ID: 1094007887

View in Genome Browser
Species Human (GRCh38)
Location 12:25774732-25774754
Sequence TTCCCTGGAAGGGGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094007887_1094007893 6 Left 1094007887 12:25774732-25774754 CCTGAGGAGCCCCTTCCAGGGAA No data
Right 1094007893 12:25774761-25774783 AATCAGCCTCATTAGAAACAGGG No data
1094007887_1094007892 5 Left 1094007887 12:25774732-25774754 CCTGAGGAGCCCCTTCCAGGGAA No data
Right 1094007892 12:25774760-25774782 GAATCAGCCTCATTAGAAACAGG No data
1094007887_1094007895 25 Left 1094007887 12:25774732-25774754 CCTGAGGAGCCCCTTCCAGGGAA No data
Right 1094007895 12:25774780-25774802 AGGGCATTTTTGTTGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094007887 Original CRISPR TTCCCTGGAAGGGGCTCCTC AGG (reversed) Intergenic
No off target data available for this crispr