ID: 1094024736

View in Genome Browser
Species Human (GRCh38)
Location 12:25950763-25950785
Sequence ATTCAAACCAGTCTCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094024735_1094024736 1 Left 1094024735 12:25950739-25950761 CCATACAGGAGAACTGGAGTTAG No data
Right 1094024736 12:25950763-25950785 ATTCAAACCAGTCTCCATGAAGG No data
1094024734_1094024736 2 Left 1094024734 12:25950738-25950760 CCCATACAGGAGAACTGGAGTTA No data
Right 1094024736 12:25950763-25950785 ATTCAAACCAGTCTCCATGAAGG No data
1094024733_1094024736 6 Left 1094024733 12:25950734-25950756 CCAGCCCATACAGGAGAACTGGA No data
Right 1094024736 12:25950763-25950785 ATTCAAACCAGTCTCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094024736 Original CRISPR ATTCAAACCAGTCTCCATGA AGG Intergenic
No off target data available for this crispr