ID: 1093999998

View in Genome Browser
Species Human (GRCh38)
Location 12:25684644-25684666
Sequence TTGAAGAATTGGTAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093999995_1093999998 0 Left 1093999995 12:25684621-25684643 CCTGCAAAAAGTTGTCGAGATGC 0: 24
1: 86
2: 79
3: 58
4: 77
Right 1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG No data
1093999993_1093999998 24 Left 1093999993 12:25684597-25684619 CCTGCTGGTTTTGGAAGTGTTTT No data
Right 1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG No data
1093999994_1093999998 1 Left 1093999994 12:25684620-25684642 CCCTGCAAAAAGTTGTCGAGATG 0: 30
1: 83
2: 83
3: 47
4: 93
Right 1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093999998 Original CRISPR TTGAAGAATTGGTAGTTGGT TGG Intergenic
No off target data available for this crispr