ID: 1094025236

View in Genome Browser
Species Human (GRCh38)
Location 12:25955027-25955049
Sequence TCCACCTTCAGTAAAGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094025236_1094025237 11 Left 1094025236 12:25955027-25955049 CCACGGACTTTACTGAAGGTGGA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1094025237 12:25955061-25955083 TCCCAGCATCCCATCTGTACTGG 0: 1
1: 0
2: 2
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094025236 Original CRISPR TCCACCTTCAGTAAAGTCCG TGG (reversed) Intergenic
900861913 1:5239978-5240000 TCCACCTTCAGCCAAGAGCGTGG + Intergenic
903758019 1:25676522-25676544 TCCACTTTCAGCACAGTCCAAGG - Intronic
907274592 1:53310227-53310249 TCCACCTCCAGAAAAGCCCTTGG + Intronic
908600368 1:65732333-65732355 TCCAGCTTCAGTTAATTCCAAGG + Intergenic
916172099 1:162009306-162009328 ACCACCTTTAGTAGAGTCCTAGG - Intronic
917652844 1:177095946-177095968 TCCACCTTCAGAAAACACTGGGG - Intronic
922558699 1:226551426-226551448 TCCACCTGCAGTGGAGTCCCAGG + Intronic
1069746091 10:70715937-70715959 TCCTCCAACAGTAAAGTCCTAGG - Intronic
1069828387 10:71268124-71268146 TCCACATTCAGGAAAATCCAAGG + Intronic
1071195009 10:83148475-83148497 TGCAACTTCAGCAAAGTCCCAGG + Intergenic
1074344045 10:112663785-112663807 TCTACCTTCATTAGACTCCGTGG + Intronic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1077148396 11:1056184-1056206 TCCACATTCAGAAAACTGCGAGG - Intergenic
1080655393 11:34253924-34253946 TCCTCCCTCAGTGAAGTTCGTGG + Intronic
1081017725 11:37904803-37904825 ACCAGCTCCAGTAAAGTCCTAGG + Intergenic
1087939745 11:104080971-104080993 TCCAGCTTCAGTTAAATCTGTGG + Intronic
1088594084 11:111426844-111426866 TACACTTTGAGTAAACTCCGGGG - Intronic
1094025236 12:25955027-25955049 TCCACCTTCAGTAAAGTCCGTGG - Intergenic
1100792228 12:98143242-98143264 TCCACCTTCAGTCAAGTTCCTGG - Intergenic
1105697880 13:22908388-22908410 TCCACCTTCCATAAAGTCCTAGG + Intergenic
1110784050 13:79502425-79502447 TCCAGCTTCAGTCCAGTCCCTGG + Intronic
1122251750 14:100444657-100444679 TCCACCCTCTGTATAGTCCCAGG - Intronic
1123468383 15:20532552-20532574 TCAACTTTCAGTAAAGGCAGAGG + Exonic
1123728701 15:23127762-23127784 TCAACTTTCAGTAAAGGCAGAGG + Intergenic
1123740133 15:23277331-23277353 TCAACTTTCAGTAAAGGCAGAGG - Intergenic
1123746865 15:23325227-23325249 TCAACTTTCAGTAAAGGCAGAGG + Intergenic
1124113114 15:26811486-26811508 TCCACCTTCAGGTAGGTCCCCGG - Intronic
1127924310 15:63523848-63523870 TCAACCTTCAGTAAAGCCTGGGG + Intronic
1128173283 15:65531172-65531194 CCCAGCCTCAGTAACGTCCGAGG - Intronic
1133441352 16:5823636-5823658 TCCACCTCCAGTCAGGTCAGTGG + Intergenic
1137868361 16:51925311-51925333 TCCAACTTAAGTAAATTCCATGG - Intergenic
1137897767 16:52232739-52232761 TCTACATTCAGTAAACTCCCTGG + Intergenic
1138058741 16:53864939-53864961 TCCACCTTCATTTAAATCCTTGG - Intronic
1142109301 16:88322773-88322795 CCCACCTTCAGGAGAATCCGTGG + Intergenic
1142724789 17:1804935-1804957 TCCACCTTCAGTATTGTTTGTGG - Intronic
1147686062 17:42287618-42287640 TCTACCTTCAGAAAAGTCCAGGG - Exonic
1148391880 17:47278732-47278754 TCCACCTTCTGTCAGATCCGTGG + Intronic
1150173216 17:63022017-63022039 TCCACCTTCCATAAAGACCTAGG - Intronic
1155808250 18:30199641-30199663 TCCACCCTCAGGTAAGTCCCAGG - Intergenic
1158507175 18:58057130-58057152 TCCACCTTCAGAAATGCCCCTGG + Intronic
1159783215 18:72683452-72683474 TCCACAGTCAGTAAAATCAGGGG - Intergenic
1164301462 19:23965864-23965886 TCCACATTCAGTAAAGGAAGTGG - Intergenic
1164500541 19:28815835-28815857 TCCACCTTCCATAATGTCCTAGG + Intergenic
925129412 2:1483763-1483785 TGCACCTTCAGTGAAGGCCCAGG + Intronic
928953625 2:36838261-36838283 TCCAGCCTCATTAAAGTCAGAGG - Intergenic
930472550 2:51837298-51837320 AGCAACTTCAGTAAAGTCCCAGG + Intergenic
935616637 2:105091120-105091142 TACACCTGTATTAAAGTCCGTGG - Intronic
945609301 2:211978318-211978340 TCCACCTTCCCTAAGGTCCTTGG - Intronic
945764615 2:213959612-213959634 TATGCCTTCAGTAAAGTCCATGG - Intronic
950359398 3:12439873-12439895 TCCTCCTTGAGTCAAGCCCGTGG - Intergenic
959743421 3:109747937-109747959 TGCTCCTTCAGTAAATGCCGAGG - Intergenic
960278578 3:115755173-115755195 TGCAACTTCAGTAAAGTCTCAGG + Intergenic
960523474 3:118682242-118682264 TCAACTTTCAGTAAAGCCAGTGG + Intergenic
963565566 3:146925814-146925836 TCCTCTTTCAGTAAAGATCGAGG + Intergenic
970317408 4:14842578-14842600 TCCACATTCTATAAAGTCCTAGG + Intergenic
971006114 4:22375725-22375747 TCCACCTTCTTTTAAGTCCTTGG + Intronic
975954481 4:79821350-79821372 TCCACCTTTCATAAAGTCCTAGG + Intergenic
981728073 4:147868824-147868846 TCCACCTTCTGTCAGATCCGCGG - Intronic
981731707 4:147906086-147906108 TGCACCTTCAGCAAAGTCTCAGG - Intronic
982859479 4:160430845-160430867 ACCACCTTCAGCAAAGTCTCAGG - Intergenic
984835436 4:184015477-184015499 TCGACATTCAAGAAAGTCCGAGG + Intronic
988549400 5:32186511-32186533 ACCACCTTCAGTGAAGACCCTGG + Intergenic
991960942 5:72043430-72043452 TCCATTTCCAGTAAAGTCAGTGG - Intergenic
992962724 5:81972071-81972093 GCCTCCTTCAGTCAGGTCCGCGG - Exonic
993201510 5:84822119-84822141 TCCACATTCAGTAATGTAAGTGG - Intergenic
994018807 5:95000809-95000831 ATCACCTACAGTAAAGTCCTAGG + Intronic
995571309 5:113485436-113485458 GCCTACTTCAGTAGAGTCCGAGG - Intronic
997334071 5:133092085-133092107 ACCAACTTCAGTAAAATCTGTGG - Intronic
1000202144 5:159021689-159021711 TACACCTTCAGTAAAGCTCACGG + Intronic
1006611902 6:35299040-35299062 TCCAAGTTCAGTAAAGTAGGGGG - Intronic
1012834738 6:104251377-104251399 TCCACCTTCCATAAAGCCCTTGG - Intergenic
1012895140 6:104939400-104939422 ACCACCTTCAGCAAATTCCCTGG - Intergenic
1014974727 6:127865066-127865088 TCAACCTCCAGTAAAATCCCAGG - Intronic
1018597518 6:165498503-165498525 TCCAACTTCAGAAAAGTACCAGG - Intronic
1018760344 6:166889096-166889118 ACCAACTTCAGTAAAGTCTCAGG + Intronic
1020145102 7:5636159-5636181 TTCACGTTCAGTAAAGTTCCAGG + Intronic
1021951981 7:25783872-25783894 TCCAACTCCAGTAAATTCCGTGG - Intergenic
1027460900 7:78452098-78452120 TCCACACTCAGTAAAGTGCCTGG - Intronic
1031473906 7:122199859-122199881 CCCACCTTCAGTAACGTTCCTGG + Intergenic
1035582966 8:751481-751503 TCCAACTTCCGTAATGTCCCCGG - Intergenic
1036133670 8:6139489-6139511 TTCCCCTTCTGTAAAGTCAGAGG + Intergenic
1042967751 8:74373612-74373634 AGCAACTTCAGTAAAGTCTGAGG - Intronic
1044485901 8:92753915-92753937 TCCATCTTCATTAAATTCCTGGG - Intergenic
1044884270 8:96760000-96760022 TCCAACTGCAGTATAGTCCTAGG - Intronic
1046358622 8:113121027-113121049 TGCACTTTCAGTGATGTCCGTGG + Intronic
1055476442 9:76667735-76667757 TCCACCTCCAGAAAAGTCAAAGG - Intronic
1058278468 9:103078765-103078787 TCCACCTTGAGGAAAGGCAGGGG - Intergenic
1060876106 9:127084611-127084633 TCCACCTTCAGTCAAGTGAGAGG - Intronic
1187358160 X:18598456-18598478 TCCAACTTCAGTAAATTCTTAGG - Exonic
1188244360 X:27822337-27822359 CCCAACTGCAGTAAAGTCTGAGG + Exonic
1191004034 X:55691168-55691190 AGCAACTTCAGTAAAGTCTGAGG + Intergenic
1196010556 X:110882988-110883010 TCCACCTTCAAGAAGGTCCTGGG + Intergenic
1196902917 X:120403420-120403442 TCCACCTTCTGTCAGGTCAGTGG - Intergenic