ID: 1094011135

View in Genome Browser
Species Human (GRCh38)
Location 12:25811009-25811031
Sequence CACTGTTTATGATGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094011135_1094011137 8 Left 1094011135 12:25811009-25811031 CCTTTTGTCCATCATAAACAGTG No data
Right 1094011137 12:25811040-25811062 AACACTCATGTACAAGTATTTGG No data
1094011135_1094011138 9 Left 1094011135 12:25811009-25811031 CCTTTTGTCCATCATAAACAGTG No data
Right 1094011138 12:25811041-25811063 ACACTCATGTACAAGTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094011135 Original CRISPR CACTGTTTATGATGGACAAA AGG (reversed) Intergenic
No off target data available for this crispr