ID: 1093999995

View in Genome Browser
Species Human (GRCh38)
Location 12:25684621-25684643
Sequence GCATCTCGACAACTTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 24, 1: 86, 2: 79, 3: 58, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093999995_1093999998 0 Left 1093999995 12:25684621-25684643 CCTGCAAAAAGTTGTCGAGATGC 0: 24
1: 86
2: 79
3: 58
4: 77
Right 1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG No data
1093999995_1093999997 -4 Left 1093999995 12:25684621-25684643 CCTGCAAAAAGTTGTCGAGATGC 0: 24
1: 86
2: 79
3: 58
4: 77
Right 1093999997 12:25684640-25684662 ATGCTTGAAGAATTGGTAGTTGG No data
1093999995_1094000001 30 Left 1093999995 12:25684621-25684643 CCTGCAAAAAGTTGTCGAGATGC 0: 24
1: 86
2: 79
3: 58
4: 77
Right 1094000001 12:25684674-25684696 TCAGGTGAATATGACAGATGAGG No data
1093999995_1094000000 12 Left 1093999995 12:25684621-25684643 CCTGCAAAAAGTTGTCGAGATGC 0: 24
1: 86
2: 79
3: 58
4: 77
Right 1094000000 12:25684656-25684678 TAGTTGGTTGGCGAGTGGTCAGG No data
1093999995_1093999999 7 Left 1093999995 12:25684621-25684643 CCTGCAAAAAGTTGTCGAGATGC 0: 24
1: 86
2: 79
3: 58
4: 77
Right 1093999999 12:25684651-25684673 ATTGGTAGTTGGTTGGCGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093999995 Original CRISPR GCATCTCGACAACTTTTTGC AGG (reversed) Intergenic
901147394 1:7075174-7075196 GACTCCCGACCACTTTTTGCAGG - Intronic
902061042 1:13643087-13643109 ACATCTCGACAACGTTTTGCAGG - Intergenic
904943649 1:34182875-34182897 GCTTCTCTACACCCTTTTGCCGG - Intronic
905854858 1:41303082-41303104 ACATCTCAACAACGTTTTGCAGG - Intergenic
906367738 1:45224788-45224810 GTATGTCGACAACTTTTTGCAGG + Intronic
908884453 1:68772014-68772036 GCATCTCAACAACTTATTGCAGG - Intergenic
909133170 1:71765321-71765343 ACATCTCAACAACTTTTTGCAGG + Intronic
909299390 1:73992503-73992525 GCATCTCAACAACTTTTTGCAGG + Intergenic
909902347 1:81153584-81153606 GCATTTCGACAACTTTTTGCAGG + Intergenic
910800842 1:91144198-91144220 GCATCTTGACAACTTTTCACAGG - Intergenic
910986427 1:93009220-93009242 GCATCTCAACAACTTTTTTCAGG - Intergenic
911997523 1:104786191-104786213 GCGTCTCAACAACTTTTTTCAGG - Intergenic
912023092 1:105131583-105131605 GCATCGCAATAACTTTTTGCAGG - Intergenic
912152590 1:106878658-106878680 GCATCTCCATTACTTTTTGCAGG + Intergenic
913215172 1:116614023-116614045 GCTTCTCGCCAACTTTCTGCCGG + Exonic
914452844 1:147808090-147808112 GCATTTTGACAACTTTTTGCAGG - Intergenic
915032783 1:152897987-152898009 GCATCTTGACAACATTTTGCAGG - Intergenic
915388100 1:155515327-155515349 GCATCTCAACAATTTTTTGCAGG + Intronic
915781724 1:158559266-158559288 GCATCTTGACAACTTTTTGCTGG + Intergenic
918490980 1:185081295-185081317 GCATCTTGACAACTTTTTGCAGG - Intronic
918821244 1:189257480-189257502 ACATCTCCACTACTTTTTGGGGG + Intergenic
919274661 1:195398077-195398099 ACATCTCAACAACTTTTTGCAGG - Intergenic
921057122 1:211551210-211551232 GCATCTTGACAACTTTTTGCAGG + Intergenic
921679833 1:218018027-218018049 GCATCTCAACAACTTTTTTCAGG + Intergenic
921750499 1:218787336-218787358 GCATCTCAACAACTTTTTGCAGG - Intergenic
921776606 1:219107860-219107882 GCATCTCTAAAACATTTTGCAGG + Intergenic
922174287 1:223183867-223183889 GCATCTCAACAAGTTTTTGCAGG - Intergenic
924773173 1:247094486-247094508 GCATCTTGACAACTTTTTGCAGG + Intergenic
1063548911 10:7009876-7009898 GCATCTCAACAACTTTTTGCAGG + Intergenic
1064330534 10:14389947-14389969 ACACTTTGACAACTTTTTGCAGG + Intronic
1064506569 10:16036947-16036969 GCCTCTCAACAACTTTTGGGTGG + Intergenic
1067574405 10:47400028-47400050 GCATCTCGACAACTTTTTGCAGG + Intergenic
1068316674 10:55353130-55353152 GCATCTCTACAACTTTTTGCAGG + Intronic
1069180520 10:65352805-65352827 GCATCTTGACAACATTTTGCAGG - Intergenic
1069520425 10:69115514-69115536 GCATCTCGGCAACTTTTTGCAGG + Intergenic
1071389496 10:85157182-85157204 GCATCTCAAAAACTTTTTGCAGG + Intergenic
1071737196 10:88314516-88314538 GCAGCTGGAAAACATTTTGCCGG - Exonic
1072042278 10:91619455-91619477 AGCACTCGACAACTTTTTGCAGG - Intergenic
1072116317 10:92373579-92373601 AAATCTCCACAACTTCTTGCTGG + Intergenic
1074444619 10:113509873-113509895 GCATTTTGACAACTTTTTGCGGG + Intergenic
1074981931 10:118626909-118626931 GGGTCTCGACAGCTTTTTGGGGG + Intergenic
1076205253 10:128593751-128593773 GCATCTCAGCAACTTTTTGGAGG - Intergenic
1078283689 11:9929749-9929771 GCATCTCAACAACTTTTTGCAGG + Intronic
1078908929 11:15712994-15713016 GCATCTCTACAGCATTATGCAGG - Intergenic
1079854572 11:25586073-25586095 GCCTCTCAACAACTTTTTATAGG - Intergenic
1081109202 11:39112047-39112069 ACATCTTGACAACTTTTTGCAGG + Intergenic
1082700934 11:56429565-56429587 GAATCTCGACAACTTTTTGCAGG + Intergenic
1082732608 11:56818494-56818516 ACATCTTGACAACTTTTCGCAGG + Intergenic
1083408718 11:62477108-62477130 GCATCTCGACAACTTTTTGCAGG + Intronic
1083504483 11:63142953-63142975 GTATCTCAACAACATTTTGTAGG + Intronic
1086436750 11:86788973-86788995 GGATCTCGACAGCCTTTTGCAGG - Intergenic
1087564068 11:99831303-99831325 GCATCTCAACAACTTTTTGCAGG - Intronic
1087686755 11:101273895-101273917 GCATCTCCACAACTCTCTGTGGG - Intergenic
1087882291 11:103431751-103431773 GCATCTCAACAACATTTTGCAGG - Intronic
1093356125 12:18170178-18170200 GTATCTCGACAAGTTTTTGCAGG - Intronic
1093999995 12:25684621-25684643 GCATCTCGACAACTTTTTGCAGG - Intergenic
1094245811 12:28291241-28291263 GCATCTCAACAACTTTTTCAGGG - Intronic
1094554545 12:31485310-31485332 GCATCTCGACAATTTTTTGCAGG + Intronic
1095193848 12:39289483-39289505 GCATCTCGAAAAGTTTTTGCAGG + Intergenic
1097796281 12:63865563-63865585 GTATCTCAATGACTTTTTGCAGG - Intronic
1097846914 12:64376249-64376271 GCATCTTGACAACTTTTGGCAGG + Intronic
1098137902 12:67421959-67421981 GCATCTCAACAACTTTTTGCAGG + Intergenic
1098736041 12:74106822-74106844 GCTTCTCAGCAACTTTTTGCAGG - Intergenic
1099785508 12:87257264-87257286 GCATCTCAACAACTTTTTGCAGG - Intergenic
1099915415 12:88886366-88886388 GCATCTCAATAGCCTTTTGCAGG - Intergenic
1100179723 12:92072385-92072407 GCATGTCAACAACTTTTAGGGGG - Intronic
1100413638 12:94348926-94348948 GCATCTCAACAACTTTTTGCAGG + Intronic
1100527701 12:95435306-95435328 GCATCTCGAGAACTTTTTGCAGG + Intergenic
1101275911 12:103201003-103201025 GCACCTTGACAACTTTTTGCAGG - Intergenic
1102413999 12:112744624-112744646 TCATCTCATCAACTCTTTGCAGG + Intronic
1103978276 12:124718383-124718405 GCATCTCGACAACTTTTTGCAGG + Intergenic
1105807986 13:23969071-23969093 GCATCTTGACAACTCTTTGCAGG + Intergenic
1106449959 13:29871977-29871999 GCATTTCAACAACTTTTTGCAGG + Intergenic
1106961418 13:35002832-35002854 GCATCTCGGCAACTTTTTGTGGG - Intronic
1107103151 13:36615693-36615715 GCATCTCGACAACTTTTTGCAGG - Intergenic
1107187638 13:37543376-37543398 GCATCCCGACAACTTTTTGCAGG - Intergenic
1107531827 13:41289931-41289953 GTATCTCAACAACTTTTTGCAGG + Intergenic
1109688348 13:65850376-65850398 GCATCTCAATAACTTTTTGCAGG - Intergenic
1110545822 13:76754241-76754263 GCATGTCAACAACTTTTTGTAGG + Intergenic
1112542568 13:100330082-100330104 GCATCTCAACAACTTTTTGCGGG + Intronic
1112843557 13:103609508-103609530 GCATCTCAACACATTTTTGATGG + Intergenic
1112940575 13:104856162-104856184 ACATCTTGACAACTTTTTGCAGG - Intergenic
1113307946 13:109098412-109098434 GCACCTCGACAACTTTTTGCAGG - Intronic
1113478638 13:110603976-110603998 GCATCTCGACAACTTTTTGCAGG - Intergenic
1113557001 13:111244948-111244970 GCATCTCGACAACTTTTTGCAGG - Intronic
1113722533 13:112570575-112570597 GCAAGTCGAAATCTTTTTGCTGG + Intronic
1113740315 13:112708144-112708166 GCATCTCGACAACTTTTACAGGG + Intronic
1114565507 14:23629511-23629533 GTATCTCGACAACTTTTTGCAGG + Intergenic
1117057540 14:51928409-51928431 GCCTCTAGAAAACTATTTGCTGG - Intronic
1117689743 14:58294356-58294378 GCATTGCGACACCTTTTTGCAGG - Intronic
1118490705 14:66256638-66256660 GCATCTCGACAACTTTTTGAAGG - Intergenic
1120275335 14:82366393-82366415 ATATCTCAACAACTTTTTGCAGG + Intergenic
1121805703 14:96819740-96819762 GCATATCAACAAATTTTTGCAGG - Intronic
1121881498 14:97504746-97504768 ATATCTTGAAAACTTTTTGCAGG - Intergenic
1121999082 14:98631246-98631268 GCATCTTGACAACTTTTTGCAGG - Intergenic
1123486326 15:20742922-20742944 GCATCTAGAAAATTTTTTGCAGG + Intergenic
1123542814 15:21311972-21311994 GCATCTAGAAAATTTTTTGCAGG + Intergenic
1123889327 15:24759957-24759979 GCACCTTGACAACTTTTTGCAGG - Intergenic
1125052379 15:35315243-35315265 ACATCTTGACAACCTTTTGCAGG + Intronic
1126641958 15:50836728-50836750 GCATCTGGACAACTTTTTGCGGG - Intergenic
1126885386 15:53143582-53143604 GCATATCAACAACATTTTGCAGG - Intergenic
1128625421 15:69197271-69197293 GCATCTCAGCAACTTTTTGCAGG + Intronic
1130849021 15:87775944-87775966 GCATCTCAACAACTTTTTTCAGG + Intergenic
1130854399 15:87828568-87828590 GCATCTCGACAACTTTTTGCAGG + Intergenic
1131329923 15:91487490-91487512 GCATCTCAACAACTTTTTGCAGG - Intergenic
1131636788 15:94241495-94241517 GCCTGTCGATATCTTTTTGCTGG + Intronic
1202951133 15_KI270727v1_random:39102-39124 GCATCTAGAAAATTTTTTGCAGG + Intergenic
1137736467 16:50727584-50727606 GAATCTTGACAACTTTCTGCAGG - Intronic
1138834494 16:60417286-60417308 GCATCTCGACGACTTTGTGCAGG - Intergenic
1139074712 16:63430055-63430077 GCATCTTGAGAACGTTTTGCAGG - Intergenic
1143277866 17:5726989-5727011 GCATCTCGACAATTTTTTGCAGG + Intergenic
1144275592 17:13665411-13665433 GCATCTAGACAACGTTTTGCAGG + Intergenic
1144534683 17:16077057-16077079 GCATCTCGACAACTTTATGCAGG + Intronic
1146478960 17:33187338-33187360 GCAACTTGACAACTTATTGCAGG + Intronic
1149167264 17:53767401-53767423 GCATCTCGACAACGTTTTGCAGG - Intergenic
1149218304 17:54385005-54385027 GTATCTTGACAACTTTTTACAGG - Intergenic
1152564518 17:81094184-81094206 GCATCTTGCCAACCCTTTGCTGG + Intronic
1152979137 18:256960-256982 GCAAGTCGTCATCTTTTTGCTGG - Intronic
1153705242 18:7738333-7738355 GCATCTAAACAACTTTCTGCAGG - Intronic
1154509956 18:15087790-15087812 GCATCTCGACAACTTTTTGCAGG + Intergenic
1155659719 18:28233722-28233744 GCATCTCGACAACTTTTTGCAGG - Intergenic
1155794247 18:30014157-30014179 GGATCTTGACAACTTTCTGCAGG + Intergenic
1159324457 18:66896304-66896326 GCATCTCAATAACTTTTTGCAGG - Intergenic
1159722992 18:71916499-71916521 GCATCTCAACAACTTTTTGCAGG + Intergenic
1164582599 19:29443655-29443677 GAATCTCAAAAACATTTTGCTGG - Intergenic
1165090116 19:33382232-33382254 GCATCCCAACAACTGATTGCAGG - Exonic
1167947967 19:53004487-53004509 GCATCCCAACAATGTTTTGCTGG + Intergenic
925048389 2:791612-791634 GCATCTTGACAACTTTTTGCAGG - Intergenic
925080979 2:1066233-1066255 CCATCTTGACAACGTTTTGCAGG - Intronic
926487571 2:13481326-13481348 GCATCTTGACAACTTTTTGCAGG - Intergenic
926758624 2:16256519-16256541 GCATCTTGACAACTTTTTGCAGG + Intergenic
928370258 2:30735414-30735436 GCAGCTGGACAGCTTTTTGGGGG + Intronic
933542645 2:83667101-83667123 GCATCTGGACAACATTTTGCAGG - Intergenic
934869920 2:97854196-97854218 GCAAGTCGTCATCTTTTTGCTGG - Intronic
934887274 2:98035827-98035849 GCATCTCAAAAACATTATGCTGG + Intergenic
935440357 2:103087555-103087577 GCATCATGACAACTTTTTGCAGG - Intergenic
935541803 2:104357057-104357079 GCATCTTGACAACTTTTTGAAGG + Intergenic
936774449 2:115955940-115955962 GCATCTTGAAAACTTTTGGCAGG - Intergenic
937065000 2:119011299-119011321 ACATCTCCACACCTTTTGGCGGG + Intergenic
937707683 2:124940181-124940203 GCATCTTGACAACTTTGTGCGGG + Intergenic
937748838 2:125448994-125449016 GCATCTTGACAACTTCTTGCAGG - Intergenic
938038343 2:128054846-128054868 GCATCTTGACAACTTTTTGCAGG + Intergenic
938654539 2:133417514-133417536 GCACCTCGACAGCTCTCTGCTGG - Intronic
939682266 2:145152312-145152334 TCATCTCGACAGATTTTTGCAGG + Intergenic
939913884 2:148016592-148016614 GCATCTCTACAACTTTTTTCAGG + Intronic
940346529 2:152634611-152634633 GCATCTCGACAACTTTTTGCAGG - Intronic
944361682 2:198864572-198864594 GCAGCTCAACAACTTTTTTCAGG + Intergenic
944550840 2:200843407-200843429 GCATCTCAACAGCTTTTTGCAGG - Intergenic
947078838 2:226373135-226373157 TCATCTCCACATCTCTTTGCAGG + Intergenic
947654435 2:231814203-231814225 GCATGTCGTAATCTTTTTGCTGG + Intergenic
948993549 2:241566615-241566637 GCAACACGAGAACTTTATGCAGG - Intronic
1169526080 20:6427311-6427333 GCATCTCAGCAACTTTTTGCAGG - Intergenic
1169730740 20:8783130-8783152 ACATCTCAATTACTTTTTGCTGG - Intronic
1169882648 20:10364288-10364310 GCATCTTGACAACTTTTTGCAGG + Intergenic
1170222876 20:13959634-13959656 ACATCTTGACAACTTTTTGCAGG + Intronic
1173760648 20:45557233-45557255 GCATCTAAACAACTTTTTGCAGG + Intronic
1174838508 20:53880057-53880079 GCTTCTTGAGAACTTTCTGCTGG + Intergenic
1176788114 21:13283989-13284011 GCATGTCGACAACTTTTTGCAGG - Intergenic
1177072329 21:16526253-16526275 GCATCTTGACAACTTTTTGCAGG - Intergenic
1177361593 21:20079036-20079058 GCATCTTGACAACTTTTTGCAGG + Intergenic
1177921409 21:27157069-27157091 GCATCTTGACAACTTTTTGCAGG - Intergenic
1177987255 21:27992193-27992215 GCATCTCGACAACTTTTTGCAGG - Intergenic
1182138031 22:27924575-27924597 GCATCTTGACAGCTTTTTGCAGG + Intergenic
1182381709 22:29895480-29895502 ACATCTAGAAAATTTTTTGCAGG - Intronic
949463257 3:4317075-4317097 GCATCTCAACAACTTTTTGCAGG + Exonic
950729499 3:14945286-14945308 GCATCTTGACAACTTTTTGCAGG - Intergenic
951981517 3:28572243-28572265 GCATTTTGACAACATTTTCCTGG + Intergenic
952985804 3:38781565-38781587 GCATCTGAACAACTTTTTGCAGG + Intronic
956699439 3:71945905-71945927 GCATCTTGACAACTTTTTGCAGG - Intergenic
956847601 3:73197587-73197609 GAATCTCGACTACCTTGTGCAGG + Intergenic
957200545 3:77129518-77129540 GCATCTCGACAACTTTTTGCAGG - Intronic
957577385 3:82026989-82027011 GCATCTCCACAACATTTTGCAGG - Intergenic
958110269 3:89133540-89133562 GCATCTCCAGAACCTTTTGCAGG - Intronic
958491098 3:94774606-94774628 GTATCTCAACAACTTTTTGCAGG + Intergenic
958572724 3:95909490-95909512 GCATCTTGGCAACTTTTTGCAGG + Intergenic
958854650 3:99370115-99370137 GCATCTCGACAACTTATTGCAGG - Intergenic
959201230 3:103250450-103250472 CCATCTGGACAACTTTTTGTAGG - Intergenic
959964652 3:112339563-112339585 GGATCTCAACAACTACTTGCAGG - Intronic
961808785 3:129508741-129508763 CCATCTCAACAACTTTTTGCAGG - Intronic
964196088 3:154066491-154066513 GCATCTTGACAACATTTTTCAGG - Intergenic
966112260 3:176417240-176417262 GCATTTTCACAACGTTTTGCAGG - Intergenic
966235636 3:177698830-177698852 GCATCTCAACAACTTTTTGCAGG - Intergenic
970264152 4:14262718-14262740 GCATCTTGACAACTTTTTGCAGG - Intergenic
971665865 4:29483883-29483905 GCATCGTGACAACTTTTTGCAGG - Intergenic
972226843 4:37023291-37023313 GCATCTCAACAACTTTTTGCAGG + Intergenic
973059005 4:45695821-45695843 GCATCTCGACAACTTTTTGTGGG + Intergenic
973688788 4:53403598-53403620 GCATCTTAAGAACTTTTTGCAGG - Intronic
974248469 4:59354457-59354479 GCATCTCGACAACTTTTTACAGG + Intergenic
974616431 4:64288978-64289000 GCATCTGGACAACGTTTTGCAGG + Intronic
975511328 4:75196411-75196433 GCATCTTGACAACTTTTTGCAGG - Intergenic
977362315 4:96021918-96021940 GCATCTTGACAACTTTTTGCAGG + Intergenic
977537535 4:98272389-98272411 GCATCTCGACAACTTTTAGGAGG - Intronic
978075075 4:104518576-104518598 GCATCTCCACAACTTTTTGCAGG - Intergenic
978436388 4:108689227-108689249 GCATCCTCACAACTTCTTGCTGG - Intergenic
978595278 4:110370791-110370813 GCATCTCAACAACTTTTTGCAGG + Intronic
979809271 4:125014974-125014996 GCATCTTGACAACTTTTGGTGGG - Intergenic
980248748 4:130284788-130284810 CCATCTCAACAACTTTTTGTAGG + Intergenic
980764867 4:137288694-137288716 GCATCTTAACAACTTTTTGCAGG + Intergenic
981075833 4:140590658-140590680 GCATTTCAATGACTTTTTGCAGG + Intergenic
981191057 4:141863747-141863769 GGATCTCAACAACTTTTTGCAGG + Intergenic
981285397 4:143012208-143012230 GCATCTCGACAGCTTTTTGCAGG - Intergenic
981314634 4:143330139-143330161 GTATCTTGACAACTACTTGCAGG + Intergenic
981824884 4:148928642-148928664 GCATCTCAAAAATATTTTGCAGG + Intergenic
984089821 4:175358944-175358966 GCATCTCAACAACTTTTTGCAGG + Intergenic
986460381 5:7964327-7964349 GCATCTTGACGATTTTTTGCAGG - Intergenic
988156905 5:27465194-27465216 GCATATTGACAATGTTTTGCAGG - Intergenic
991196539 5:63941034-63941056 ACATCTCAACAACTTTTTGCAGG + Intergenic
991624886 5:68590417-68590439 GCATCTCGACAACTTTTTGCAGG + Intergenic
992244037 5:74799443-74799465 GCATCCCAACAATGTTTTGCTGG + Intronic
992307317 5:75455292-75455314 GCATCTTGACAACTTTTTGCAGG + Intronic
993256329 5:85594579-85594601 GCACCTTCACAACTTTTTGCAGG + Intergenic
993695423 5:91056020-91056042 GCATCTCGACAACTTTTTGCAGG - Intronic
994432621 5:99687303-99687325 ACATTTTGACAACTTTCTGCAGG + Intergenic
995220981 5:109647533-109647555 CCATCTGGACCACTGTTTGCAGG + Intergenic
995380444 5:111525983-111526005 GCATCTCAACAACTTTTTGCAGG - Intergenic
995896074 5:117012359-117012381 GCATCACAACAACTTTTTGTAGG + Intergenic
995906735 5:117133455-117133477 GCATCTGGATAAATGTTTGCTGG + Intergenic
996447138 5:123567986-123568008 GCATCTTGACAACCTTTTGCAGG - Intronic
999535248 5:152509614-152509636 GCATCTCAGCAACTTTTTGCAGG - Intergenic
999863372 5:155673669-155673691 GGATCTTGACAACATTTTGCAGG - Intergenic
1000263423 5:159612075-159612097 GCATCTTGACAACTTTTTGCAGG - Intergenic
1000436272 5:161213683-161213705 GCATCTCGACAACTTTTTGCAGG - Intergenic
1000701095 5:164451492-164451514 GTATCGCGACAACTTTTGTCAGG - Intergenic
1003344461 6:5254291-5254313 GCATCTCGACAACTTTTTGTAGG + Intronic
1003419562 6:5944388-5944410 GCACCTCAACAACTTTGTGCAGG - Intergenic
1003499952 6:6695670-6695692 GCATCTGGACACCTTCCTGCAGG - Intergenic
1004655809 6:17659178-17659200 GCATCTCGAAAACTTTTTGCAGG + Intronic
1005586615 6:27282880-27282902 ACATCTCCACAACTTTTTGCAGG - Intergenic
1008073602 6:47122285-47122307 GCATATTGACAACTTTTTGCAGG - Intergenic
1008875568 6:56322390-56322412 GCGTCTCAACAACTTTTTGCAGG + Intronic
1010398712 6:75423773-75423795 GCATCTTGACAACTTTTTGCTGG + Intronic
1010850222 6:80766131-80766153 GCATCTCCACAGCATTTTGCAGG + Intergenic
1011052261 6:83165649-83165671 GCATCTCAGCAACGTTTTGCAGG - Intronic
1012034120 6:94109805-94109827 GCATCTTAAAGACTTTTTGCAGG - Intergenic
1012842498 6:104346950-104346972 GCATCTCAACAACTTTTTGCAGG + Intergenic
1013104212 6:107012809-107012831 GCATCTCAACAACTTTTTGCAGG + Intergenic
1014057313 6:117031316-117031338 GCATCTTGACAACTTTTTGCAGG + Intergenic
1014264003 6:119253513-119253535 GCATCGCGACAACTTTTTGCAGG + Intronic
1014527712 6:122520914-122520936 GCATTTCAACAACTTTTTGCAGG - Intronic
1014792412 6:125688838-125688860 GCATCTCAACAGCTTTTTGCAGG - Intergenic
1014864940 6:126517591-126517613 GCATTGCAACAACTTTTTGCAGG - Intergenic
1014982276 6:127958817-127958839 ACATCTCAACAACTTTATGCAGG + Intergenic
1015966640 6:138700895-138700917 GCATCTTGACAACTTTTTGTGGG + Intergenic
1016222052 6:141686268-141686290 GCATCTCGGCAATTTTTTGCAGG - Intergenic
1016853809 6:148646224-148646246 GCATCTCGACAACTTTTTGCAGG + Intergenic
1017972300 6:159323414-159323436 GCATCTTGACAACTTTTTGCAGG - Intergenic
1021135236 7:16957438-16957460 GCATCTCGACAACTTTTTGCAGG + Intergenic
1021247134 7:18277356-18277378 CCATCTCGTCTCCTTTTTGCTGG - Intronic
1021575936 7:22105966-22105988 GCATCTCGATAACTTTTTGCAGG - Intergenic
1024279123 7:47704070-47704092 GCATCTCGACAACTTTTTGTAGG - Intronic
1024383811 7:48728147-48728169 GCATCTCAACAACTTTTTGCAGG - Intergenic
1024628287 7:51227171-51227193 GCGTCTCTACAACTGTGTGCTGG - Intronic
1026240358 7:68568832-68568854 GCATCTCAACAACTTTTTGCGGG + Intergenic
1029266812 7:99348909-99348931 GCATCCCAACAACGTTTTGCTGG + Exonic
1029609886 7:101621261-101621283 GCATCCCGGCCACTTTTTGCTGG + Intronic
1029726108 7:102405959-102405981 GCACTTTGACAACTTTTTGCAGG - Intronic
1030495424 7:110293040-110293062 GCATCTCAACAACTTTTGTGGGG - Intergenic
1030763704 7:113382675-113382697 GCATCTCGACAACTTTTTGCAGG + Intergenic
1030792956 7:113751748-113751770 GCATTTGGGCAACTGTTTGCAGG + Intergenic
1031649717 7:124273280-124273302 GCATCTCAACAACTTTTTGCAGG - Intergenic
1033574141 7:142663639-142663661 GCATCTTGTCAACTTTTTGCAGG + Intergenic
1033712491 7:143962619-143962641 ACATCTCTACAACTTTGTACAGG - Intergenic
1035327615 7:158075174-158075196 GCATTTTGACAAGTGTTTGCAGG - Intronic
1035554085 8:552377-552399 GCACCTTGACAACTTTTTCTGGG + Intergenic
1036218980 8:6904672-6904694 GCATCTGGACAACTTTTTGCAGG - Intergenic
1036510802 8:9398355-9398377 GCAACTCTACAACCTCTTGCTGG - Intergenic
1038582064 8:28756387-28756409 GCATCTCCAAAACGTTATGCTGG - Intergenic
1038902465 8:31858910-31858932 GCATCTTGATAACTTACTGCAGG + Intronic
1039601130 8:38838523-38838545 TCATCTCCAAAACTTCTTGCCGG - Exonic
1039924018 8:41912717-41912739 GCATCTCAACAACTTTTTGCAGG - Intergenic
1040778742 8:51080211-51080233 GCATCTTGACAATTTTTTGCAGG - Intergenic
1041069727 8:54115602-54115624 GCATCTCGACAGTTTTTAGCAGG - Intergenic
1041213127 8:55572695-55572717 GCATCTTGACAACTTTTTGCAGG - Intergenic
1041219508 8:55634598-55634620 GCACCTTGACAACGTTTTGCAGG - Intergenic
1041963442 8:63647056-63647078 GGAACTCTACAACTATTTGCTGG - Intergenic
1042513614 8:69636622-69636644 GCATCTCGACAACTTTCTGTAGG - Intronic
1043074670 8:75683219-75683241 GCATCTCTAATACTTTTTGAAGG + Intergenic
1043330444 8:79110759-79110781 ACACTTTGACAACTTTTTGCAGG - Intergenic
1043661785 8:82752280-82752302 GCATCTGGGCAACTTTTTGCAGG + Intergenic
1044174700 8:89105048-89105070 GCATCTCCACAACTTTTTGCAGG + Intergenic
1044438470 8:92194092-92194114 GCACCTCCACAACATTTTGCAGG - Intergenic
1045767990 8:105698947-105698969 GCATCTTGCCAACCTTTTCCAGG - Intronic
1046992006 8:120468507-120468529 GCATCTCAACAACTTTTTGCAGG - Intronic
1047599870 8:126415307-126415329 GCATCTTGACAACTTTTTGCAGG - Intergenic
1047659810 8:127020823-127020845 GTATCTCAACAACTTTTTGCAGG + Intergenic
1048099807 8:131338660-131338682 GCATCTCAACAACTTTTTGCTGG + Intergenic
1048413980 8:134205873-134205895 GCATCCCAACAACTTTTTGCAGG - Intergenic
1048524929 8:135193747-135193769 GCTTCTCAACAGCTCTTTGCTGG + Intergenic
1050206422 9:3201048-3201070 GCATCAAGACAACTATGTGCTGG - Intergenic
1050462548 9:5889318-5889340 TCATCTTAACAACTTTTTGCAGG + Intronic
1050952144 9:11611074-11611096 GCATCTCGACAACTTTTTGCAGG - Intergenic
1051042564 9:12830269-12830291 ACATCTCGACAACTTTTTGCAGG - Intergenic
1051119718 9:13738736-13738758 GTATCTCAACAACTTTGTCCAGG - Intergenic
1051573850 9:18591866-18591888 GCATCTCGATAACTTTTTGCAGG - Intronic
1051811060 9:21050365-21050387 GCATCTCAACAACTTTTTGTAGG - Intergenic
1051965335 9:22821599-22821621 GTATTTCGACAATTTTTTGCAGG + Intergenic
1052139936 9:24968431-24968453 GCATCTCAACAACTTTTTACAGG - Intergenic
1052886595 9:33655079-33655101 GCATCTTGTCAACTTTTTGCAGG + Intergenic
1055167112 9:73210389-73210411 GCATCTCAACATCTTTTTGAAGG + Intergenic
1055198237 9:73623655-73623677 GGATCTCGACAATTTTTTGCAGG + Intergenic
1056144220 9:83713358-83713380 GCATCTTGACAACTTTTTGCAGG + Intergenic
1056173424 9:84010591-84010613 GCATCTCGACAACTTTTTGCAGG - Intergenic
1056941045 9:90956566-90956588 GCATCTTAACAACTTTTTGCAGG - Intergenic
1059026163 9:110633523-110633545 GCACCTTGACAACTTTTTGCAGG + Intergenic
1186173427 X:6901150-6901172 TCAGCTGGACAACTTTTTGCTGG + Intergenic
1188055277 X:25533695-25533717 GCATCTCAACAACTTTTTGCAGG + Intergenic
1188294110 X:28425008-28425030 GCATCTCAGCAACTTTTTGCAGG + Intergenic
1188596898 X:31912418-31912440 GCATCTCGACAACTTTTTACAGG + Intronic
1189416564 X:40820062-40820084 GCATCTCAACAACTTTTGGCAGG + Intergenic
1191008944 X:55740545-55740567 GCATCTCGACAACCTTTTGCAGG - Intronic
1192684457 X:73288995-73289017 GCATGGCCACACCTTTTTGCAGG + Intergenic
1192957434 X:76087746-76087768 TCATCTCGACAACTTTTTGCAGG + Intergenic
1193024199 X:76826829-76826851 GCATCTCGACAGCTTTTGGCAGG - Intergenic
1193829957 X:86278379-86278401 GCATCTTGACCACTTTTTGCGGG + Intronic
1194036039 X:88873659-88873681 ACATGTCAACAACTATTTGCAGG + Intergenic
1194388718 X:93289465-93289487 GCATCTCAACAACTTTTTGCAGG - Intergenic
1194528904 X:95019024-95019046 GCATCTCGACAACTTTTTGTAGG - Intergenic
1196889707 X:120280162-120280184 GCATCTCTACAAAATTTAGCTGG - Intronic
1197015235 X:121617193-121617215 GAATCTCAACTACCTTTTGCAGG - Intergenic
1197361365 X:125507600-125507622 GCATCTCGACAACTTTTTGCAGG - Intergenic
1198317272 X:135480708-135480730 GCATCTCGACAACTTTTTGCAGG - Intergenic
1198844293 X:140893468-140893490 GCATCTCGACAACTTTTTGCAGG + Intergenic
1199058298 X:143324305-143324327 GGATATCAACAACTTTTTTCGGG - Intergenic
1199284421 X:146039883-146039905 ACATGTCCACAACTTTTTGCAGG - Intergenic