ID: 1094008640

View in Genome Browser
Species Human (GRCh38)
Location 12:25783107-25783129
Sequence GTGACCAGGAGGAAACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094008640_1094008647 11 Left 1094008640 12:25783107-25783129 CCTGCAGGTTTCCTCCTGGTCAC 0: 1
1: 0
2: 4
3: 22
4: 243
Right 1094008647 12:25783141-25783163 CCTCTCCAGGGCATGAGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 244
1094008640_1094008649 23 Left 1094008640 12:25783107-25783129 CCTGCAGGTTTCCTCCTGGTCAC 0: 1
1: 0
2: 4
3: 22
4: 243
Right 1094008649 12:25783153-25783175 ATGAGATGAGGTGAAAAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 537
1094008640_1094008644 -2 Left 1094008640 12:25783107-25783129 CCTGCAGGTTTCCTCCTGGTCAC 0: 1
1: 0
2: 4
3: 22
4: 243
Right 1094008644 12:25783128-25783150 ACTAGGCACTACTCCTCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 67
1094008640_1094008645 -1 Left 1094008640 12:25783107-25783129 CCTGCAGGTTTCCTCCTGGTCAC 0: 1
1: 0
2: 4
3: 22
4: 243
Right 1094008645 12:25783129-25783151 CTAGGCACTACTCCTCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094008640 Original CRISPR GTGACCAGGAGGAAACCTGC AGG (reversed) Intergenic
900384908 1:2406058-2406080 GGGAGCAGGAGGGAACCTCCCGG - Intronic
900783630 1:4633873-4633895 GTGACTAGGAGGAAACATCAGGG + Intergenic
900914592 1:5627153-5627175 ATGACCAGGAGGAAGTTTGCAGG + Intergenic
900978629 1:6033888-6033910 GTGACCTGGAGCAAATCTTCCGG - Intronic
901551066 1:9996721-9996743 ATGACCAGGAGGTAACAAGCAGG + Intergenic
901812631 1:11776555-11776577 GTGTCCAGCAGGCATCCTGCAGG - Exonic
902779239 1:18693744-18693766 GTGCCCAGGAGAACAGCTGCAGG - Intronic
904949361 1:34223844-34223866 GTGTCCAGGAAGAAAACTGGAGG - Intergenic
906683630 1:47748441-47748463 GTGGCAACGAGGAAACCTGCTGG + Intergenic
906747347 1:48231352-48231374 GTGACCAGCTGGCATCCTGCCGG + Intronic
916350331 1:163842340-163842362 ATGACCAGGAGAAGACCTTCTGG - Intergenic
917094337 1:171385080-171385102 TTGCCCAGGAGGAAACATACTGG + Intergenic
920164693 1:204027524-204027546 GAGACCAGGAAGACCCCTGCAGG + Intergenic
920271883 1:204771452-204771474 GTGACTAGGAGGAGACCCGGGGG - Intergenic
923441933 1:234028773-234028795 GTGACCTGGTGTGAACCTGCAGG - Intronic
923826950 1:237510949-237510971 GAGATCAGGAGGTAACATGCAGG + Intronic
1067455542 10:46416970-46416992 TTGACCACTAGGAATCCTGCAGG - Intergenic
1067631661 10:47967669-47967691 TTGACCACTAGGAATCCTGCAGG + Intergenic
1067828359 10:49595718-49595740 GTGACTTGGATGAACCCTGCAGG - Intergenic
1070026708 10:72638677-72638699 GTGAAGAGGGGGAAACCTGAGGG + Intergenic
1070668181 10:78359984-78360006 GTGAGCAGGAGGGAGCCTGGGGG + Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1071218421 10:83434198-83434220 GTCATCAGTAGGAAAACTGCAGG + Intergenic
1073586701 10:104717378-104717400 GAGAACAGAAGGAAACCTGAAGG - Intronic
1075760607 10:124852927-124852949 GTGACCAAGAGCAAAGCTCCAGG - Intergenic
1076539928 10:131207369-131207391 CTGCCCAGGAGGGAGCCTGCAGG + Intronic
1076805071 10:132851525-132851547 GTGACCGGGAGGGAACATGAGGG - Intronic
1077243869 11:1526459-1526481 GTGTCCAGGAGGCAGCCAGCTGG + Intergenic
1077675300 11:4189547-4189569 GTCACCATGAGCAGACCTGCAGG - Intergenic
1078362705 11:10681496-10681518 GTGACAAGGAGGAGGACTGCAGG - Intronic
1078701535 11:13689298-13689320 GTGACCAGAAGGTAACATGAAGG - Intronic
1079883259 11:25952976-25952998 CAGATCAGGAGGAAACCTGAGGG - Intergenic
1081862375 11:46340600-46340622 ATGAGCAGGAGGAAACCTGGAGG - Intronic
1082698925 11:56403217-56403239 GTGAACAGCAAGGAACCTGCAGG - Intergenic
1084979867 11:72823236-72823258 GTCACCAGGAGAGAACCTGTGGG + Intronic
1085152945 11:74266859-74266881 GTGGCAATGAGGACACCTGCAGG - Exonic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1086131799 11:83409033-83409055 GTGTCCTGGAGAAAGCCTGCAGG + Intergenic
1089763374 11:120745134-120745156 GTGACCAGGATGAAAACTGGAGG - Intronic
1089860483 11:121586171-121586193 ATGACGAGGAGGAAACAGGCAGG - Intronic
1090594878 11:128310526-128310548 GTGCCCAGGAGCAAACTTCCAGG - Intergenic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1100415986 12:94375428-94375450 GTGAACAGGAGGAAAAATACAGG + Intronic
1101814390 12:108134511-108134533 GTGACCAGCTGGAAACTGGCTGG - Intronic
1103081316 12:118026261-118026283 GTGAGGAGGGGGAATCCTGCAGG - Intronic
1107892375 13:44925376-44925398 GTGAAAAGCAGGAAAACTGCAGG - Intergenic
1108065753 13:46576125-46576147 GCGACCAGGAGAAAGCCAGCTGG + Intronic
1108214085 13:48166865-48166887 GTGACCATGAAGAGACCAGCAGG + Intergenic
1108775209 13:53757484-53757506 GTGAGCAGTAGGAAACCTCTTGG - Intergenic
1114570609 14:23664753-23664775 GTGACCAGGATAGAGCCTGCTGG - Intergenic
1117294061 14:54362791-54362813 ATGACCAGGAGGAAGCAGGCAGG + Intergenic
1118360993 14:65056392-65056414 GTCTCCAGGAGGGGACCTGCTGG + Intronic
1118736663 14:68705949-68705971 GTGACCTGGAGGAAAGGTGTGGG - Intronic
1120681910 14:87490093-87490115 GTGTCCAGGAAGGGACCTGCTGG - Intergenic
1121337075 14:93083969-93083991 GTGTCCAGGAGGGAAATTGCCGG - Intronic
1121404610 14:93712193-93712215 GTTACCAGCTGGCAACCTGCCGG + Intergenic
1123699454 15:22903628-22903650 GTGACATGGAGGAAGCCTGCGGG + Intronic
1123977034 15:25563484-25563506 GTGACCAGGGGGCAGGCTGCTGG - Intergenic
1124203783 15:27700026-27700048 GTGACAAGGAAGAAACCTCTGGG + Intergenic
1124499637 15:30216084-30216106 GAGTCCAAGAGGAAAACTGCTGG + Intergenic
1124743942 15:32322583-32322605 GAGTCCAAGAGGAAAACTGCTGG - Intergenic
1125377202 15:39042899-39042921 GTTACCAGGAGGAAGAATGCAGG + Intergenic
1125687569 15:41572584-41572606 GTGGCCAGGAGGAAACGGGTGGG + Intronic
1127252328 15:57253338-57253360 GTGACCAGCAGGCAAACTGGTGG - Exonic
1128321701 15:66699137-66699159 ATTACCAGCAGGTAACCTGCAGG - Intergenic
1128868159 15:71131677-71131699 GTTCCCAGGAGGAAATCTTCTGG - Intronic
1129082537 15:73052886-73052908 GGATCCAGGAGGAAACGTGCAGG + Intronic
1129206093 15:74037778-74037800 GGGCCCAGCAGCAAACCTGCAGG - Intronic
1129580829 15:76808105-76808127 GTGCCCAGGAGGTTAGCTGCTGG - Intronic
1132209347 15:100008518-100008540 GGGCCCAGGAGGACACCTGAGGG + Intronic
1137676541 16:50306436-50306458 GAGGTCACGAGGAAACCTGCTGG + Intronic
1138544581 16:57708241-57708263 GTGGCCAGGAGGAGACATGAGGG - Intronic
1138701031 16:58863835-58863857 GTAACCAGCATGAATCCTGCTGG - Intergenic
1141651568 16:85395775-85395797 GCGCCCAGGAGGAAGCCGGCGGG - Intergenic
1141852168 16:86653883-86653905 GGGACCAGGAGGAAACCAGCAGG - Intergenic
1142176103 16:88646165-88646187 GTGGCCAGCAGGAAGCCGGCGGG + Exonic
1142522135 17:512496-512518 GTGAACAGGAGGGAAGATGCCGG - Exonic
1142946723 17:3435682-3435704 GTGACATGTAGTAAACCTGCAGG - Intergenic
1147165118 17:38588974-38588996 GGAACCCGGAGGAATCCTGCTGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148781164 17:50122909-50122931 TTGTCCAGGGGGCAACCTGCTGG + Intronic
1148805367 17:50261180-50261202 GTGACCAGGAGGAGCCCGGGAGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152320457 17:79606146-79606168 GAGACCAGGAAGAAACCAGAAGG + Intergenic
1152570370 17:81118984-81119006 GTGCCCAGGTGGAGCCCTGCTGG - Intronic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1154969739 18:21395447-21395469 CCCACCAGGAGGAATCCTGCTGG - Exonic
1157427870 18:47599713-47599735 GTGTCCAGGATGAAGCCTCCTGG - Intergenic
1157604590 18:48917859-48917881 GTGGTCAGGAGGAAACGTGGCGG + Intergenic
1159200313 18:65175042-65175064 GTGTCCAGGGAGAAACCTGGTGG + Intergenic
1159504863 18:69323026-69323048 GGGACCATGAGGGAACCTTCTGG + Intergenic
1160562471 18:79767271-79767293 GCTTCCAGCAGGAAACCTGCTGG + Intergenic
1161559033 19:4960595-4960617 GTGGCCAGGAGCAAACCTGATGG + Intronic
1162097889 19:8321638-8321660 GTGACCTGGAGGAAAGAAGCTGG - Exonic
1164055653 19:21620096-21620118 GTGTCCAGGAGAAAACTTTCTGG - Intergenic
1164774435 19:30842090-30842112 GTGAGCAGATGGAGACCTGCAGG - Intergenic
925200839 2:1966532-1966554 ATGACCAGGAGGAGAATTGCTGG - Intronic
925978670 2:9158936-9158958 GTGAAAAGGAACAAACCTGCTGG - Intergenic
926745738 2:16155869-16155891 GAGTCCAGGAGGCAACCTGCAGG - Intergenic
927448947 2:23189762-23189784 GAGACCAGGAGGGCGCCTGCTGG - Intergenic
928044596 2:27916574-27916596 GTGTCCAGCAGCATACCTGCTGG - Intronic
929560099 2:42951141-42951163 CTCAGCAGGAGGAAGCCTGCAGG + Intergenic
929601297 2:43206386-43206408 GTGACCATGGGAAAATCTGCAGG + Intergenic
930182731 2:48380426-48380448 GTGCCCAGAAGTAAATCTGCTGG - Intergenic
930736818 2:54788013-54788035 TTGACCATGATGAAACCTGATGG + Intronic
931229017 2:60358461-60358483 GTTACCCGGAGGACCCCTGCAGG - Intergenic
936062630 2:109305478-109305500 GAGACCAGAAGGAAACTAGCAGG - Intronic
936710250 2:115122921-115122943 GTGACCAAGAGGAATCATTCTGG + Intronic
937126825 2:119480337-119480359 GTGGGCAGGAGGACACATGCAGG + Intronic
937241353 2:120464597-120464619 GTGACCTGGAGGTGACCTGGAGG - Intergenic
937473085 2:122190337-122190359 GGAACCAGGAGGAGACCTACAGG + Intergenic
937816336 2:126254903-126254925 GTGACCAAGAGCACAACTGCTGG + Intergenic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
942890862 2:180985941-180985963 GTGACCTTGAGGAAACATTCCGG - Intronic
944686146 2:202119699-202119721 GTGACAATTAGAAAACCTGCTGG + Intronic
948043406 2:234923186-234923208 GGGAACAGGAGGAGACCTTCTGG + Intergenic
948099089 2:235359461-235359483 GTGCCCAGGAGGAGGGCTGCTGG - Intergenic
948120353 2:235524688-235524710 GTGTCCAAGAGAAAACCTGATGG + Intronic
948567471 2:238896082-238896104 CTGAGAAGGAGGAATCCTGCTGG - Intronic
948696633 2:239736240-239736262 GGGACCAGGAGCACCCCTGCGGG + Intergenic
948876608 2:240832910-240832932 GTGTCCAGGCAGAATCCTGCTGG + Intergenic
1168837754 20:888978-889000 GTGACCAGGAGGAGAGTGGCAGG - Intronic
1170412699 20:16107964-16107986 AGGAGCAGGAAGAAACCTGCAGG + Intergenic
1170464421 20:16609907-16609929 GTGAGGAAGAGGCAACCTGCAGG - Intergenic
1171243325 20:23588534-23588556 GTGACCAGGAGGCCAACTTCAGG - Intergenic
1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG + Intergenic
1179914543 21:44467697-44467719 GTGACCTGGAGGTAGCCTCCTGG + Intergenic
1180930040 22:19583685-19583707 GTGACCAGGAGGAGTCATGAGGG + Intergenic
1181393723 22:22603163-22603185 GTGGCCAGCAGGACACCTGGAGG + Intergenic
1184239075 22:43202332-43202354 GTGACCAGGAGGAACCCTAGAGG + Exonic
1185420152 22:50730625-50730647 GGGTCCAGGAGGAAACGGGCTGG - Intergenic
949828223 3:8185420-8185442 GTGAGCAGGAGGAGGCCTGAGGG - Intergenic
958463173 3:94424872-94424894 GTCAGCAGGAGGAAACCTGGGGG + Intergenic
960154396 3:114283313-114283335 GTGACCAGCAGGCAATCTGTGGG + Intronic
960821314 3:121735983-121736005 GTGACCAGGAGCCAATCTGAAGG + Intronic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
961537050 3:127576692-127576714 GTGGCCTGGAAGAAACATGCTGG + Exonic
962090441 3:132238965-132238987 GAGACCAGGAGGACAACTTCTGG + Intronic
965840124 3:172895261-172895283 GGGACCAGGAGGAAAACAGATGG - Intronic
966430690 3:179828871-179828893 GTGAGGATGAGAAAACCTGCTGG - Intronic
966459891 3:180165331-180165353 GTGACTATCAGGAAACCTGTAGG - Intergenic
966625040 3:182006497-182006519 GTGACAAAGAGGAAAAATGCAGG - Intergenic
967092809 3:186149722-186149744 GCGTCCATGAGGAAACTTGCAGG + Exonic
967472193 3:189874867-189874889 GTGAACAGGAGGAAATTTGAGGG - Intronic
967885978 3:194333764-194333786 GTGACCCGGGGGATACTTGCCGG - Intergenic
967989378 3:195119991-195120013 GTCACGAGCAGGAATCCTGCGGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968332251 3:197880925-197880947 ATGACCAGGAGAAAAAATGCTGG - Intronic
968642701 4:1722272-1722294 GTGACTCGGAGGAAGCCTTCTGG - Intronic
968666475 4:1825006-1825028 GGCACCGGGAGGAAACCGGCTGG + Intronic
969470870 4:7388562-7388584 GTGATCAGGTGGACACCTGTGGG - Intronic
969760268 4:9176119-9176141 CTGAGGAGGAGGAAACCTGAAGG - Exonic
972847010 4:43002906-43002928 GTGTCAAGGAAGAAACCTGGTGG + Intronic
975026710 4:69557899-69557921 GTGTCTCGGAAGAAACCTGCTGG - Intergenic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
981208689 4:142074946-142074968 GTGGCCAGGAGGTATCCTGGAGG - Intronic
981955193 4:150463841-150463863 ATGACCAGAAGGAAGCCTCCAGG - Intronic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
982771559 4:159401472-159401494 GTGAGCAGCAGGAAGCCTTCAGG - Intergenic
982940169 4:161540583-161540605 ATGAGAAGGATGAAACCTGCAGG - Intronic
984532666 4:180935682-180935704 GTGAACTGGGGGAAGCCTGCTGG + Intergenic
984715226 4:182918147-182918169 ATTACCAGGAGGTAACATGCAGG - Intergenic
986337636 5:6767037-6767059 GTGACAAGGAGGATCCCTCCCGG + Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
988640167 5:33032993-33033015 GAGACCCGGAGGAAACATGCTGG + Intergenic
990516349 5:56534464-56534486 ATGTCCAGGAGGAAACTTCCTGG - Intronic
990845123 5:60128576-60128598 GTGACCAGGTGGAAGGCAGCTGG + Intronic
992013731 5:72556081-72556103 GGCCCCAGGGGGAAACCTGCTGG - Intergenic
992024563 5:72657687-72657709 TTGACTAAGAGGAAACCTTCAGG + Intergenic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
993799750 5:92318429-92318451 GTGTCAAGGAAGAAACCTGGTGG + Intergenic
994630629 5:102281885-102281907 ATGCCCAGGAGTAAAACTGCTGG - Intronic
996543083 5:124649682-124649704 TTGACCACTAGGACACCTGCAGG + Exonic
998046340 5:138990093-138990115 GGGACCAGGAGTAAACTTGCTGG - Intronic
1000495791 5:161982693-161982715 ATGAACAGGAGGAAACCTTTGGG - Intergenic
1001746632 5:174097355-174097377 GAGAACAGGAGGAGACATGCAGG + Intronic
1002708934 5:181182481-181182503 GAGACCAGGAGAAAACCAGAAGG - Intergenic
1003263233 6:4543166-4543188 GGGATGAGGAGGAAAGCTGCTGG + Intergenic
1004337486 6:14777430-14777452 GAGACCAGGAGGAATCGAGCAGG - Intergenic
1005113692 6:22313667-22313689 GTGCCCAGGCAGAAGCCTGCTGG - Intergenic
1005671449 6:28110045-28110067 GTGTCCAGGGAGAAACCTGGTGG + Intergenic
1006838708 6:37014743-37014765 GGGACCAGGCTGAGACCTGCAGG - Intronic
1007269131 6:40622569-40622591 GTGACTGGGAGGAAGCCTGGGGG + Intergenic
1008418055 6:51266275-51266297 CTGCCCAGGAGGGAACCTGATGG - Intergenic
1008667518 6:53730925-53730947 GGGACAAGGTGGAAACCTACAGG - Intergenic
1009428790 6:63543345-63543367 GTGCCAAGAAGGAAACCTGCAGG - Intronic
1010638302 6:78287647-78287669 GAGAAAAGGTGGAAACCTGCTGG - Intergenic
1012833557 6:104236907-104236929 GAGAAGAGGAGGAAACTTGCTGG - Intergenic
1013488379 6:110619695-110619717 GTTACCAAGAGGAAACATCCAGG - Intronic
1013687419 6:112601426-112601448 TGGGCCAGAAGGAAACCTGCTGG + Intergenic
1016639817 6:146335838-146335860 GTGTCCAGGAAGAGACCTGGTGG + Intronic
1018452920 6:163925573-163925595 GTGAACAGCAGGCAAACTGCAGG + Intergenic
1018958925 6:168432338-168432360 GTGCACAGGAGCAAGCCTGCCGG - Intergenic
1019660317 7:2220334-2220356 GTGGTCAGGAGGAAGCCTGGCGG - Intronic
1019843064 7:3468663-3468685 GAGGCCAGGAAGAATCCTGCTGG + Intronic
1024009167 7:45253108-45253130 GTAACCAGGAGATACCCTGCAGG + Intergenic
1024151674 7:46578067-46578089 GTGACCAAGATGAAAACTGAAGG + Intergenic
1024936835 7:54719490-54719512 GTGGCCAGGAGGAAATCAGTTGG - Intergenic
1027266846 7:76499201-76499223 GTGACCTGGAGGGAAACTGCTGG - Intronic
1027318663 7:76999061-76999083 GTGACCTGGAGGGAAACTGCTGG - Intergenic
1028588508 7:92473788-92473810 GTGTCCAGGAGACAACCTCCTGG + Intronic
1029401714 7:100351354-100351376 GTGACCGGGAGGAAACAGGCTGG - Intronic
1029529922 7:101118540-101118562 GTGGCCTGGAGGCACCCTGCAGG + Intergenic
1031924031 7:127621012-127621034 GCGACCAGGAGGAAGCCTGTGGG + Intergenic
1032838803 7:135697872-135697894 GCGACCATGTGGAAACCTGAAGG - Intronic
1033058498 7:138082007-138082029 GTGACTAGGAGGCAATATGCAGG + Intronic
1034738081 7:153447407-153447429 GTGACCTGGGGGAGTCCTGCAGG + Intergenic
1034881797 7:154768199-154768221 GGCACCAGGAGGAGACCAGCTGG - Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035024140 7:155815372-155815394 GTGCCCAGGAGGGAGCCTGGGGG - Intergenic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1035608861 8:947607-947629 GTGACCAGGCTGAAGCCAGCGGG - Intergenic
1036263891 8:7259866-7259888 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036265187 8:7267488-7267510 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036266488 8:7275110-7275132 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036267794 8:7282732-7282754 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036269097 8:7290354-7290376 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036270391 8:7297976-7297998 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036297494 8:7549079-7549101 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036298798 8:7556726-7556748 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036300103 8:7564376-7564398 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036301407 8:7572021-7572043 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036302704 8:7579670-7579692 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036315931 8:7718405-7718427 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036317238 8:7726053-7726075 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036318546 8:7733701-7733723 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036319855 8:7741348-7741370 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036321162 8:7748996-7749018 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036322471 8:7756644-7756666 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036323779 8:7764292-7764314 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036325081 8:7771940-7771962 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036350963 8:8012368-8012390 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036352261 8:8020014-8020036 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036353560 8:8027662-8027684 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036846247 8:12172787-12172809 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036867613 8:12415106-12415128 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1037264829 8:17046789-17046811 GAGCCCAGGAGGAAATTTGCAGG - Intronic
1037928707 8:22865052-22865074 GTCACCAGGCGGGGACCTGCAGG + Intronic
1038451030 8:27639062-27639084 GTCTCCAGGTGGAGACCTGCAGG + Intronic
1039475752 8:37838652-37838674 GTGACCAGCAGCAGGCCTGCAGG - Intronic
1040354957 8:46608450-46608472 AGGAACAGGAGGAAACCTCCCGG - Intergenic
1041375244 8:57205401-57205423 GTCAGCAGGAGGAAACCTTAGGG + Intergenic
1041375475 8:57206755-57206777 GTCAGCAGGAGGAAACCTTAGGG + Intergenic
1041376238 8:57211134-57211156 GTCAGCAGGAGGAAACCTTAGGG + Intergenic
1042847406 8:73182288-73182310 GTGACAAGGAGAAAATATGCCGG - Intergenic
1047340776 8:123978113-123978135 GGGACCAGGAGCAAACCTCCTGG - Intronic
1048242806 8:132760783-132760805 GTGACCAGGGTGTAACCAGCTGG - Intergenic
1048988117 8:139746259-139746281 GTGCCCAGGAGGAAACGCGATGG - Intronic
1056276597 9:84999850-84999872 GTGGCTTGGAGGAAACCTACAGG - Intronic
1056760674 9:89412382-89412404 GTGCCCAGGTGGAAGCCAGCAGG + Intronic
1058777699 9:108301139-108301161 GTGACCAGGAGGAAATCATGAGG + Intergenic
1059350280 9:113659458-113659480 ATTACCAAGAGGAAACCTTCAGG + Intergenic
1059695471 9:116726160-116726182 GTGACCAAGAGGGAATCTGCAGG + Intronic
1062400693 9:136371446-136371468 ATGTCCAGGAGCACACCTGCGGG + Exonic
1062501747 9:136854755-136854777 GAGACCAGGAAGGAGCCTGCGGG - Exonic
1062623176 9:137431659-137431681 GTGACCAGGAGTGACCCAGCTGG + Intronic
1188885823 X:35547471-35547493 GTGACTAGGAGGATATCTGCTGG + Intergenic
1191586604 X:62833962-62833984 GTGGCCAGGCAGAAACCTTCAGG - Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192179791 X:68909288-68909310 GTTCCCAGGAGGGAACATGCTGG + Intergenic
1194086832 X:89538488-89538510 GTAATTAGGAGGAAAGCTGCTGG + Intergenic
1195112740 X:101664055-101664077 GTGACCAGGAGCTGACATGCTGG + Intergenic
1195368629 X:104151145-104151167 GTGATAAGGAGGAAACCTGGGGG - Intronic
1195668148 X:107449122-107449144 GTGACCAGGAGGGGAGCTGCAGG + Intergenic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1198278808 X:135122210-135122232 GTGGCCAGGAGAAAACCTGCGGG - Intergenic
1198292152 X:135250306-135250328 GTGGCCAGGAGAAAACCTGCGGG + Intronic
1200872709 Y:8121043-8121065 GTGACCAGGTGGACACCTTGGGG + Intergenic