ID: 1094003132

View in Genome Browser
Species Human (GRCh38)
Location 12:25718070-25718092
Sequence GGAAACATGTTGATTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094003126_1094003132 17 Left 1094003126 12:25718030-25718052 CCCACTCAATCTAGTTCAAGTAA No data
Right 1094003132 12:25718070-25718092 GGAAACATGTTGATTGGAACTGG No data
1094003125_1094003132 25 Left 1094003125 12:25718022-25718044 CCACTGTACCCACTCAATCTAGT No data
Right 1094003132 12:25718070-25718092 GGAAACATGTTGATTGGAACTGG No data
1094003127_1094003132 16 Left 1094003127 12:25718031-25718053 CCACTCAATCTAGTTCAAGTAAA No data
Right 1094003132 12:25718070-25718092 GGAAACATGTTGATTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094003132 Original CRISPR GGAAACATGTTGATTGGAAC TGG Intergenic
No off target data available for this crispr