ID: 1093999993

View in Genome Browser
Species Human (GRCh38)
Location 12:25684597-25684619
Sequence AAAACACTTCCAAAACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093999993_1093999996 13 Left 1093999993 12:25684597-25684619 CCTGCTGGTTTTGGAAGTGTTTT No data
Right 1093999996 12:25684633-25684655 TGTCGAGATGCTTGAAGAATTGG No data
1093999993_1093999997 20 Left 1093999993 12:25684597-25684619 CCTGCTGGTTTTGGAAGTGTTTT No data
Right 1093999997 12:25684640-25684662 ATGCTTGAAGAATTGGTAGTTGG No data
1093999993_1093999998 24 Left 1093999993 12:25684597-25684619 CCTGCTGGTTTTGGAAGTGTTTT No data
Right 1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093999993 Original CRISPR AAAACACTTCCAAAACCAGC AGG (reversed) Intergenic
No off target data available for this crispr