ID: 1093999994

View in Genome Browser
Species Human (GRCh38)
Location 12:25684620-25684642
Sequence CATCTCGACAACTTTTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 30, 1: 83, 2: 83, 3: 47, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093999994_1093999998 1 Left 1093999994 12:25684620-25684642 CCCTGCAAAAAGTTGTCGAGATG 0: 30
1: 83
2: 83
3: 47
4: 93
Right 1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG No data
1093999994_1093999996 -10 Left 1093999994 12:25684620-25684642 CCCTGCAAAAAGTTGTCGAGATG 0: 30
1: 83
2: 83
3: 47
4: 93
Right 1093999996 12:25684633-25684655 TGTCGAGATGCTTGAAGAATTGG No data
1093999994_1093999999 8 Left 1093999994 12:25684620-25684642 CCCTGCAAAAAGTTGTCGAGATG 0: 30
1: 83
2: 83
3: 47
4: 93
Right 1093999999 12:25684651-25684673 ATTGGTAGTTGGTTGGCGAGTGG No data
1093999994_1093999997 -3 Left 1093999994 12:25684620-25684642 CCCTGCAAAAAGTTGTCGAGATG 0: 30
1: 83
2: 83
3: 47
4: 93
Right 1093999997 12:25684640-25684662 ATGCTTGAAGAATTGGTAGTTGG No data
1093999994_1094000000 13 Left 1093999994 12:25684620-25684642 CCCTGCAAAAAGTTGTCGAGATG 0: 30
1: 83
2: 83
3: 47
4: 93
Right 1094000000 12:25684656-25684678 TAGTTGGTTGGCGAGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093999994 Original CRISPR CATCTCGACAACTTTTTGCA GGG (reversed) Intergenic
902061041 1:13643086-13643108 CATCTCGACAACGTTTTGCAGGG - Intergenic
904814977 1:33189097-33189119 CATGTGGAGAATTTTTTGCAGGG - Intergenic
905854857 1:41303081-41303103 CATCTCAACAACGTTTTGCAGGG - Intergenic
905872547 1:41413362-41413384 GATCCTGACAACTTTCTGCAAGG - Intergenic
906367739 1:45224789-45224811 TATGTCGACAACTTTTTGCAGGG + Intronic
908884452 1:68772013-68772035 CATCTCAACAACTTATTGCAGGG - Intergenic
909133171 1:71765322-71765344 CATCTCAACAACTTTTTGCAGGG + Intronic
909299391 1:73992504-73992526 CATCTCAACAACTTTTTGCAGGG + Intergenic
909902348 1:81153585-81153607 CATTTCGACAACTTTTTGCAGGG + Intergenic
910051037 1:82974218-82974240 CATCTCGACAACTTTTTGCAAGG - Intergenic
910800841 1:91144197-91144219 CATCTTGACAACTTTTCACAGGG - Intergenic
910986426 1:93009219-93009241 CATCTCAACAACTTTTTTCAGGG - Intergenic
912023091 1:105131582-105131604 CATCGCAATAACTTTTTGCAGGG - Intergenic
914452843 1:147808089-147808111 CATTTTGACAACTTTTTGCAGGG - Intergenic
915032782 1:152897986-152898008 CATCTTGACAACATTTTGCAGGG - Intergenic
915388101 1:155515328-155515350 CATCTCAACAATTTTTTGCAGGG + Intronic
918490979 1:185081294-185081316 CATCTTGACAACTTTTTGCAGGG - Intronic
918764479 1:188461238-188461260 CATCTCAACAACTTTTTGCACGG - Intergenic
918821245 1:189257481-189257503 CATCTCCACTACTTTTTGGGGGG + Intergenic
919274660 1:195398076-195398098 CATCTCAACAACTTTTTGCAGGG - Intergenic
920362885 1:205431435-205431457 AATATCCACAAGTTTTTGCAGGG - Intronic
920636866 1:207712574-207712596 CATCAGGACAACTTTTTACCTGG + Intronic
921057123 1:211551211-211551233 CATCTTGACAACTTTTTGCAGGG + Intergenic
921679834 1:218018028-218018050 CATCTCAACAACTTTTTTCAGGG + Intergenic
921776607 1:219107861-219107883 CATCTCTAAAACATTTTGCAGGG + Intergenic
922174286 1:223183866-223183888 CATCTCAACAAGTTTTTGCAGGG - Intergenic
924773174 1:247094487-247094509 CATCTTGACAACTTTTTGCAGGG + Intergenic
1063257675 10:4346409-4346431 CATCAAAACAACATTTTGCATGG - Intergenic
1063548912 10:7009877-7009899 CATCTCAACAACTTTTTGCAGGG + Intergenic
1064330535 10:14389948-14389970 CACTTTGACAACTTTTTGCAGGG + Intronic
1064620812 10:17215284-17215306 CATCTGAACAATTTTTTGGAAGG - Intergenic
1065992215 10:31022811-31022833 CATCTCGACAACTATTTGAAAGG + Intronic
1067574406 10:47400029-47400051 CATCTCGACAACTTTTTGCAGGG + Intergenic
1068316675 10:55353131-55353153 CATCTCTACAACTTTTTGCAGGG + Intronic
1069180519 10:65352804-65352826 CATCTTGACAACATTTTGCAGGG - Intergenic
1069520426 10:69115515-69115537 CATCTCGGCAACTTTTTGCAGGG + Intergenic
1071389497 10:85157183-85157205 CATCTCAAAAACTTTTTGCAGGG + Intergenic
1072042277 10:91619454-91619476 GCACTCGACAACTTTTTGCAGGG - Intergenic
1075224920 10:120620197-120620219 CATCTCTACAACTTTTTTCTAGG + Intergenic
1076205252 10:128593750-128593772 CATCTCAGCAACTTTTTGGAGGG - Intergenic
1077852689 11:6089345-6089367 CATCTCAACAACTTTTTGCAAGG + Intergenic
1078244071 11:9557299-9557321 CATCTCAACAACTTTTTGTACGG + Intergenic
1078283690 11:9929750-9929772 CATCTCAACAACTTTTTGCAGGG + Intronic
1079017029 11:16877855-16877877 CATCACAACAACCTTTTGGAGGG - Intronic
1079854570 11:25586072-25586094 CCTCTCAACAACTTTTTATAGGG - Intergenic
1080318834 11:30982225-30982247 CTTCTCCACAACTTCTTCCAAGG + Intronic
1080602474 11:33833251-33833273 CATCTCGACAACTTTTTGCAAGG + Intergenic
1081109203 11:39112048-39112070 CATCTTGACAACTTTTTGCAGGG + Intergenic
1082700935 11:56429566-56429588 AATCTCGACAACTTTTTGCAGGG + Intergenic
1083408719 11:62477109-62477131 CATCTCGACAACTTTTTGCAGGG + Intronic
1085375635 11:76058372-76058394 CACCTGGCTAACTTTTTGCACGG - Intronic
1087882290 11:103431750-103431772 CATCTCAACAACATTTTGCAGGG - Intronic
1089097901 11:115934829-115934851 CATCTAGAAAATTATTTGCAGGG + Intergenic
1091522474 12:1260335-1260357 CATCTTGAAAACTTTTAGAAAGG - Intronic
1093356124 12:18170177-18170199 TATCTCGACAAGTTTTTGCAGGG - Intronic
1093999994 12:25684620-25684642 CATCTCGACAACTTTTTGCAGGG - Intergenic
1094554546 12:31485311-31485333 CATCTCGACAATTTTTTGCAGGG + Intronic
1095193849 12:39289484-39289506 CATCTCGAAAAGTTTTTGCAGGG + Intergenic
1095336879 12:41039187-41039209 CATCTCAACCACTCTTTGGAAGG + Intronic
1097796280 12:63865562-63865584 TATCTCAATGACTTTTTGCAGGG - Intronic
1097826119 12:64176296-64176318 CATCTCAACAGCTTTTTAAAAGG - Intergenic
1097846915 12:64376250-64376272 CATCTTGACAACTTTTGGCAGGG + Intronic
1098137903 12:67421960-67421982 CATCTCAACAACTTTTTGCAGGG + Intergenic
1098736040 12:74106821-74106843 CTTCTCAGCAACTTTTTGCAGGG - Intergenic
1099211518 12:79795796-79795818 TATCTTGACAATATTTTGCAAGG + Intronic
1099785507 12:87257263-87257285 CATCTCAACAACTTTTTGCAGGG - Intergenic
1099915414 12:88886365-88886387 CATCTCAATAGCCTTTTGCAGGG - Intergenic
1100413639 12:94348927-94348949 CATCTCAACAACTTTTTGCAGGG + Intronic
1100527702 12:95435307-95435329 CATCTCGAGAACTTTTTGCAGGG + Intergenic
1101275910 12:103201002-103201024 CACCTTGACAACTTTTTGCAGGG - Intergenic
1103978277 12:124718384-124718406 CATCTCGACAACTTTTTGCAGGG + Intergenic
1105271882 13:18884250-18884272 CATCTAGAAATTTTTTTGCAGGG + Intergenic
1105807987 13:23969072-23969094 CATCTTGACAACTCTTTGCAGGG + Intergenic
1106103736 13:26716504-26716526 GACCTAGACAACTTTTTTCAAGG + Intergenic
1106449960 13:29871978-29872000 CATTTCAACAACTTTTTGCAGGG + Intergenic
1106961417 13:35002831-35002853 CATCTCGGCAACTTTTTGTGGGG - Intronic
1107103150 13:36615692-36615714 CATCTCGACAACTTTTTGCAGGG - Intergenic
1107187637 13:37543375-37543397 CATCCCGACAACTTTTTGCAGGG - Intergenic
1107531828 13:41289932-41289954 TATCTCAACAACTTTTTGCAGGG + Intergenic
1109688347 13:65850375-65850397 CATCTCAATAACTTTTTGCAGGG - Intergenic
1109944595 13:69417086-69417108 CATTTCTAGCACTTTTTGCAAGG - Intergenic
1110545823 13:76754242-76754264 CATGTCAACAACTTTTTGTAGGG + Intergenic
1111590124 13:90335499-90335521 TCTCTAGACCACTTTTTGCATGG + Intergenic
1112542569 13:100330083-100330105 CATCTCAACAACTTTTTGCGGGG + Intronic
1112940574 13:104856161-104856183 CATCTTGACAACTTTTTGCAGGG - Intergenic
1113307945 13:109098411-109098433 CACCTCGACAACTTTTTGCAGGG - Intronic
1113478637 13:110603975-110603997 CATCTCGACAACTTTTTGCAGGG - Intergenic
1113557000 13:111244947-111244969 CATCTCGACAACTTTTTGCAGGG - Intronic
1114565508 14:23629512-23629534 TATCTCGACAACTTTTTGCAGGG + Intergenic
1117689742 14:58294355-58294377 CATTGCGACACCTTTTTGCAGGG - Intronic
1118490704 14:66256637-66256659 CATCTCGACAACTTTTTGAAGGG - Intergenic
1120275336 14:82366394-82366416 TATCTCAACAACTTTTTGCAGGG + Intergenic
1121805702 14:96819739-96819761 CATATCAACAAATTTTTGCAGGG - Intronic
1121881497 14:97504745-97504767 TATCTTGAAAACTTTTTGCAGGG - Intergenic
1121999081 14:98631245-98631267 CATCTTGACAACTTTTTGCAGGG - Intergenic
1123486327 15:20742923-20742945 CATCTAGAAAATTTTTTGCAGGG + Intergenic
1123542815 15:21311973-21311995 CATCTAGAAAATTTTTTGCAGGG + Intergenic
1123889326 15:24759956-24759978 CACCTTGACAACTTTTTGCAGGG - Intergenic
1125052380 15:35315244-35315266 CATCTTGACAACCTTTTGCAGGG + Intronic
1126641957 15:50836727-50836749 CATCTGGACAACTTTTTGCGGGG - Intergenic
1126744409 15:51811714-51811736 CATCTGGACAACTGATTGAAGGG + Exonic
1126885385 15:53143581-53143603 CATATCAACAACATTTTGCAGGG - Intergenic
1127769555 15:62220067-62220089 AGCATCGACAACTTTTTGCAGGG + Intergenic
1127945568 15:63747843-63747865 CTTCTAGACAAGTTGTTGCATGG - Exonic
1128625422 15:69197272-69197294 CATCTCAGCAACTTTTTGCAGGG + Intronic
1130849022 15:87775945-87775967 CATCTCAACAACTTTTTTCAGGG + Intergenic
1130854400 15:87828569-87828591 CATCTCGACAACTTTTTGCAGGG + Intergenic
1131329922 15:91487489-91487511 CATCTCAACAACTTTTTGCAGGG - Intergenic
1131770687 15:95734216-95734238 CATCTCAACAGCTTGTTGGAAGG - Intergenic
1202951134 15_KI270727v1_random:39103-39125 CATCTAGAAAATTTTTTGCAGGG + Intergenic
1134243289 16:12521580-12521602 AATCTTCACAAGTTTTTGCAGGG + Intronic
1138834493 16:60417285-60417307 CATCTCGACGACTTTGTGCAGGG - Intergenic
1139074711 16:63430054-63430076 CATCTTGAGAACGTTTTGCAGGG - Intergenic
1143277867 17:5726990-5727012 CATCTCGACAATTTTTTGCAGGG + Intergenic
1144275593 17:13665412-13665434 CATCTAGACAACGTTTTGCAGGG + Intergenic
1144534684 17:16077058-16077080 CATCTCGACAACTTTATGCAGGG + Intronic
1146478961 17:33187339-33187361 CAACTTGACAACTTATTGCAGGG + Intronic
1149167263 17:53767400-53767422 CATCTCGACAACGTTTTGCAGGG - Intergenic
1149218303 17:54385004-54385026 TATCTTGACAACTTTTTACAGGG - Intergenic
1151083907 17:71359501-71359523 CATCCTTACAACTTTTTGAAGGG + Intergenic
1153678192 18:7474547-7474569 CATCTCCACAATTTCTTGCCTGG + Intergenic
1153705241 18:7738332-7738354 CATCTAAACAACTTTCTGCAGGG - Intronic
1154509957 18:15087791-15087813 CATCTCGACAACTTTTTGCAGGG + Intergenic
1155659718 18:28233721-28233743 CATCTCGACAACTTTTTGCAGGG - Intergenic
1155794248 18:30014158-30014180 GATCTTGACAACTTTCTGCAGGG + Intergenic
1157965803 18:52206810-52206832 CTTCTCCACTACTTTTTGGATGG - Intergenic
1159324456 18:66896303-66896325 CATCTCAATAACTTTTTGCAGGG - Intergenic
1159392311 18:67808682-67808704 CATCTCGCCAACTTTTTGCAAGG - Intergenic
1159722993 18:71916500-71916522 CATCTCAACAACTTTTTGCAGGG + Intergenic
1163398290 19:17076541-17076563 CATCTCAACATCTATCTGCACGG - Intronic
1165090115 19:33382231-33382253 CATCCCAACAACTGATTGCAGGG - Exonic
925048388 2:791611-791633 CATCTTGACAACTTTTTGCAGGG - Intergenic
925080978 2:1066232-1066254 CATCTTGACAACGTTTTGCAGGG - Intronic
925182219 2:1824658-1824680 CCTCTCGACAACTCGCTGCACGG - Intronic
926140926 2:10367636-10367658 ACTTTCGACAAATTTTTGCAAGG - Intronic
926487570 2:13481325-13481347 CATCTTGACAACTTTTTGCAGGG - Intergenic
926758625 2:16256520-16256542 CATCTTGACAACTTTTTGCAGGG + Intergenic
927021435 2:19021055-19021077 CATCTCAACCAATTTTTGAAAGG - Intergenic
933542644 2:83667100-83667122 CATCTGGACAACATTTTGCAGGG - Intergenic
935091648 2:99900536-99900558 CATAGCGACAACGTTTTTCAGGG + Intronic
935440356 2:103087554-103087576 CATCATGACAACTTTTTGCAGGG - Intergenic
935541804 2:104357058-104357080 CATCTTGACAACTTTTTGAAGGG + Intergenic
937065001 2:119011300-119011322 CATCTCCACACCTTTTGGCGGGG + Intergenic
937707684 2:124940182-124940204 CATCTTGACAACTTTGTGCGGGG + Intergenic
937748837 2:125448993-125449015 CATCTTGACAACTTCTTGCAGGG - Intergenic
939682267 2:145152313-145152335 CATCTCGACAGATTTTTGCAGGG + Intergenic
939913885 2:148016593-148016615 CATCTCTACAACTTTTTTCAGGG + Intronic
940346528 2:152634610-152634632 CATCTCGACAACTTTTTGCAGGG - Intronic
941990777 2:171554820-171554842 TATCTCTACAACATTTTACATGG - Exonic
944078655 2:195759844-195759866 CATCTCTACAATTTTTTTTAAGG - Intronic
944242229 2:197498153-197498175 CATCTCCAAAACTTTTTATATGG - Intronic
944361683 2:198864573-198864595 CAGCTCAACAACTTTTTTCAGGG + Intergenic
944550839 2:200843406-200843428 CATCTCAACAGCTTTTTGCAGGG - Intergenic
946122616 2:217529730-217529752 AGCCTCCACAACTTTTTGCAAGG - Intronic
948993548 2:241566614-241566636 CAACACGAGAACTTTATGCAGGG - Intronic
1169526079 20:6427310-6427332 CATCTCAGCAACTTTTTGCAGGG - Intergenic
1169841492 20:9943112-9943134 CAGTTGGACAAATTTTTGCAAGG + Intergenic
1169882649 20:10364289-10364311 CATCTTGACAACTTTTTGCAGGG + Intergenic
1170222877 20:13959635-13959657 CATCTTGACAACTTTTTGCAGGG + Intronic
1173722248 20:45269588-45269610 CATCTCAACAATTTTGTTCAAGG - Intergenic
1173760649 20:45557234-45557256 CATCTAAACAACTTTTTGCAGGG + Intronic
1176788113 21:13283988-13284010 CATGTCGACAACTTTTTGCAGGG - Intergenic
1177072328 21:16526252-16526274 CATCTTGACAACTTTTTGCAGGG - Intergenic
1177361594 21:20079037-20079059 CATCTTGACAACTTTTTGCAGGG + Intergenic
1177921408 21:27157068-27157090 CATCTTGACAACTTTTTGCAGGG - Intergenic
1177987254 21:27992192-27992214 CATCTCGACAACTTTTTGCAGGG - Intergenic
1182381708 22:29895479-29895501 CATCTAGAAAATTTTTTGCAGGG - Intronic
1184559098 22:45251236-45251258 CCTTTTGACAACATTTTGCAGGG + Intergenic
949463258 3:4317076-4317098 CATCTCAACAACTTTTTGCAGGG + Exonic
950729498 3:14945285-14945307 CATCTTGACAACTTTTTGCAGGG - Intergenic
953344304 3:42162057-42162079 CATCTGGACATCTTGTTACAAGG - Intronic
955324147 3:57996766-57996788 CATCTCTACAACTACTTGGAAGG - Intergenic
956699438 3:71945904-71945926 CATCTTGACAACTTTTTGCAGGG - Intergenic
957200544 3:77129517-77129539 CATCTCGACAACTTTTTGCAGGG - Intronic
957577384 3:82026988-82027010 CATCTCCACAACATTTTGCAGGG - Intergenic
958110268 3:89133539-89133561 CATCTCCAGAACCTTTTGCAGGG - Intronic
958491099 3:94774607-94774629 TATCTCAACAACTTTTTGCAGGG + Intergenic
958572725 3:95909491-95909513 CATCTTGGCAACTTTTTGCAGGG + Intergenic
958854649 3:99370114-99370136 CATCTCGACAACTTATTGCAGGG - Intergenic
959201229 3:103250449-103250471 CATCTGGACAACTTTTTGTAGGG - Intergenic
960133123 3:114078544-114078566 CATCTCCACATCTGTTTTCATGG + Intronic
961808784 3:129508740-129508762 CATCTCAACAACTTTTTGCAGGG - Intronic
964196087 3:154066490-154066512 CATCTTGACAACATTTTTCAGGG - Intergenic
966112259 3:176417239-176417261 CATTTTCACAACGTTTTGCAGGG - Intergenic
966235635 3:177698829-177698851 CATCTCAACAACTTTTTGCAGGG - Intergenic
970264151 4:14262717-14262739 CATCTTGACAACTTTTTGCAGGG - Intergenic
970285813 4:14513285-14513307 AATCTCGACAACTTTTTTTTAGG + Intergenic
971665864 4:29483882-29483904 CATCGTGACAACTTTTTGCAGGG - Intergenic
971698983 4:29943681-29943703 TATCTCCCCAACTTTCTGCAAGG + Intergenic
972226844 4:37023292-37023314 CATCTCAACAACTTTTTGCAGGG + Intergenic
973059006 4:45695822-45695844 CATCTCGACAACTTTTTGTGGGG + Intergenic
973688787 4:53403597-53403619 CATCTTAAGAACTTTTTGCAGGG - Intronic
974024804 4:56724070-56724092 CAGCTTGATAACTTTTTCCATGG + Intergenic
974248470 4:59354458-59354480 CATCTCGACAACTTTTTACAGGG + Intergenic
974616432 4:64288979-64289001 CATCTGGACAACGTTTTGCAGGG + Intronic
975511327 4:75196410-75196432 CATCTTGACAACTTTTTGCAGGG - Intergenic
976117965 4:81748421-81748443 AAACTCGACATCTTTTTGAATGG + Intronic
977362316 4:96021919-96021941 CATCTTGACAACTTTTTGCAGGG + Intergenic
977537534 4:98272388-98272410 CATCTCGACAACTTTTAGGAGGG - Intronic
978595279 4:110370792-110370814 CATCTCAACAACTTTTTGCAGGG + Intronic
979809270 4:125014973-125014995 CATCTTGACAACTTTTGGTGGGG - Intergenic
980248749 4:130284789-130284811 CATCTCAACAACTTTTTGTAGGG + Intergenic
980764868 4:137288695-137288717 CATCTTAACAACTTTTTGCAGGG + Intergenic
981075834 4:140590659-140590681 CATTTCAATGACTTTTTGCAGGG + Intergenic
981191058 4:141863748-141863770 GATCTCAACAACTTTTTGCAGGG + Intergenic
981285396 4:143012207-143012229 CATCTCGACAGCTTTTTGCAGGG - Intergenic
981824885 4:148928643-148928665 CATCTCAAAAATATTTTGCAGGG + Intergenic
983740111 4:171120213-171120235 CATCTCTAGTACTTTTAGCAAGG - Intergenic
984089822 4:175358945-175358967 CATCTCAACAACTTTTTGCAGGG + Intergenic
984175131 4:176408013-176408035 CCTCTCGACATCTTATTGAAAGG + Intergenic
988044197 5:25927991-25928013 CATAATGACAACTTTTTTCATGG + Intergenic
988156904 5:27465193-27465215 CATATTGACAATGTTTTGCAGGG - Intergenic
990177454 5:53123505-53123527 CATCAAGAGAACTTTTGGCAAGG + Intergenic
990571302 5:57081773-57081795 CATCTCCACAAAATTTTTCATGG + Intergenic
991196540 5:63941035-63941057 CATCTCAACAACTTTTTGCAGGG + Intergenic
991309303 5:65217957-65217979 GATCTCCACAACTTTCTGCTTGG + Intronic
991624887 5:68590418-68590440 CATCTCGACAACTTTTTGCAGGG + Intergenic
992307318 5:75455293-75455315 CATCTTGACAACTTTTTGCAGGG + Intronic
993695422 5:91056019-91056041 CATCTCGACAACTTTTTGCAGGG - Intronic
994432622 5:99687304-99687326 CATTTTGACAACTTTCTGCAGGG + Intergenic
995380443 5:111525982-111526004 CATCTCAACAACTTTTTGCAGGG - Intergenic
995896075 5:117012360-117012382 CATCACAACAACTTTTTGTAGGG + Intergenic
996447137 5:123567985-123568007 CATCTTGACAACCTTTTGCAGGG - Intronic
999258952 5:150226112-150226134 CTTCTTCACAACTTTTTGGAGGG + Intronic
999535247 5:152509613-152509635 CATCTCAGCAACTTTTTGCAGGG - Intergenic
999863371 5:155673668-155673690 GATCTTGACAACATTTTGCAGGG - Intergenic
999964404 5:156793277-156793299 ACTCTCAATAACTTTTTGCAGGG + Intergenic
1000263422 5:159612074-159612096 CATCTTGACAACTTTTTGCAGGG - Intergenic
1000436271 5:161213682-161213704 CATCTCGACAACTTTTTGCAGGG - Intergenic
1001312326 5:170620097-170620119 CATTTTGACAACATATTGCATGG - Intronic
1001735361 5:173994034-173994056 TATCTGGACAACTTTTTGCAAGG - Intronic
1003052536 6:2792915-2792937 CATATGGAAAACATTTTGCATGG - Intergenic
1003344462 6:5254292-5254314 CATCTCGACAACTTTTTGTAGGG + Intronic
1003499951 6:6695669-6695691 CATCTGGACACCTTCCTGCAGGG - Intergenic
1004432652 6:15559847-15559869 CATCTTGACAACTTTTTTGCAGG + Intronic
1004655810 6:17659179-17659201 CATCTCGAAAACTTTTTGCAGGG + Intronic
1008073601 6:47122284-47122306 CATATTGACAACTTTTTGCAGGG - Intergenic
1008875569 6:56322391-56322413 CGTCTCAACAACTTTTTGCAGGG + Intronic
1010398713 6:75423774-75423796 CATCTTGACAACTTTTTGCTGGG + Intronic
1010850223 6:80766132-80766154 CATCTCCACAGCATTTTGCAGGG + Intergenic
1011052260 6:83165648-83165670 CATCTCAGCAACGTTTTGCAGGG - Intronic
1012034119 6:94109804-94109826 CATCTTAAAGACTTTTTGCAGGG - Intergenic
1012842499 6:104346951-104346973 CATCTCAACAACTTTTTGCAGGG + Intergenic
1013104213 6:107012810-107012832 CATCTCAACAACTTTTTGCAGGG + Intergenic
1013572179 6:111439977-111439999 CATCTGGACAACTTTTTGCCAGG + Intronic
1014264004 6:119253514-119253536 CATCGCGACAACTTTTTGCAGGG + Intronic
1014527711 6:122520913-122520935 CATTTCAACAACTTTTTGCAGGG - Intronic
1014792411 6:125688837-125688859 CATCTCAACAGCTTTTTGCAGGG - Intergenic
1014864939 6:126517590-126517612 CATTGCAACAACTTTTTGCAGGG - Intergenic
1014982277 6:127958818-127958840 CATCTCAACAACTTTATGCAGGG + Intergenic
1015412064 6:132904670-132904692 CCACTTGACAACTTTTTTCATGG - Intergenic
1015966641 6:138700896-138700918 CATCTTGACAACTTTTTGTGGGG + Intergenic
1016222051 6:141686267-141686289 CATCTCGGCAATTTTTTGCAGGG - Intergenic
1016451086 6:144182882-144182904 CATCTCATCCACTTGTTGCATGG + Intronic
1016853810 6:148646225-148646247 CATCTCGACAACTTTTTGCAGGG + Intergenic
1017144454 6:151221687-151221709 CGTCTTGACAACTTTTTGCAAGG + Intergenic
1017972299 6:159323413-159323435 CATCTTGACAACTTTTTGCAGGG - Intergenic
1018490775 6:164290313-164290335 CATGTGGACAACCTTTTGCCTGG - Intergenic
1018633316 6:165839372-165839394 CATCTTGACCACTTGTTGAAGGG - Intronic
1021135237 7:16957439-16957461 CATCTCGACAACTTTTTGCAGGG + Intergenic
1021575935 7:22105965-22105987 CATCTCGATAACTTTTTGCAGGG - Intergenic
1024279122 7:47704069-47704091 CATCTCGACAACTTTTTGTAGGG - Intronic
1024383810 7:48728146-48728168 CATCTCAACAACTTTTTGCAGGG - Intergenic
1026240359 7:68568833-68568855 CATCTCAACAACTTTTTGCGGGG + Intergenic
1027548609 7:79562325-79562347 CTTCTTGGCATCTTTTTGCATGG - Intergenic
1028882425 7:95894797-95894819 CATCTCGACAACTTTTTACATGG - Intronic
1029726107 7:102405958-102405980 CACTTTGACAACTTTTTGCAGGG - Intronic
1030763705 7:113382676-113382698 CATCTCGACAACTTTTTGCAGGG + Intergenic
1031255730 7:119445733-119445755 AATCTCGACAGCGTTCTGCAGGG + Intergenic
1031649716 7:124273279-124273301 CATCTCAACAACTTTTTGCAGGG - Intergenic
1033574142 7:142663640-142663662 CATCTTGTCAACTTTTTGCAGGG + Intergenic
1034136914 7:148779437-148779459 CATCTCAAACACTTTTTTCAGGG - Intronic
1036218979 8:6904671-6904693 CATCTGGACAACTTTTTGCAGGG - Intergenic
1038902466 8:31858911-31858933 CATCTTGATAACTTACTGCAGGG + Intronic
1039601129 8:38838522-38838544 CATCTCCAAAACTTCTTGCCGGG - Exonic
1039924017 8:41912716-41912738 CATCTCAACAACTTTTTGCAGGG - Intergenic
1040778741 8:51080210-51080232 CATCTTGACAATTTTTTGCAGGG - Intergenic
1041069726 8:54115601-54115623 CATCTCGACAGTTTTTAGCAGGG - Intergenic
1041213126 8:55572694-55572716 CATCTTGACAACTTTTTGCAGGG - Intergenic
1041219507 8:55634597-55634619 CACCTTGACAACGTTTTGCAGGG - Intergenic
1042513613 8:69636621-69636643 CATCTCGACAACTTTCTGTAGGG - Intronic
1043330443 8:79110758-79110780 CACTTTGACAACTTTTTGCAGGG - Intergenic
1043661786 8:82752281-82752303 CATCTGGGCAACTTTTTGCAGGG + Intergenic
1044174701 8:89105049-89105071 CATCTCCACAACTTTTTGCAGGG + Intergenic
1044438469 8:92194091-92194113 CACCTCCACAACATTTTGCAGGG - Intergenic
1044945683 8:97386773-97386795 CATCTCAAGAACCTTTAGCAGGG - Intergenic
1046510612 8:115197633-115197655 CACCTGGACAATGTTTTGCAGGG + Intergenic
1046992005 8:120468506-120468528 CATCTCAACAACTTTTTGCAGGG - Intronic
1047599869 8:126415306-126415328 CATCTTGACAACTTTTTGCAGGG - Intergenic
1047659811 8:127020824-127020846 TATCTCAACAACTTTTTGCAGGG + Intergenic
1048099808 8:131338661-131338683 CATCTCAACAACTTTTTGCTGGG + Intergenic
1048413979 8:134205872-134205894 CATCCCAACAACTTTTTGCAGGG - Intergenic
1050462549 9:5889319-5889341 CATCTTAACAACTTTTTGCAGGG + Intronic
1050952143 9:11611073-11611095 CATCTCGACAACTTTTTGCAGGG - Intergenic
1051042563 9:12830268-12830290 CATCTCGACAACTTTTTGCAGGG - Intergenic
1051119717 9:13738735-13738757 TATCTCAACAACTTTGTCCAGGG - Intergenic
1051573849 9:18591865-18591887 CATCTCGATAACTTTTTGCAGGG - Intronic
1051965336 9:22821600-22821622 TATTTCGACAATTTTTTGCAGGG + Intergenic
1052139935 9:24968430-24968452 CATCTCAACAACTTTTTACAGGG - Intergenic
1052886596 9:33655080-33655102 CATCTTGTCAACTTTTTGCAGGG + Intergenic
1055167113 9:73210390-73210412 CATCTCAACATCTTTTTGAAGGG + Intergenic
1055198238 9:73623656-73623678 GATCTCGACAATTTTTTGCAGGG + Intergenic
1055736114 9:79332877-79332899 CATTTGGACAACTCTTTGCTTGG - Intergenic
1056140225 9:83670901-83670923 CATCTGTACAAGTTTTTTCATGG + Intronic
1056144221 9:83713359-83713381 CATCTTGACAACTTTTTGCAGGG + Intergenic
1056173423 9:84010590-84010612 CATCTCGACAACTTTTTGCAGGG - Intergenic
1056941044 9:90956565-90956587 CATCTTAACAACTTTTTGCAGGG - Intergenic
1059026164 9:110633524-110633546 CACCTTGACAACTTTTTGCAGGG + Intergenic
1059686305 9:116640164-116640186 AGTCTCCACAACTTTTTGCAAGG + Intronic
1187593780 X:20747828-20747850 AAACTCCAAAACTTTTTGCAAGG - Intergenic
1188294111 X:28425009-28425031 CATCTCAGCAACTTTTTGCAGGG + Intergenic
1188471291 X:30542552-30542574 CATCTCAACAACTTTTTTTGCGG + Intergenic
1188596899 X:31912419-31912441 CATCTCGACAACTTTTTACAGGG + Intronic
1189416565 X:40820063-40820085 CATCTCAACAACTTTTGGCAGGG + Intergenic
1189737302 X:44084774-44084796 CATCCCTATAACTTTTTGCATGG - Intergenic
1189876381 X:45440736-45440758 CATCTCTACTGCTTCTTGCAGGG - Intergenic
1191008943 X:55740544-55740566 CATCTCGACAACCTTTTGCAGGG - Intronic
1192957435 X:76087747-76087769 CATCTCGACAACTTTTTGCAGGG + Intergenic
1193024198 X:76826828-76826850 CATCTCGACAGCTTTTGGCAGGG - Intergenic
1193124824 X:77859967-77859989 CATCACATCAACTTTTGGCAAGG - Intronic
1193317672 X:80082677-80082699 GATTTTGACAAATTTTTGCATGG + Intergenic
1193829958 X:86278380-86278402 CATCTTGACCACTTTTTGCGGGG + Intronic
1194036040 X:88873660-88873682 CATGTCAACAACTATTTGCAGGG + Intergenic
1194213103 X:91092784-91092806 CATCTGGACACTTTTTTGTAGGG + Intergenic
1194334911 X:92633631-92633653 CATCTCGACAACTTTTTGCATGG - Intergenic
1194388717 X:93289464-93289486 CATCTCAACAACTTTTTGCAGGG - Intergenic
1194452118 X:94057097-94057119 CACCTTGACAACTTTATGGATGG + Intergenic
1194528903 X:95019023-95019045 CATCTCGACAACTTTTTGTAGGG - Intergenic
1196515225 X:116603221-116603243 CACCTCAACAACTTTTTGCAAGG - Intergenic
1197015234 X:121617192-121617214 AATCTCAACTACCTTTTGCAGGG - Intergenic
1197361364 X:125507599-125507621 CATCTCGACAACTTTTTGCAGGG - Intergenic
1198317271 X:135480707-135480729 CATCTCGACAACTTTTTGCAGGG - Intergenic
1198844294 X:140893469-140893491 CATCTCGACAACTTTTTGCAGGG + Intergenic
1198949839 X:142058120-142058142 CATCTTGTCAACTTTTGGCATGG + Intergenic
1198949918 X:142058642-142058664 CATCTGGTCAACCTTATGCACGG + Intergenic
1200643389 Y:5750682-5750704 CATCTCGACAACTTTTTGCATGG - Intergenic