855724 CCTTTTCTTTCGCAGCTGGGAGG + Intergenic
1014304865 6:119727745-119727767 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1014336780 6:120147232-120147254 CCTTTCCTTTCACAGCTGGGAGG + Intergenic
1014603848 6:123448301-123448323 CCTTTTCTTTTGCAGCTGGAAGG + Intronic
1014738723 6:125124171-125124193 CCTTTTCTCTCACAGCTGGGAGG + Intronic
1015849838 6:137560389-137560411 CCTTCTCTTTTGCAGCTGGGAGG - Intergenic
1018009361 6:159655531-159655553 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1018114993 6:160574327-160574349 CCTTTTCTTTCACAGCTGGGAGG - Intronic
1020634858 7:10684756-10684778 TACTTTCTTTCACAGCTGGGAGG + Intergenic
1020860746 7:13489313-13489335 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1020915202 7:14184357-14184379 CCTTTTCTTTCGCAGTTGGGAGG + Intronic
1022787394 7:33652153-33652175 CCTGGTCTTTCTCAGCTGGGTGG + Intergenic
1023701216 7:42893337-42893359 CCTTTTCTCTCACAGCTGGGAGG + Intergenic
1024191798 7:47019677-47019699 TCTTATCTTGCCCAGATGTGGGG - Intergenic
1024917274 7:54515463-54515485 GCTTTTCTTTCATAGCTGGGAGG - Intergenic
1025772752 7:64528391-64528413 CCTTTTCTTTCACAGCTAGGAGG + Intronic
1027295328 7:76763960-76763982 CCTTTTCTTTCACAACTGGGAGG + Intergenic
1027350501 7:77306613-77306635 CCTTTTCTTTTGCAGCTGGGAGG - Intronic
1027417693 7:77990475-77990497 CCTTTTCCTTTGCAGCTGGGAGG - Intergenic
1028183011 7:87747907-87747929 TCTTTTCTTTTGCACCTGGGAGG - Intronic
1030325161 7:108211449-108211471 CCTTTTCTTTTGCCGCTGGGAGG + Intronic
1030935944 7:115585115-115585137 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1031752213 7:125590324-125590346 TATTATCTTTCAAAGCTGGCAGG + Intergenic
1031879180 7:127177066-127177088 CCTTTTCTTTCGCAGCTGGGAGG + Intronic
1035598163 8:877909-877931 TCTTGACTTTCTGAGCTGGGAGG + Intergenic
1038367258 8:26948671-26948693 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1039083335 8:33755598-33755620 CCTTTTTTTTCACAGCTGGGAGG - Intergenic
1039123519 8:34175397-34175419 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1039268451 8:35854456-35854478 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1039571781 8:38592771-38592793 TATTTGCTTTTGCAGCTGGGAGG + Intergenic
1040635721 8:49270716-49270738 CCTTTTCTTTGGCAGCTGGGAGG - Intergenic
1040711581 8:50195366-50195388 CCTTTTCTTTCACAGCTGGAAGG - Intronic
1040800208 8:51331546-51331568 CCTTTTCTTTCGTAGCTGGGAGG + Intronic
1041205697 8:55495711-55495733 TCCAACCTCTCGCAGCTGGGTGG - Intronic
1041293802 8:56333699-56333721 GCTCTTCTTTCACAGCTGGGAGG - Intergenic
1041364125 8:57083359-57083381 CCTTTTCTTTAGCAGCTGGGAGG + Intergenic
1041570606 8:59333359-59333381 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1041637047 8:60156249-60156271 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1041658168 8:60375054-60375076 CCTTTTCTCTCGCAGCTGGGAGG + Intergenic
1042088557 8:65133681-65133703 CCTTTTCTCTTGCAGCTGGGAGG + Intergenic
1042304183 8:67314191-67314213 CCTTTTCTTTCACAGCTGGGAGG - Intronic
1042467184 8:69141082-69141104 CCCTTTCTTTGGCAGCTGGGAGG - Intergenic
1043040742 8:75259396-75259418 TATTTGCTTTCACAGCTGGGAGG + Intergenic
1044227499 8:89736223-89736245 TCTTTTCTTTCTCAGCTGGGAGG + Intergenic
1045994145 8:108343062-108343084 TTCTTGCTTTCGCAGCTGGGAGG + Intronic
1047130806 8:122017689-122017711 CCTTTTCTCTCGCAGCTGAGAGG - Intergenic
1050502635 9:6315021-6315043 CCTTTTCTTTCTCAGCTGGAAGG + Intergenic
1051362632 9:16294634-16294656 TTTTTTCTTTCGCAGCTGGAAGG + Intergenic
1053079227 9:35160797-35160819 TTTTTTCTTTTGCAGCTGTGAGG + Intergenic
1054749891 9:68894916-68894938 TCTTTTCTTTCTCCGCTGTGGGG + Intronic
1054867813 9:70020555-70020577 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1055347032 9:75350270-75350292 TCTTTTCTTTCGCAGCCGGGAGG - Intergenic
1055736222 9:79334195-79334217 TGCTTGCTTTCGCAGCTGGGAGG + Intergenic
1056322786 9:85452345-85452367 CCCTTTCTTTCACAGCTGGGAGG - Intergenic
1057119548 9:92559053-92559075 CCTTTTCTTTGGCAGCTGGGAGG - Intronic
1058085089 9:100739998-100740020 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1058156725 9:101524402-101524424 CCTTTTCTTTCGCAGCTGGGAGG - Intronic
1058308451 9:103471593-103471615 CCTTTTCTTTCCCAGGTGGGAGG - Intergenic
1058623248 9:106905819-106905841 TCTTTTTTCTCGCAGCTGGGAGG - Intronic
1059245253 9:112844219-112844241 TTTTGGCTTTAGCAGCTGGGTGG + Intronic
1186833503 X:13414622-13414644 TTTTCTCTCTCTCAGCTGGGTGG + Intergenic
1187219251 X:17308000-17308022 CCTTTTCTTTCACAGCTGGAAGG - Intergenic
1187681368 X:21770775-21770797 CCTTTTCTTTCGCAGCAGGGAGG + Intergenic
1187748337 X:22433408-22433430 CCTTTTCTCTCACAGCTGGGAGG + Intergenic
1188045956 X:25426369-25426391 CCTTTCCTTTCGCAGCTGGGAGG - Intergenic
1188738053 X:33742368-33742390 CCCTTTCTTTGGCAGCTGGGAGG - Intergenic
1190005516 X:46732874-46732896 TCTTTTCTTTCATAGCTGCGTGG - Intronic
1190448875 X:50557820-50557842 CCTTTTCTCTCGCAGCTGGGAGG + Intergenic
1190596211 X:52054305-52054327 TTCTATCTTTTGCAGCAGGGTGG + Intergenic
1190612613 X:52199768-52199790 TTCTATCTTTTGCAGCAGGGTGG - Intergenic
1191067663 X:56367398-56367420 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1191779916 X:64854208-64854230 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1191903620 X:66064603-66064625 CCTTTTCTTTTGTAGCTGGGAGG - Intergenic
1191954083 X:66625232-66625254 CCTTTTATTTCACAGCTGGGAGG + Intronic
1192014758 X:67317454-67317476 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1192067078 X:67896740-67896762 TTTTCTCTTTTGCAGCTGTGAGG + Intergenic
1192069112 X:67918337-67918359 CCTTTTCTTTCACAGCTGGGAGG - Intergenic
1192914566 X:75638506-75638528 TCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1192979095 X:76319374-76319396 CCTTTTCTTTCCCAGCTGGGAGG - Intergenic
1192995177 X:76505688-76505710 CCTTTTCCTTTGCAGCTGGGAGG - Intergenic
1193076963 X:77364733-77364755 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1193101797 X:77622692-77622714 CCTTTTCTTTTGCAGCTTGGAGG + Intronic
1193156801 X:78183063-78183085 CGTTTCCTTTCGCAGCTGGGAGG + Intergenic
1193404209 X:81082380-81082402 TCTTTACTTTTGCAGCTGGAAGG + Intergenic
1193420759 X:81279898-81279920 CCTTTTCTTTCGCAGCTGGGAGG + Intronic
1193578464 X:83232463-83232485 CCTTTTCTTTAGCGGCTGGGAGG + Intergenic
1193779693 X:85686485-85686507 CCTTTTCTCTTGCAGCTGGGAGG - Intergenic
1193791599 X:85821591-85821613 TACTTTCTTTTGCAGCTGGGAGG + Intergenic
1193826349 X:86231662-86231684 CCTTTTCTCTCACAGCTGGGTGG - Intronic
1193974325 X:88098846-88098868 TCCTCTCTTTTGCAGCTGTGAGG + Intergenic
1194701544 X:97119968-97119990 CCTTTTCTTTCACAGCTCGGAGG - Intronic
1194926968 X:99836777-99836799 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1195019520 X:100812685-100812707 CCTTTTCTCTCACAGCTGGGAGG - Intergenic
1195795407 X:108641953-108641975 CCTTTTCTTTTGCAGCTTGGTGG + Intronic
1196170855 X:112587347-112587369 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1196218858 X:113088127-113088149 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1196225223 X:113158137-113158159 TATTTGCTTTCACAGCTGGGAGG - Intergenic
1196235433 X:113274352-113274374 CCTTTTCTTTGGCAGTTGGGAGG + Intergenic
1196464780 X:115960620-115960642 ACTTTTCTCTTGCAGCTGGGAGG + Intergenic
1196590536 X:117481775-117481797 CCTTTTCTTTCACAGCTAGGAGG - Intergenic
1196675798 X:118419108-118419130 CTTTTTCTTTCACAGCTGGGAGG - Intronic
1197066286 X:122237516-122237538 CCCTTTCTTTCACAGCTGGGAGG - Intergenic
1197132349 X:123019881-123019903 TCTTTTCTTTCACAGCTGGGAGG + Intergenic
1197518867 X:127472889-127472911 CCTTTTCTTTCACAGCTGGGAGG + Intergenic
1197671708 X:129284660-129284682 CCTTTTCTTTTGCAGCTGGGAGG - Intergenic
1197977785 X:132183562-132183584 TCTTGGCTTTAGCAACTGGGTGG + Intergenic
1198843190 X:140880772-140880794 CCTTTTCTTTTGCAGCTGGGAGG + Intergenic
1199193845 X:145003858-145003880 TCTTTTCTTTTGTAGCTGTGAGG + Intergenic
1199668470 X:150121001-150121023 CCTTTTATTTTGCAGCTGGGAGG + Intergenic
1200285757 X:154820723-154820745 TTTTCTCTTTTGCAGCTGCGAGG + Intronic
1201306654 Y:12556404-12556426 CTTTTTCTTTCACAGCTGGGAGG + Intergenic