ID: 1094025843

View in Genome Browser
Species Human (GRCh38)
Location 12:25958974-25958996
Sequence GCCGGGGCCTCCAGCCGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094025832_1094025843 9 Left 1094025832 12:25958942-25958964 CCGGGAGGTGCGCGGAGAGGGAA 0: 1
1: 0
2: 0
3: 20
4: 256
Right 1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG 0: 1
1: 1
2: 1
3: 11
4: 197
1094025824_1094025843 29 Left 1094025824 12:25958922-25958944 CCACACTCACCTAGCGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG 0: 1
1: 1
2: 1
3: 11
4: 197
1094025828_1094025843 20 Left 1094025828 12:25958931-25958953 CCTAGCGCGGGCCGGGAGGTGCG 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG 0: 1
1: 1
2: 1
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094025843 Original CRISPR GCCGGGGCCTCCAGCCGGTG CGG Intergenic
900269417 1:1779228-1779250 CCCGAGTCCTCCAGCCTGTGGGG - Intronic
900780729 1:4615700-4615722 ACAGGGGCCCCCAGCCAGTGGGG - Intergenic
901193600 1:7427089-7427111 AGCGAGGCCTCCAGCAGGTGGGG + Intronic
901235054 1:7663224-7663246 GCCAGGGACCCCAGCCGCTGTGG + Intronic
901491249 1:9597447-9597469 GCCGGGGCCACCAGCAGGCAAGG - Intronic
901511005 1:9717998-9718020 GGCGGTGCCTGCAGCCTGTGAGG + Intronic
903754660 1:25652462-25652484 CTGGGGGCCTCCAGCCTGTGGGG - Intronic
904587603 1:31588762-31588784 GCCGCCACCTCCAGCCAGTGGGG + Intergenic
906288839 1:44606114-44606136 GCTGGGGCCTCCCGCTGGGGCGG - Intronic
906532781 1:46533067-46533089 GCCGGGGCCTCCAGGGCGAGGGG + Intergenic
911663722 1:100531746-100531768 GCAAGGGCCTTCTGCCGGTGGGG + Intergenic
912056638 1:105607784-105607806 GCCAGGGCCCACAGCCAGTGAGG - Intergenic
912652049 1:111448768-111448790 CTCGGGGCCTCCAGCCTGAGTGG - Exonic
915024297 1:152812744-152812766 TCCGGGGGCTCCAGCTGCTGTGG + Exonic
916749768 1:167713767-167713789 TGCGGGGTCTCCCGCCGGTGTGG - Intergenic
919854190 1:201694459-201694481 GCCGGGGTCACCAGCTGCTGGGG + Intronic
921167044 1:212514883-212514905 GCCGGCGCCTCCAGTCCGCGAGG - Intergenic
1063593108 10:7410830-7410852 GCCGGGGACAGCAGCCGGCGCGG + Intronic
1064306791 10:14174462-14174484 GCCGGAGCATCCAGCCGCTTTGG + Intronic
1066191740 10:33062230-33062252 GCAGGTGCTTCCAGCGGGTGGGG + Intergenic
1067237915 10:44467246-44467268 GCCTGGGCCACGAGCTGGTGAGG + Intergenic
1069531282 10:69221442-69221464 GCCGTGACAGCCAGCCGGTGTGG - Intronic
1069744329 10:70705407-70705429 GCCAGGGCCGCCAGCCGGGCTGG + Intronic
1069769388 10:70888005-70888027 GCACGGGCCTCAAGCCGGCGCGG + Intronic
1070785355 10:79159297-79159319 GCCGAGGCCCACAGCCTGTGTGG - Intronic
1073320503 10:102613508-102613530 GCTGGGGCCTGCAGCCAGGGTGG - Intronic
1075359115 10:121813740-121813762 GCTGGGGCCTCCTGCTGCTGAGG - Intronic
1075567835 10:123517706-123517728 CCAGGGCCCTCCAGCCGGTGTGG - Intergenic
1076612866 10:131737387-131737409 GTCGGGGTCACCAGCCTGTGGGG - Intergenic
1076861628 10:133140622-133140644 GCCGCGGGCCCCAGCCTGTGGGG + Intergenic
1076990582 11:271368-271390 GCCAGGGCCTCCTGTTGGTGGGG - Intergenic
1085464700 11:76715895-76715917 GCCGGGGCCACCAGCTGGCAGGG - Intergenic
1085530352 11:77188972-77188994 GCCTGGGCCACCAGCTGGTTAGG + Intronic
1089605710 11:119640161-119640183 GGAGGGGCTCCCAGCCGGTGTGG + Intronic
1089661586 11:119989626-119989648 GCCTGGGCCTCCATCTGGTTTGG - Intergenic
1090920073 11:131199226-131199248 GGCAGGGCCTCCAGCCAGCGAGG + Intergenic
1091849134 12:3681078-3681100 CCAGGGGCCTCCAGCAGGAGAGG - Intronic
1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG + Intergenic
1094536556 12:31326428-31326450 GCCGCGGCCTGCAGCCGGGGGGG - Intronic
1101333686 12:103777836-103777858 GCCTGGGCCTCCTGCAGGAGAGG + Exonic
1102038628 12:109786644-109786666 GCAGGGGCCCCGAGCCAGTGGGG + Intronic
1103397408 12:120618797-120618819 CCAGGGGCGTCCAGCCAGTGAGG + Intergenic
1103736670 12:123065078-123065100 CCAGGGGCCTCCAGCGGCTGTGG - Intronic
1104721862 12:131048861-131048883 GAAAGGGCCTCCAGCTGGTGGGG + Intronic
1104775341 12:131387411-131387433 GGCGGGCGCTGCAGCCGGTGGGG - Intergenic
1105071202 12:133235530-133235552 GCCTGGGGCTCCAGCCTGGGAGG + Exonic
1106246511 13:27954438-27954460 GCCGCGGCCTCCTGCCGGGTAGG - Intergenic
1112768721 13:102773500-102773522 CCCGCGGGCACCAGCCGGTGGGG - Intronic
1113962075 13:114131927-114131949 GCCGGGGCCTCACGCCCCTGGGG + Intronic
1115548616 14:34485786-34485808 GCGGGGGCCACCAGCATGTGTGG - Intergenic
1115770495 14:36661184-36661206 GCCCGTGCCTCGAGCCTGTGTGG + Intronic
1116018203 14:39431885-39431907 GCCGAGGCCCGCAGCCGGTCGGG + Exonic
1118350838 14:64971840-64971862 GCCACCGCCTCCAGCCGGAGGGG + Intronic
1118869209 14:69727250-69727272 GCCAGGGCCTCCAGCGGGTAGGG + Intronic
1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG + Intronic
1119219436 14:72893939-72893961 GCAGGCGCCTCCAGCCGCGGCGG - Intronic
1119260814 14:73237341-73237363 CCCGGGGCCTCCACCCGCTTGGG - Intergenic
1121645612 14:95515817-95515839 CCAGGGGCCTCCAGCCTGGGCGG - Intergenic
1122913399 14:104844593-104844615 GCCTGGGCCTCCAGCAGGTCTGG - Intergenic
1123119372 14:105909729-105909751 GCCGGGGGCTCCGGCGGGTCGGG - Intergenic
1124004476 15:25785096-25785118 GCCGGGTGCTCCAGCTGGAGTGG - Intronic
1124014194 15:25862515-25862537 GCCGGGCCCTCCACCCTGAGTGG + Intronic
1125482197 15:40088635-40088657 GCAGGGGCCACCTGCCGATGGGG + Exonic
1129288003 15:74541221-74541243 GCCGGGGGCCACAGCCGGGGCGG - Exonic
1131165979 15:90142421-90142443 GCCGCGGCGCCCAGCCGGTGGGG - Intergenic
1132357667 15:101184779-101184801 GCAGGGGCCACCAGCCAGTCTGG - Intronic
1132675711 16:1120509-1120531 GCCAGGGGCTGCAGCCGGCGCGG + Intergenic
1132751790 16:1461019-1461041 CCCGGGGCCTGCAGGCGGTCTGG - Intronic
1132842537 16:1985064-1985086 GCAGGGACCTCCAACAGGTGAGG + Intronic
1132869290 16:2108554-2108576 GCCGGGGCGCCCAGCGCGTGTGG - Exonic
1134102666 16:11462904-11462926 GACCGGGGCTCCAGCTGGTGAGG - Intronic
1134140276 16:11712478-11712500 GCAGGAGCCACCAGCCAGTGTGG - Intronic
1136546643 16:30958368-30958390 GCCCGGGCCGCTGGCCGGTGAGG + Intronic
1137679081 16:50323440-50323462 CCCGTGGCCTCCAGCCGGGCTGG + Intronic
1139549860 16:67667159-67667181 GCTGGGCCCTCCAGGCGGGGAGG + Intronic
1141471026 16:84238583-84238605 GAAGGGGCCTCCAGCCGCAGTGG + Intronic
1141689254 16:85587190-85587212 GCCGGGCCCTCCAGACCATGGGG - Intergenic
1141863605 16:86734649-86734671 ACTGGGGCCTGCAGCCAGTGGGG - Intergenic
1142683090 17:1561926-1561948 GGCAGGGCCTCCCGGCGGTGGGG - Intronic
1143541570 17:7572614-7572636 GGCGGGCCCTCCAGCCAATGAGG + Exonic
1143873456 17:9974427-9974449 TCTGGGGCCTCCAGCCTCTGGGG + Intronic
1146271378 17:31487975-31487997 GGCGGGGCCTCGCGCCGGGGCGG - Intronic
1146681403 17:34810899-34810921 GGGGAAGCCTCCAGCCGGTGAGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1148322401 17:46765501-46765523 CCCGGGCCCTCCACACGGTGAGG - Intronic
1148787136 17:50150928-50150950 GCCGAGGCCTCCGGCCGGACTGG - Intergenic
1149541091 17:57468714-57468736 GCCGGGGGATGCAGTCGGTGTGG + Intronic
1150790353 17:68197302-68197324 GCCGGGGCCTGGAGCCGGGAGGG - Intergenic
1151975745 17:77482789-77482811 TCCGGGGCCACCAGGGGGTGTGG - Intronic
1152301228 17:79496135-79496157 GCCCTGGCCTCCAGCCCGAGAGG - Intronic
1152376537 17:79921510-79921532 GCTGGGGCCTCCAGTGAGTGGGG - Intergenic
1152640026 17:81445460-81445482 GGTGGGGCCTGCAGCGGGTGAGG - Exonic
1152648536 17:81481496-81481518 GAGGGGGCCGCCAGCCCGTGCGG - Intergenic
1152730629 17:81967922-81967944 GCCGCGGCCTGCAGCTCGTGAGG - Intergenic
1153067432 18:1062440-1062462 ACCAGGGGCTCCAGCAGGTGTGG + Intergenic
1153480534 18:5543211-5543233 GCAGCGGCCCCCGGCCGGTGGGG - Intronic
1153985025 18:10343927-10343949 GCCGGCCCCTCCAGCAGGGGAGG - Intergenic
1154148520 18:11886756-11886778 GCACGTGGCTCCAGCCGGTGTGG - Exonic
1154358627 18:13641697-13641719 GGCGGGGCCGCCAGTCGGCGTGG + Intronic
1160259613 18:77280206-77280228 GCTGGGGCATCCATCCCGTGAGG + Intergenic
1160543487 18:79638178-79638200 GCGGGGCCCTCGAGCCGATGCGG + Intergenic
1160765403 19:805390-805412 GCCGGGGCCGCCCGCCGGCCGGG + Intronic
1161217351 19:3101071-3101093 GCCTGGGCCACCGGACGGTGCGG - Intronic
1161312762 19:3603907-3603929 GCAGGGGCCCCCACGCGGTGGGG + Intronic
1162235913 19:9309616-9309638 CCCGGGGCCTCCCGCCGCCGCGG - Intronic
1163400516 19:17089459-17089481 GACGGGGCCTCCAGAAAGTGTGG - Intronic
1163833895 19:19562052-19562074 GCCAGGGTCTCCAGCAGGTGAGG + Exonic
1165328238 19:35126421-35126443 GCCGAGGCCAGCAGCAGGTGGGG + Exonic
1166317917 19:41998985-41999007 GCCGGCGCATCCAGGCGCTGCGG - Exonic
1166856110 19:45783320-45783342 GTCGGGGCCTCCAACCGGCCTGG + Exonic
1166924725 19:46259566-46259588 GGCGGGGTCTCCAGCCCGTGCGG - Intergenic
1167425728 19:49428765-49428787 GACAGGGCCTCCAGACGCTGCGG - Exonic
1167586258 19:50377347-50377369 GGCGGGGCCTACAGCAGGGGCGG + Intronic
1168159809 19:54502845-54502867 CCGGGGGCCTCCTGCCCGTGGGG - Exonic
925405136 2:3601145-3601167 GCCGAGGCCCCCTGCCCGTGTGG - Intronic
925744078 2:7029948-7029970 GCCTGGGCCTCCAGTGGCTGTGG + Intronic
927911345 2:26902044-26902066 GGCGGGGCCTGCAGGTGGTGGGG - Intronic
928091408 2:28377227-28377249 GCCTGGCCCTCCTGACGGTGAGG + Intergenic
930156417 2:48111736-48111758 GCCGGGGGCGCCGGCCGGGGAGG - Intergenic
934862394 2:97775248-97775270 GCCGAGGCCTCCAACGGGCGAGG + Intronic
937141725 2:119607670-119607692 GCCAGGGGCTCCAGGGGGTGGGG - Intronic
938248743 2:129797852-129797874 TCCGGGGCCTCCAGCAGCTCGGG + Intergenic
939489700 2:142862305-142862327 GCCGGGCACTCCTGCCTGTGTGG + Intergenic
940619777 2:156097090-156097112 GCCGGGGCCTCCAGTGAATGGGG + Intergenic
942462536 2:176178266-176178288 GACGCGGCCGCCAGCCGGTAGGG - Intergenic
942612641 2:177757761-177757783 GCTGGGGCCCCCAGCCTGGGGGG + Intronic
946340115 2:219061038-219061060 GCCGGGGCCGCCCGCCCGAGGGG - Intergenic
948429755 2:237911960-237911982 GCGGTGGCCTCCAGCCAGGGGGG - Exonic
948642276 2:239383252-239383274 GCCAGGGCCTCCTGCTTGTGAGG - Intronic
948854405 2:240723472-240723494 TCCGGGGCCTCCAGCCTGCCAGG + Exonic
948876481 2:240832419-240832441 GGCGGGGCCTACAGCAGGCGGGG - Intergenic
948894346 2:240921359-240921381 GCTGGGGCCCCCATCAGGTGGGG - Intronic
948901148 2:240957513-240957535 GCCGGGGCGTCCAGGCAGCGGGG + Intronic
1169557678 20:6767899-6767921 GCCGGGTGCTCCAGCCCGCGCGG - Exonic
1169915003 20:10674841-10674863 GCCGGGGCGTCGGGCCGGGGAGG - Intergenic
1175251807 20:57614489-57614511 CCCTGGGGCTCCAGCCGGTAGGG + Intronic
1175869384 20:62201049-62201071 GCCAGGGCCGCCAGCCGCTCAGG + Exonic
1175936871 20:62518032-62518054 CCCTGGGCCCCCAGCCAGTGAGG + Intergenic
1175966329 20:62661832-62661854 CCCGGGGCCCTGAGCCGGTGGGG + Intronic
1176088284 20:63307800-63307822 GCCAGGGCCTCCACACGGAGGGG - Intronic
1176293708 21:5059533-5059555 GCCAGGGCCCACAGCAGGTGCGG + Intergenic
1178488594 21:33033805-33033827 GCCGGGGTCTCCAGCCGGTGGGG - Intergenic
1179863551 21:44204115-44204137 GCCAGGGCCCACAGCAGGTGCGG - Intergenic
1179891845 21:44339209-44339231 GCCGGGGGCGCCCGCCGGTCGGG - Exonic
1180008946 21:45037152-45037174 GCCCAGGCCTCCAGGTGGTGGGG + Intergenic
1183390836 22:37545108-37545130 GTCGGTGCCTCCAGGCGCTGGGG - Intergenic
1183395577 22:37569087-37569109 GCTGGGTCCTCCAGCTGGTGGGG - Exonic
1184257773 22:43296831-43296853 ACAGGGGCCTTCAGCAGGTGGGG + Intronic
1184783315 22:46659730-46659752 GTGGGGGCATCCAGCTGGTGTGG + Intronic
1185210517 22:49568308-49568330 GAGGGGGCCTCCAGCCATTGAGG - Intronic
950628714 3:14267247-14267269 CCCAGGGCCTCCAGCCGTGGAGG + Intergenic
954063705 3:48089254-48089276 GACCGGGCCACCAGCGGGTGGGG + Exonic
958123453 3:89324418-89324440 GCCTAGGCCTCCAGGCGCTGTGG + Intronic
961384795 3:126517452-126517474 TCCAGGGGCTCCAGCCTGTGCGG - Intronic
961664201 3:128486193-128486215 TCCAGGGCCTCCAGCAGCTGAGG + Exonic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
967085986 3:186095837-186095859 GCCCCAGCCTCCAGCTGGTGGGG - Intronic
968570917 4:1340332-1340354 GCCGGGGCCTCAAGACGCTGGGG - Intergenic
968653121 4:1767734-1767756 GCGGGGGGCTCCGGCCGGCGCGG - Intergenic
969604703 4:8196666-8196688 ACAGAGGCCTCCAGCTGGTGGGG + Intronic
980383988 4:132062842-132062864 GCAGGAGCCTCCCGCGGGTGTGG + Intergenic
984187592 4:176564941-176564963 CCCTTGGCCTCCAGCTGGTGTGG + Intergenic
987379997 5:17275841-17275863 GCCGGGGCCTCCACCGGCTTGGG - Exonic
989523118 5:42423874-42423896 GCCGGGGCCTCCGGCCCGCGTGG - Intronic
998143108 5:139710846-139710868 CCCGGCGCCTGCAGCCGGCGAGG + Intergenic
999272197 5:150302978-150303000 GCCGGGGCTTCCCGCCCGGGAGG - Intronic
999434339 5:151551452-151551474 GCCGAGGCCTCTAACCTGTGTGG + Exonic
1000014702 5:157266486-157266508 GCCGGAGCCGCCAGCCCGGGAGG + Intronic
1001548681 5:172586761-172586783 GCCAGGGCTTCCAACCAGTGAGG - Intergenic
1001594190 5:172887228-172887250 GCCGGCGGCTCCAGCCCTTGGGG - Intronic
1002279424 5:178121959-178121981 GCCGGGGACTCCAGGGTGTGGGG - Exonic
1002341108 5:178517030-178517052 GACGGGGCCTCCAGGCTGCGGGG + Intronic
1003508372 6:6758963-6758985 TCTGGGGCCTGCAGCAGGTGTGG + Intergenic
1004134976 6:12957562-12957584 GTGGCAGCCTCCAGCCGGTGGGG - Intronic
1006151330 6:31991781-31991803 CCCGGGGCCTCCTGAAGGTGGGG - Exonic
1006157631 6:32024519-32024541 CCCGGGGCCTCCTGAAGGTGGGG - Exonic
1007702008 6:43771124-43771146 GCCCGGGCCTCGGGCCGGGGAGG + Exonic
1017882049 6:158568763-158568785 ACTGGGGACTCCAGCCGCTGTGG + Intronic
1018017641 6:159727019-159727041 GCCGGGGCCACCTGCGGCTGCGG - Exonic
1018613168 6:165662566-165662588 GCCGGGGCCCCCAGCGGGGCTGG + Intronic
1018705938 6:166462980-166463002 GCAGCAGCCTCCAGCAGGTGGGG - Intronic
1018992450 6:168684584-168684606 GCAGGAGCCACCAGCAGGTGCGG - Intergenic
1019738661 7:2662381-2662403 GCTGGGGCCTCCAGCAGGGCAGG - Exonic
1021890833 7:25184862-25184884 CCCGGGGGCTCCAGCTGATGAGG + Intergenic
1025610545 7:63072637-63072659 GTGGAGGCCTCCAGCTGGTGGGG + Intergenic
1026948696 7:74333023-74333045 GCGTGGTCCTGCAGCCGGTGGGG - Intronic
1028622209 7:92836705-92836727 GCTGGGGGCCCCAGCCGGGGAGG + Intergenic
1028984921 7:97002180-97002202 GCCGGGGCCTTGAGCCCCTGAGG + Intergenic
1029264308 7:99326141-99326163 GCCGGGGCCTCCTGAGGGGGCGG + Intronic
1032037776 7:128532053-128532075 GCCGAGGCCTCCAGCTGCCGAGG - Intergenic
1032082952 7:128869244-128869266 GCCGCGTCCTCCTGGCGGTGCGG + Intronic
1033399434 7:141007812-141007834 GACGGGGCCTGCAGTAGGTGGGG - Intronic
1034433271 7:151051352-151051374 GCCGGGGGCTCCCGACGGGGCGG + Intronic
1045353196 8:101361140-101361162 GCCGGGGCCACCTGCCTGAGAGG - Intergenic
1048443880 8:134479007-134479029 CCCGGGGCTTCCAGGAGGTGTGG + Intronic
1052122777 9:24738629-24738651 GCCGGTGCCTCCAGCCGTGCCGG + Intergenic
1053003313 9:34589670-34589692 GGCGGCGGCTCCAGCCGGCGCGG - Exonic
1053398907 9:37800748-37800770 GCGCGGGTTTCCAGCCGGTGGGG + Exonic
1060936078 9:127517061-127517083 GACGGGACCTGCAGCTGGTGCGG - Intronic
1061329937 9:129885954-129885976 GCCGGCTCCTCCAGCGGGTCAGG - Intergenic
1061666083 9:132161806-132161828 GCCGGGGCATCCCCCCGGCGCGG - Intronic
1061693700 9:132355253-132355275 CCCGGGGCTTCCTGCGGGTGGGG + Intergenic
1061843924 9:133376240-133376262 GGCGGGGCCTCCAGCGTGAGAGG - Intergenic
1061974698 9:134062261-134062283 GCCGGGCCCTCCAGGCGGCCAGG - Intronic
1062209480 9:135356013-135356035 GCCGGGGGCTCCGGCTGGGGAGG - Intergenic
1062226564 9:135455737-135455759 GCCGGGAACTCCAGCGGGAGGGG - Intergenic
1062364813 9:136203498-136203520 GCAGGGTCCTCCCGCCGCTGAGG + Intronic
1062462624 9:136668259-136668281 GCCTGTGCCTCCAGGCGGGGTGG - Exonic
1203778285 EBV:86181-86203 GCCGGGGCCTCCATCCAGTGGGG + Intergenic
1190308779 X:49101891-49101913 GCCGGGGCCTCTCGTTGGTGGGG + Intergenic
1195599213 X:106726932-106726954 GCCGGGGTCTCCTGCCGCGGTGG + Exonic