ID: 1094012670

View in Genome Browser
Species Human (GRCh38)
Location 12:25825675-25825697
Sequence AGGGTTTCACAGGATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094012670_1094012675 23 Left 1094012670 12:25825675-25825697 CCAGCAACATCCTGTGAAACCCT No data
Right 1094012675 12:25825721-25825743 CTCCCTCTTCTGCCACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094012670 Original CRISPR AGGGTTTCACAGGATGTTGC TGG (reversed) Intergenic
No off target data available for this crispr