ID: 1093996118

View in Genome Browser
Species Human (GRCh38)
Location 12:25644704-25644726
Sequence CTTCTATTCTGCAGCATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093996118_1093996125 22 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996125 12:25644749-25644771 ATCCTTGGAAAGGTGAGGGTGGG 0: 1
1: 0
2: 0
3: 34
4: 284
1093996118_1093996122 17 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996122 12:25644744-25644766 CAAGAATCCTTGGAAAGGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 219
1093996118_1093996120 7 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996120 12:25644734-25644756 ACTATAAGAACAAGAATCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 199
1093996118_1093996127 26 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996127 12:25644753-25644775 TTGGAAAGGTGAGGGTGGGTAGG 0: 1
1: 0
2: 4
3: 64
4: 513
1093996118_1093996123 18 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996123 12:25644745-25644767 AAGAATCCTTGGAAAGGTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 288
1093996118_1093996121 12 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996121 12:25644739-25644761 AAGAACAAGAATCCTTGGAAAGG 0: 1
1: 0
2: 2
3: 20
4: 302
1093996118_1093996124 21 Left 1093996118 12:25644704-25644726 CCATAGATGCTGCAGAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1093996124 12:25644748-25644770 AATCCTTGGAAAGGTGAGGGTGG 0: 1
1: 0
2: 2
3: 29
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093996118 Original CRISPR CTTCTATTCTGCAGCATCTA TGG (reversed) Intronic
901881450 1:12196363-12196385 GTGCTATTCAGCAGCATCTTTGG + Intronic
901984603 1:13064482-13064504 CTTCCTTTCTGGAGCATCTCTGG + Intronic
901997207 1:13162288-13162310 CTTCCTTTCTGGAGCATCTCTGG - Intergenic
905217373 1:36418468-36418490 CTGCTATTCTGTAGCAGCCAGGG - Intronic
905502303 1:38449370-38449392 CTCCTATCCTCCAGCATCAATGG - Intergenic
906471729 1:46136618-46136640 CTGGAATTCAGCAGCATCTAGGG - Intronic
906756221 1:48318245-48318267 CTTCTATTCAGCAGTATATTGGG + Intronic
906903705 1:49865409-49865431 TTGCTATTCTGCAGCCTCCACGG + Intronic
907301187 1:53487161-53487183 TTTCTAAGCTGCAGCATCAAAGG + Intergenic
908627849 1:66066605-66066627 ATTATATTCTGCAGCTTTTAGGG - Intronic
911312142 1:96306283-96306305 CTACAATTCTGCATCATTTATGG - Intergenic
912752888 1:112300181-112300203 CTTCTTTTCTGCAACATTTATGG - Intergenic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914665526 1:149829393-149829415 CTTCTATTGTGTAGCATCCCTGG + Intergenic
914670239 1:149864401-149864423 CTTCTATTGTGTAGCATCCCTGG - Intronic
921271987 1:213478781-213478803 CTTCTAGTCTGCAGCAGATTTGG + Intergenic
922098616 1:222463568-222463590 CTTCGATTCTGCAGCTTATCTGG - Intergenic
922977815 1:229799689-229799711 CTTCTATCCTCCAGCCTCTTGGG - Intergenic
1064248509 10:13689032-13689054 CTTCATTTCTTCAGCATCTGAGG + Intronic
1065038123 10:21661239-21661261 CTTCTATTCTCCAGCTTACATGG - Intronic
1066929154 10:41735111-41735133 CTTCCATTCTGCTGAATCAAAGG - Intergenic
1068689876 10:59905009-59905031 CCGCTATTTTGCAGCAGCTATGG + Intronic
1068916302 10:62435491-62435513 CTAACATTCTGCAGCATTTAGGG - Intronic
1070394840 10:76003083-76003105 CTGGTAATCTGCAGAATCTAGGG - Intronic
1072084254 10:92062977-92062999 CATGTATTCTTCAGCATCTTTGG - Intronic
1072303966 10:94088653-94088675 CTGCTATTCTGCAGCATGGCAGG + Intronic
1072813862 10:98485874-98485896 CTTCTCTTCTGCAGTCTCCAAGG - Intronic
1072864830 10:99047637-99047659 CTTCTCTTCTACACCATCCATGG - Intronic
1076017841 10:127042758-127042780 CTTCCATGCTGCAGCGTCTGAGG + Intronic
1081416682 11:42823586-42823608 CTTCTGTCCTCCTGCATCTATGG - Intergenic
1086236892 11:84642626-84642648 CTTCTCTTCTGCTTCATTTATGG - Intronic
1086892053 11:92269874-92269896 TTTCTATTCTACATCCTCTAGGG + Intergenic
1088926330 11:114306960-114306982 CTTCTATTCCAAAGCATCTCTGG + Intronic
1090555827 11:127874244-127874266 CTCCTATTCTTCAGCATGTTAGG - Intergenic
1092178395 12:6426916-6426938 CTTCTCTTCTGCAGGATTTTTGG - Intergenic
1093106950 12:15098256-15098278 CTTGTATTCTTCAGTGTCTATGG + Intergenic
1093996118 12:25644704-25644726 CTTCTATTCTGCAGCATCTATGG - Intronic
1094132668 12:27091459-27091481 CATGCAGTCTGCAGCATCTATGG - Intergenic
1097727990 12:63096282-63096304 CATCTATCCTGTAGCATCTTAGG + Intergenic
1101006444 12:100405578-100405600 CTTGTCTTCTCCAGCTTCTAGGG - Intronic
1106404035 13:29458088-29458110 CTTCTTTTGTGAAGCATCTGTGG + Intronic
1107229460 13:38090808-38090830 TTTCTATACTGAAGCAGCTACGG + Intergenic
1108771288 13:53703549-53703571 CTTGAATTCTACAGCTTCTATGG - Intergenic
1111076090 13:83237575-83237597 CTTCTATGCTGTATAATCTAAGG - Intergenic
1112421792 13:99258570-99258592 CTTGAAGTCTGCATCATCTATGG + Exonic
1114596012 14:23912284-23912306 AATCTCTTCTGCAGCATCTTAGG - Intergenic
1114935267 14:27528451-27528473 CTGGTATTCTGCTGCATCTCTGG + Intergenic
1115455181 14:33593805-33593827 CTACTATTCTGCAACATCAAGGG - Intronic
1116076875 14:40121966-40121988 TTTTTATTCTCCAGCATCTCAGG + Intergenic
1117270740 14:54140785-54140807 CTTCTGATCTGCAGGAACTATGG + Intergenic
1118903480 14:70005724-70005746 CTTCTTCTCTGCACCATCTGAGG + Intronic
1119194060 14:72703848-72703870 CTTAGATCCTGCAGCAGCTAGGG + Intronic
1120072360 14:80117953-80117975 CTTCTATTCTCTAGCATGCATGG + Intergenic
1120464029 14:84833162-84833184 CACCTATTCTGCAGCTTCAATGG - Intergenic
1120545779 14:85809458-85809480 CTTCTATTCAGGGACATCTATGG + Intergenic
1121158471 14:91710586-91710608 CTTATATTTTGAAGCATCTCTGG - Intronic
1125587141 15:40828881-40828903 CTCCCTTTCTGCAGCTTCTAGGG + Intergenic
1126346883 15:47705123-47705145 CTTTTACTCTGAAGCACCTATGG + Intronic
1128816988 15:70617512-70617534 CTTCTACTGTGAAGCAACTAGGG - Intergenic
1132161414 15:99546697-99546719 CTTCTGGTCTACAGCATTTATGG + Intergenic
1133265136 16:4578847-4578869 CTTCTCTTATGGAGCATCTCAGG - Intronic
1137469620 16:48742917-48742939 CCTACATTCTGCAGCATCTCTGG - Intergenic
1138749730 16:59404447-59404469 CTTCTATTCTGCCTCATTTCAGG + Intergenic
1138850323 16:60621411-60621433 CTTGCATTCTGCAGGCTCTAGGG + Intergenic
1139311629 16:66032754-66032776 CATCAATTCAGCAGCATCTCTGG + Intergenic
1139775669 16:69315684-69315706 TTTCTATTCTGCTGCCTCAAGGG - Intronic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1143317861 17:6046297-6046319 CTATCATTCTGCACCATCTAAGG + Intronic
1146964728 17:37015875-37015897 CCTCTATTCTGGAGCTTCTGTGG + Intronic
1151867131 17:76811321-76811343 TTTCAATTCTGCAGCAGCTGCGG + Intergenic
1151958949 17:77394931-77394953 CTCCTATTCTCAAGCACCTACGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153136534 18:1923721-1923743 CTTACATTCTGTAGCATTTAAGG + Intergenic
1153568430 18:6444239-6444261 CTTCGATTCTGCAGCAACTGCGG + Intergenic
1158118127 18:54019255-54019277 CTACTTTTCTTCAGAATCTATGG + Intergenic
1159833717 18:73310563-73310585 CTTCTATTCACCAGGTTCTAGGG - Intergenic
925432380 2:3806377-3806399 CTTCTGTTCTGCAGCAGAGAGGG + Intronic
925749512 2:7075058-7075080 CTTCTAATCTGTAGAATCCATGG - Intergenic
926176495 2:10596739-10596761 CTTTCATTCTGCAGCAGCTCAGG - Intronic
926779324 2:16453167-16453189 CTTCCATTCTACAGAATCAAAGG + Intergenic
928456989 2:31431210-31431232 TTTCTCTTCTGCAGCACCTGTGG + Intergenic
928771509 2:34707426-34707448 CTTCTCTTCTACAGCATTTTTGG - Intergenic
930758059 2:54998908-54998930 CTTCTATACTGCAGAATAAAGGG + Intronic
931958914 2:67459750-67459772 ATCCTATCCTGCAGCATCTTGGG + Intergenic
933475601 2:82786140-82786162 CTTCAAGTCAGCAGCCTCTAGGG - Intergenic
935621385 2:105132932-105132954 CTTGTATTCTTCAGCTTCTAGGG + Intergenic
937011703 2:118568725-118568747 CTTCTTCTCTGCACCATCTGGGG - Intergenic
937781189 2:125839907-125839929 CTCCTGTTATGCAGCATATATGG + Intergenic
939725251 2:145711903-145711925 GTTATATTCTGCAAGATCTATGG + Intergenic
939793705 2:146614915-146614937 CTTCTATTCTGCCACATCTTTGG - Intergenic
940231581 2:151459416-151459438 TTTCTATTCAGGAGCAGCTAGGG + Intronic
940721094 2:157283059-157283081 CTTCTATTCTTGTGGATCTAAGG + Intronic
941012651 2:160319004-160319026 CCTATATTCCCCAGCATCTATGG - Intronic
942862851 2:180636513-180636535 ATTCTATTCTACTGCAGCTAAGG - Intergenic
946134020 2:217630858-217630880 TTTCTATTCTTCTCCATCTATGG + Intronic
946223949 2:218252333-218252355 TTTCTTTTCTGCAGCTTCTTGGG + Intronic
946567545 2:220983595-220983617 TCTGTATTCTGCAGCTTCTAGGG + Intergenic
1168810757 20:703093-703115 CTTCTGTTCTACAGTATCTGGGG - Intergenic
1174775132 20:53336402-53336424 CTTATAATCTGCAGCTTCTTAGG - Intronic
1177333922 21:19699362-19699384 CTTCTTTTCTGGAGCATGTCAGG + Intergenic
1177453476 21:21303076-21303098 CTAGTATTCTGCAGTGTCTATGG - Intronic
1177841784 21:26242563-26242585 CTCCCATTCTGCAAGATCTACGG + Intergenic
1179952650 21:44718799-44718821 CTTTTATGCTGCAGCCACTAGGG + Intergenic
1182876876 22:33699813-33699835 CTTACACTCAGCAGCATCTAAGG + Intronic
949129197 3:480963-480985 CTTCTCTTCTTCAAAATCTAAGG + Intergenic
949620469 3:5805800-5805822 CTGCTAGTCTACAGCATATAGGG - Intergenic
952011376 3:28903979-28904001 CTACTAGTCTGCGGCATGTAAGG - Intergenic
953070174 3:39512323-39512345 TTTATATTCAGCAGTATCTATGG + Intronic
957849454 3:85787830-85787852 CTTCTTTTCTGCCTCATCTTGGG + Intronic
959979188 3:112496055-112496077 CCTTTATTCTGCATCATATATGG + Intronic
961095771 3:124155241-124155263 CTTCTCTTCTGCACCCTCCATGG + Intronic
961123403 3:124393834-124393856 AATCTCTTCTGCCGCATCTAGGG + Intronic
961957997 3:130824283-130824305 CTTCTAATCTTCAGCAAGTAAGG - Intergenic
963547776 3:146683437-146683459 CTTCTATTCAGCTGGATCCATGG - Intergenic
966297833 3:178444582-178444604 GCTCTATTCTACAGCAGCTAAGG + Intronic
970782543 4:19755762-19755784 CTTTTTTTCTGGAGGATCTAGGG - Intergenic
970930147 4:21501625-21501647 CTTCAACTCTGCAGCAATTATGG + Intronic
975316518 4:72959493-72959515 CTTCTCCTCTGCAGGATCTGGGG - Intergenic
978856129 4:113396964-113396986 CTTCTATTCACCAGGATATATGG + Intergenic
979746451 4:124219724-124219746 CTTATATTCTGCAGCTATTATGG - Intergenic
980197794 4:129613953-129613975 CTTCTATTCTTGATCATCTAAGG + Intergenic
980300296 4:130982504-130982526 CTTGTCTTCTGCAGCCTCAAGGG - Intergenic
981202396 4:141995973-141995995 ATTCTATTCTGCCTCATTTAAGG - Intergenic
982676905 4:158386657-158386679 TTTCTATACTCCAGCATCCAGGG + Intronic
986117332 5:4789694-4789716 CTTGTATCCTGCAACATTTATGG - Intergenic
986852996 5:11834637-11834659 CCTATATTCTGCAGGATCTTGGG + Intronic
986920166 5:12670937-12670959 CTTCTATTTTGCAAAAGCTAAGG + Intergenic
987435530 5:17888597-17888619 CTTATATTCTGCAGAATCATTGG + Intergenic
987578939 5:19763440-19763462 CTTCAATTATGCAGTAACTATGG - Intronic
989135008 5:38144865-38144887 CTTCTAGTCCTCAGGATCTAGGG - Intergenic
989457181 5:41657754-41657776 GTTCTATTCTTCAGCCTCTGGGG - Intergenic
990354535 5:54953336-54953358 CTTCTTTCCTTCAGGATCTATGG + Intergenic
990857416 5:60284968-60284990 CATCCATTATGCATCATCTATGG + Intronic
990991248 5:61686147-61686169 CCTCTCTTCTGCAGCATGTTTGG + Intronic
991202333 5:64008854-64008876 TTTCTATTCTGCAGCCACCACGG + Intergenic
992341914 5:75832769-75832791 CCTCTTTTCTGGAGCGTCTAAGG + Intergenic
992353340 5:75953616-75953638 CTTCTAGCCTGTAGCATATATGG - Intergenic
992870110 5:80997272-80997294 ATTCTAATTTGCAGCATCCATGG - Intronic
993775994 5:91996791-91996813 CTTCTGATCTGTCGCATCTATGG + Intergenic
993896618 5:93542761-93542783 CTTCAATTCTGAAACATCAAAGG + Intergenic
994078225 5:95677728-95677750 CTTCTATTTTGTAGTATATATGG + Intronic
994505470 5:100638330-100638352 CTTCTATACTGAAGCATGTAAGG - Intergenic
995051811 5:107715367-107715389 CTTCTATTCTGGAAAATGTAGGG + Intergenic
995858906 5:116621421-116621443 CTTCTCTTTTCCATCATCTAGGG + Intergenic
997054609 5:130426421-130426443 CTTCTATTGTGCATCATTTGTGG + Intergenic
998216725 5:140243148-140243170 CTTCCATTCAGCAGCAGCAATGG + Intronic
999005570 5:147973700-147973722 CTTCTTTTCTGGAGCCTCTGGGG + Intergenic
1000656419 5:163884512-163884534 CATCTATACTGCTGCATGTAGGG - Intergenic
1002824089 6:757011-757033 CTTCGTTTCTGGAGGATCTAGGG - Intergenic
1004038805 6:11953472-11953494 CTTCTTTTCTCCAGCCTCAAAGG + Intergenic
1007657951 6:43463738-43463760 CTTCTATTATGCAGCAGCCAGGG + Intergenic
1010218319 6:73425168-73425190 CTTGTATTCTCCAGGATTTAGGG + Exonic
1012761857 6:103312381-103312403 CTTCTATTCTGGATGATCTGGGG - Intergenic
1013748547 6:113374235-113374257 CTTCCATTCTCCAGCATCACCGG - Intergenic
1014829543 6:126086073-126086095 CTTTTAATATGAAGCATCTAAGG - Intergenic
1016907059 6:149161435-149161457 CTTTCATTCTGAAGCTTCTAGGG + Intergenic
1021003718 7:15367360-15367382 CTACTATTTTACAGCTTCTATGG + Intronic
1028403048 7:90445622-90445644 TTTCTATTCAGCAGCATTTGGGG - Intronic
1029246730 7:99207437-99207459 CCTCTCTTCTGGAGCATCTAAGG + Exonic
1030074765 7:105726777-105726799 CTCCTGTGCTGCAGCATCTCAGG + Intronic
1033611551 7:142967949-142967971 CTTCTATTCTGCTGCCTAGAAGG + Intergenic
1035440146 7:158890453-158890475 GTTCAATTCTTCAGCATTTATGG + Intronic
1036740283 8:11355054-11355076 CTTCTATTCTGCATTATAAAGGG - Intergenic
1038787002 8:30626818-30626840 ATTCCATTGTGCAGCATCTGTGG + Intronic
1042223756 8:66498890-66498912 CCTCTCTTCTGCAGCTTCTCAGG - Intronic
1043106153 8:76113551-76113573 CTTGTATACTGCAACATCTCAGG - Intergenic
1055212097 9:73808538-73808560 ATTGTATTATGCATCATCTATGG + Intergenic
1057607819 9:96513542-96513564 CTTCTTCTCTGCAGCATCCTTGG + Intronic
1060116714 9:120947176-120947198 ATTCTTTTCTGCATTATCTATGG + Intergenic
1185616127 X:1423304-1423326 CTTCTATGTTCCAGCCTCTAAGG + Intronic
1187063476 X:15810385-15810407 CTTCTCTTCTGCAGAATATATGG - Intronic
1188372222 X:29382710-29382732 TTTCTGTACTGCTGCATCTAGGG + Intronic
1188918115 X:35937192-35937214 CTCCTCTTCTGCAGGATCTCAGG + Intronic
1198059266 X:133027936-133027958 CTTCAATTGTTCAGCATCTGTGG + Exonic