ID: 1094027659

View in Genome Browser
Species Human (GRCh38)
Location 12:25975911-25975933
Sequence GACACTGTGCTGCTTCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094027659_1094027664 18 Left 1094027659 12:25975911-25975933 CCTTTGGGAAGCAGCACAGTGTC 0: 1
1: 0
2: 0
3: 14
4: 260
Right 1094027664 12:25975952-25975974 GATGAGACTAGACAGAAATGGGG 0: 1
1: 0
2: 4
3: 24
4: 272
1094027659_1094027662 16 Left 1094027659 12:25975911-25975933 CCTTTGGGAAGCAGCACAGTGTC 0: 1
1: 0
2: 0
3: 14
4: 260
Right 1094027662 12:25975950-25975972 GGGATGAGACTAGACAGAAATGG 0: 1
1: 0
2: 1
3: 37
4: 296
1094027659_1094027663 17 Left 1094027659 12:25975911-25975933 CCTTTGGGAAGCAGCACAGTGTC 0: 1
1: 0
2: 0
3: 14
4: 260
Right 1094027663 12:25975951-25975973 GGATGAGACTAGACAGAAATGGG 0: 1
1: 0
2: 1
3: 14
4: 222
1094027659_1094027660 -5 Left 1094027659 12:25975911-25975933 CCTTTGGGAAGCAGCACAGTGTC 0: 1
1: 0
2: 0
3: 14
4: 260
Right 1094027660 12:25975929-25975951 GTGTCTAGACTCAGTCAGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1094027659_1094027661 -4 Left 1094027659 12:25975911-25975933 CCTTTGGGAAGCAGCACAGTGTC 0: 1
1: 0
2: 0
3: 14
4: 260
Right 1094027661 12:25975930-25975952 TGTCTAGACTCAGTCAGCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094027659 Original CRISPR GACACTGTGCTGCTTCCCAA AGG (reversed) Intronic
900472313 1:2860995-2861017 GCCTCTGTGCTGCTTCCCTCTGG + Intergenic
900742943 1:4341792-4341814 GCCTCGGTGCTGCTTCCCCAGGG - Intergenic
900752038 1:4404448-4404470 GACAGTGTGCTGATTCCTCAAGG + Intergenic
901428140 1:9196584-9196606 GAAACCGAGCTGCTTCCCATGGG - Intergenic
901697559 1:11020444-11020466 AACACTTTTCTGCTTCTCAAAGG - Exonic
901965077 1:12859765-12859787 GGCCCTGTCCTGCTTCCCAGAGG + Exonic
902079777 1:13813092-13813114 GACACTGTGCTGATACCTACTGG + Intronic
902155457 1:14482007-14482029 GACATGGTAATGCTTCCCAAAGG + Intergenic
902317012 1:15629139-15629161 GACACTGTTTAGCTCCCCAAGGG + Intronic
903226360 1:21896110-21896132 GAGACTGTGCTTCTTCCCACTGG - Intronic
903988944 1:27251531-27251553 GGCACTGTGCTCCGGCCCAAAGG - Intronic
904986715 1:34556787-34556809 GACACTGTGGTGATTCCTCAAGG + Intergenic
905509783 1:38509956-38509978 GTCACTGTGCAGGTGCCCAAGGG + Intergenic
905708247 1:40078752-40078774 GCCACTGTGTTTCTTCCCCATGG + Intronic
905853811 1:41293980-41294002 GACTCTGGGCTGCCTTCCAAGGG - Intergenic
908279811 1:62520685-62520707 GACAGTGTGCTGATTCCTGAAGG + Intronic
909842370 1:80344523-80344545 GACAGTGTGGTGATTCCCCAAGG + Intergenic
912117567 1:106425735-106425757 GACAGTGTGGTGATTCCCCAAGG + Intergenic
914955680 1:152159978-152160000 GACACTGTGCTGGCATCCAAGGG - Intergenic
918805408 1:189034854-189034876 GACAGTGACCTGCTTCTCAAGGG - Intergenic
919140978 1:193571300-193571322 GACAGTGTGGTGATTCCTAAAGG - Intergenic
919332323 1:196187839-196187861 GACACTGTGGTGATTCCTCAAGG - Intergenic
919602404 1:199638433-199638455 GACAGTGTGGTGATTCCTAAAGG + Intergenic
919894369 1:201999809-201999831 GACACTGTGCTGCCTCCTTGTGG - Intronic
920742867 1:208598024-208598046 GACACTGTGCAGGTTCACACTGG - Intergenic
920876981 1:209845534-209845556 GAGACTGTCCTGCTTACAAAGGG - Intronic
921593436 1:217029456-217029478 GACACTGAACTGCTTCCAAATGG + Intronic
922503152 1:226111041-226111063 GTCACGGTGCTGCTGCCCAACGG + Intergenic
922716567 1:227877727-227877749 GACACTGTGGTGATTCCTCAAGG + Intergenic
924425134 1:243943713-243943735 GACAGAGTGCTGCAACCCAAGGG - Intergenic
1062954892 10:1533570-1533592 GACTCTGCGATGCCTCCCAAGGG + Intronic
1064930315 10:20618681-20618703 TACAATGTACTACTTCCCAAAGG + Intergenic
1065876638 10:30002683-30002705 GACTCTGTTCTGCTCCCCATGGG - Intergenic
1066453265 10:35550375-35550397 GACCCTGTGCTGCTTGCTGATGG + Intronic
1067934960 10:50602307-50602329 GAGAATGTTCTGCTTCCCACAGG + Intronic
1068026957 10:51658137-51658159 TTCACTGTACTGCTTGCCAATGG - Intronic
1069508558 10:69023054-69023076 TACCCTGTGCTGCTGACCAAAGG + Intergenic
1072387896 10:94951006-94951028 GACAGTGTGCTGATTCCTCAAGG + Intronic
1073927191 10:108530886-108530908 GACAGTGTGGTGATTCCCCAAGG + Intergenic
1075499978 10:122964665-122964687 GGCTCTGTGCTGCTTCCAGATGG - Intronic
1075622536 10:123938606-123938628 GACACTGTGCACCTGGCCAAGGG + Intronic
1075818373 10:125284024-125284046 GTCAGTGTCCTGCTTGCCAATGG + Intergenic
1076047862 10:127308995-127309017 GACACTGTGGTGATTCCTCAAGG - Intronic
1076168525 10:128301586-128301608 GATACGGTGCTGATCCCCAAAGG + Intergenic
1077186301 11:1236854-1236876 GGCTCTGTGCTGCCTCCCACGGG + Intronic
1077418046 11:2434869-2434891 GGCGGTGTGGTGCTTCCCAATGG - Intergenic
1078006315 11:7535089-7535111 GATACTGAGCTGTTTCCCAGGGG + Intronic
1078560897 11:12371521-12371543 GACAGTGTGGTGATTCCCTAAGG + Intergenic
1079690293 11:23408385-23408407 GACACTGTGGTGATTCCTCAAGG - Intergenic
1080220330 11:29895513-29895535 TTCACTGTTCTGTTTCCCAATGG + Intergenic
1084563224 11:69915622-69915644 GACACTGTGCTGCCCCCTAGAGG - Intergenic
1087201804 11:95352994-95353016 GACAGTGTGCAGCAACCCAAGGG + Intergenic
1088674355 11:112177839-112177861 TACACTGTGCTGCCTCTTAAGGG + Intronic
1091046606 11:132331033-132331055 GCCACTGGGCTGCTTCCCGCAGG - Intronic
1091867774 12:3856710-3856732 GACACTGTGGTGATTCCTCAAGG + Intronic
1093693404 12:22133157-22133179 GACAGTGTGGTGCTTCCTCAAGG - Intronic
1094027659 12:25975911-25975933 GACACTGTGCTGCTTCCCAAAGG - Intronic
1094755924 12:33468295-33468317 GACAGTGTGGTGATTCCCCAAGG + Intergenic
1095650160 12:44598326-44598348 GAGTCTGTACTTCTTCCCAAAGG - Intronic
1097227928 12:57489835-57489857 GACACTCAGTTTCTTCCCAATGG - Intronic
1097513016 12:60567370-60567392 GACATTGTGCTCCTACCCTAAGG + Intergenic
1099511547 12:83544934-83544956 GACACTGTGGTGATTCCTCAAGG - Intergenic
1099949209 12:89281578-89281600 GGCACAGTGATGTTTCCCAAAGG + Intergenic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1106770643 13:32957910-32957932 GAGACTGTGCTGCCTAACAAGGG - Intergenic
1109034351 13:57235488-57235510 GACAGTGTGGCGATTCCCAAAGG + Intergenic
1109118813 13:58427377-58427399 GACAGTGTGCTGATTCCTCAAGG + Intergenic
1109464037 13:62704415-62704437 GCTACTGTGCTGCATACCAAGGG - Intergenic
1111393142 13:87625784-87625806 GTCACAGTGTTGCTTTCCAAGGG - Intergenic
1111704556 13:91732092-91732114 GACAGTGTGGTGCTTCCTCAAGG - Intronic
1112715237 13:102177301-102177323 GACACTGTGTAGCTTCCAGAGGG - Intronic
1112863248 13:103861592-103861614 GACATTCTTCTGCTTCACAAAGG - Intergenic
1113946654 13:114048368-114048390 GACTCTCTGAGGCTTCCCAATGG - Intronic
1114059340 14:19005138-19005160 GACAGTGTGCTGATTCCTCAAGG - Intergenic
1114103207 14:19396613-19396635 GACAGTGTGCTGATTCCTCAAGG + Intergenic
1115124705 14:29977909-29977931 GACAGTGTGGTGCTTCCTCAAGG + Intronic
1115880387 14:37910543-37910565 GACCTTGGGCTGCCTCCCAATGG - Intronic
1115953460 14:38748500-38748522 GACACTGTGGTGATTCCTCAAGG - Intergenic
1118515591 14:66525057-66525079 GACACTGTGGTGATTCCTCAAGG - Intronic
1119919902 14:78437113-78437135 GGCACTGTGCTGTCTTCCAAAGG - Intronic
1121224277 14:92309780-92309802 GACTCTGTGCAGCTGCCCACAGG + Intergenic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1124439571 15:29676179-29676201 GGCACTGTGCTGAGTCCCAGCGG + Intergenic
1126230266 15:46315458-46315480 GCCTCTCTGCTGCTTCCCCAAGG - Intergenic
1127758193 15:62113247-62113269 GAGACAGTGCTGCTGACCAAGGG - Intergenic
1128054754 15:64691363-64691385 TCCACTGTGCTGCTGCTCAAGGG - Intronic
1129223912 15:74154355-74154377 GCCACTGTGCTTCTTCTTAATGG + Intergenic
1129498631 15:76013901-76013923 GACAGTGTGGTGATTCCCCAAGG - Intronic
1130168652 15:81488298-81488320 GACAGTGTGGTGATTCCCCAAGG - Intergenic
1130572786 15:85063432-85063454 GGCACTGGGCTGCTACCCAGGGG - Intronic
1130677940 15:85970369-85970391 GACACTGTGGTGATTCCTCAAGG - Intergenic
1132023970 15:98389061-98389083 GACACCATTCTGCTTTCCAAGGG - Intergenic
1136589512 16:31209208-31209230 GACAGTGTGCTGGCACCCAAGGG - Intergenic
1137374301 16:47939651-47939673 GAAACTGTGCTGTTGCCCAAAGG + Intergenic
1137809050 16:51335375-51335397 GACAGTGTGGTGATTCCCCAAGG + Intergenic
1139701671 16:68711576-68711598 GCCTCTGTTCTGCTTCCCACTGG + Intronic
1140384110 16:74518917-74518939 GACACTGTGATGATTCCTCAAGG + Intronic
1141569352 16:84924956-84924978 GCCACGGGCCTGCTTCCCAAAGG - Intergenic
1142383693 16:89748807-89748829 TACACTCTGCTCCTTCCCAAGGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143636514 17:8166933-8166955 CACACTGCCCTGCTTCCCAGTGG - Intergenic
1144148053 17:12417118-12417140 GACACTGTGCTGGTTCCTAGGGG + Intergenic
1144277602 17:13689030-13689052 GACACTGTGCTACCTGCCCAGGG - Intergenic
1149546689 17:57509078-57509100 GGCAAAGTGCTGCTTCTCAAGGG + Intronic
1150599768 17:66640743-66640765 AACACTGTGCTTGTCCCCAAGGG + Intronic
1152809476 17:82374793-82374815 GACACCGTGCAGCGCCCCAAGGG + Exonic
1154001948 18:10489200-10489222 GTCAGTGTGCTGCTTTCCTAGGG + Exonic
1156259024 18:35427400-35427422 GCCACTATTCTGCCTCCCAAAGG - Intergenic
1156360115 18:36377510-36377532 GACAATTTGCTGCTTCCCATAGG - Intronic
1159749205 18:72279671-72279693 GACAGTGTGGTGATTCCCCAAGG + Intergenic
1160275545 18:77430406-77430428 GACAGTGTGGTGATTCCTAAAGG + Intergenic
1163914665 19:20230450-20230472 GACAGTGTGGTGATTCCCCAAGG + Intergenic
1166650425 19:44570252-44570274 GCCTCCCTGCTGCTTCCCAAGGG + Intergenic
1168224856 19:54987352-54987374 GCCACTGGACAGCTTCCCAAGGG - Intronic
1168641065 19:58032047-58032069 GACACCAGGCTGCCTCCCAATGG + Intergenic
925059568 2:880597-880619 GACTGTGGGCTGCTTCCCATAGG + Intergenic
925505325 2:4556164-4556186 GACAGTGCCCTGCTTCCCAGAGG - Intergenic
928690671 2:33795146-33795168 GACACAGTGTTTCTTCCCCATGG - Intergenic
929799426 2:45086773-45086795 GACAGTGTGGTGATTCCCCAAGG + Intergenic
930332265 2:50000238-50000260 TACATTGTGCTTCTTTCCAATGG + Intronic
932369615 2:71176351-71176373 GCCACTGAGCAGCTTCCCAAAGG - Intergenic
932869754 2:75386813-75386835 GACAGTGTGGTGCTTCCTCAAGG - Intergenic
933530319 2:83501660-83501682 GACACAGTGCTGGTCCCCAGGGG + Intergenic
935273392 2:101454455-101454477 GACAGTGTGGTGCTTCCTCAAGG - Intronic
935539954 2:104337360-104337382 GACACTGTGGTGTTTGCAAAGGG + Intergenic
936720041 2:115240161-115240183 GACACTGTGGTGATTCCTCAAGG - Intronic
937717079 2:125044801-125044823 GCCACTGTGCTTATTCCCCAAGG + Intergenic
938344015 2:130554087-130554109 GCCACTTGGCTGCTTCCCACAGG + Intergenic
938345818 2:130566635-130566657 GCCACTTGGCTGCTTCCCACAGG - Intergenic
938948128 2:136232902-136232924 GAAATTGTTCTGCTTGCCAATGG + Intergenic
940462482 2:153983875-153983897 AATACTGTGCTTCTTCCTAAAGG + Intronic
940996312 2:160154015-160154037 GACAGTGTGGTGATTCCCCAAGG + Intronic
946794686 2:223337775-223337797 GACACCCTGGAGCTTCCCAAAGG - Intergenic
948477897 2:238232287-238232309 AACACTTTTCTGCTTCTCAAAGG - Intergenic
948922232 2:241071203-241071225 GACACAGTGCTTCTCCCCAGTGG - Intronic
1170179782 20:13517066-13517088 TGCACTGTGGCGCTTCCCAAAGG - Intronic
1170769076 20:19316629-19316651 GACTCTGTGCTCCTGCCCAGGGG - Intronic
1173440407 20:43070407-43070429 GACACTGTGGTGATTCCTCAGGG + Intronic
1174552301 20:51370759-51370781 GAGACAGTGATGCTTTCCAAGGG - Intergenic
1175315501 20:58044064-58044086 GCCTCTGTGCTACTTCCCAGAGG - Intergenic
1177859922 21:26440368-26440390 GACACTGTGGTGATTCCTCAAGG - Intergenic
1178250981 21:31003321-31003343 GACACAGTTCTGGTTCCCCAAGG + Intergenic
1180840336 22:18956113-18956135 GCCACTGTGCTGCAGCCCCAAGG - Intergenic
1181061152 22:20282663-20282685 GCCACTGTGCTGCAGCCCCAAGG + Intronic
1181716369 22:24732950-24732972 GAAGCTTTGCTGGTTCCCAATGG + Intronic
1182416277 22:30223366-30223388 GACAGCGGGCTGCTTCCCAGGGG - Intergenic
1182852545 22:33488073-33488095 AACACTTTGCTGGTGCCCAAAGG + Intronic
1183062398 22:35344328-35344350 GGCACCGTGCTGCTCTCCAAGGG + Intronic
1183594182 22:38800115-38800137 GAAAGGGTGCTGTTTCCCAAAGG - Intergenic
1183970319 22:41472456-41472478 GGCACTATGCTGCTTCCCTTTGG + Intronic
1184458605 22:44625059-44625081 TACCCTGAGCTGCTGCCCAAGGG + Intergenic
1185220002 22:49624446-49624468 GGCACTGTGCCTCCTCCCAAAGG - Exonic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
950952602 3:17016511-17016533 GCCACTGTGCTGAGTGCCAAAGG + Intronic
951462380 3:22965133-22965155 AACACCGTGCTGCTTCCCATTGG - Intergenic
952536811 3:34320065-34320087 TAGACTGTGCTCCTGCCCAAGGG - Intergenic
953659859 3:44884018-44884040 GACGCTGTGCTGCTGGCCCAGGG - Intronic
954699430 3:52443602-52443624 GACACTCTGGGCCTTCCCAAAGG - Intronic
954916476 3:54152142-54152164 GACACTGAGCTCCTTCCTAGAGG + Intronic
955499868 3:59573039-59573061 GACACTGTGCTGGTGAACAATGG - Intergenic
955938291 3:64123517-64123539 GATACTGTGATGCTTACGAATGG + Intronic
956126867 3:66018868-66018890 GACACACTGTGGCTTCCCAAAGG - Intronic
956795093 3:72710900-72710922 GACACTGTGGTGATTCCTCAAGG - Intergenic
957597036 3:82279737-82279759 GACACTGTGGTGATTCCTCAGGG - Intergenic
957662983 3:83184786-83184808 GAGACTGGGCTGCTTACAAAAGG - Intergenic
958136687 3:89503236-89503258 GACACTGTGGTGATTCCTCAAGG + Intergenic
961556773 3:127701501-127701523 AACCCTGTGGTGCTTCCCATGGG + Intronic
961783783 3:129337340-129337362 CACCCTGTGATGCTTCCAAATGG - Intergenic
961804271 3:129477543-129477565 GACACTGTGAAGCTGCCCAAGGG - Intronic
962281918 3:134058542-134058564 GGCACTGCTCTGCTGCCCAACGG - Intergenic
962422613 3:135241546-135241568 GACAATGGGCTGTTTCCAAATGG + Intronic
963401444 3:144803961-144803983 GACACTGTGGTGATTCCTCAAGG - Intergenic
964262368 3:154853734-154853756 GACACTGTGGTGATTCCTCAAGG - Intergenic
964265867 3:154894705-154894727 ATAACTGTGCTGCTTGCCAAAGG + Intergenic
967272706 3:187744163-187744185 GACTCTGTGTTGGCTCCCAATGG - Intronic
967994218 3:195154587-195154609 CACACTGCGCTCCCTCCCAAGGG + Intronic
969500509 4:7549778-7549800 GATACGGTGCTGGTCCCCAAGGG - Intronic
969520159 4:7673411-7673433 TCCACTGAGCTGCTTCCCTACGG - Intronic
969960966 4:10944512-10944534 AACAGTTTGCTGCTTCCCATAGG + Intergenic
974420251 4:61663424-61663446 GCACCTGTGCTGCTGCCCAAAGG + Intronic
978338480 4:107696154-107696176 GACAGTGTGGTGCTTCCTCAAGG + Intronic
979107014 4:116701767-116701789 GCCAGGGTGCTGATTCCCAAGGG + Intergenic
979462198 4:120996621-120996643 GACAGTGTGGTGATTCCCCAAGG - Intergenic
981289918 4:143062920-143062942 GACACTGTGGTGATTCCTCAAGG + Intergenic
981342255 4:143634860-143634882 GTCACTGTGGTCCTTCCAAATGG + Intronic
985196764 4:187438686-187438708 GACACTGTTCTTATTCTCAAAGG - Intergenic
985991619 5:3566437-3566459 GAAACACTGCTGCTTACCAAGGG + Intergenic
989685542 5:44082269-44082291 GACACTGTGGTGATTCCTCAAGG - Intergenic
989688435 5:44114721-44114743 GACACTCTGCTGGATCCAAAGGG - Intergenic
990233145 5:53737036-53737058 GACAATGTGGTGCTTCCTCAAGG + Intergenic
991162985 5:63527035-63527057 GACACTGTGGTGATTCCTCAAGG + Intergenic
992186736 5:74251543-74251565 GATACTGTGCTGATTCCAATAGG - Intergenic
994742100 5:103632923-103632945 GACACTTTCCTGCTTAGCAATGG - Intergenic
995675985 5:114663182-114663204 GATGCTGTGCTGCTTCCCTCTGG + Intergenic
995689886 5:114813691-114813713 GACACTGTGGTGATTCCTCAAGG - Intergenic
996225097 5:120983354-120983376 GACAGTGTGGTGCTTCCTCAAGG + Intergenic
996462039 5:123756456-123756478 GATTCTGGGCTGCTTCCAAATGG + Intergenic
996671718 5:126125184-126125206 GACATTGTGCTATTACCCAAGGG - Intergenic
997736468 5:136216090-136216112 GGCACTGTGCTCCTTTCCAGAGG - Intronic
998769304 5:145524003-145524025 AAATCTGTGCTGCTTCTCAAAGG + Intronic
998844449 5:146293475-146293497 AACACAGTGTTGCTCCCCAAGGG - Intronic
999162779 5:149518613-149518635 AACACTTTGCTTCTTCCCCATGG + Intronic
999971984 5:156873512-156873534 GACAGTGTGGTGATTCCCCAAGG - Intergenic
1001157356 5:169284312-169284334 GACCCTGAGCTCCTTTCCAAAGG + Intronic
1001678014 5:173534571-173534593 TATACTCTGCTGCTTTCCAAGGG - Intergenic
1002439301 5:179256088-179256110 GACACGGTCCTTCTTCCCACAGG + Intronic
1003173946 6:3741074-3741096 GAGACTGGGGTGCTGCCCAAGGG - Intronic
1004291033 6:14367616-14367638 GACCCTGTGCTGCTTTCAAGGGG + Intergenic
1005322736 6:24671044-24671066 GACACTGTGGTGATTCCTCAAGG + Intronic
1007221871 6:40285198-40285220 GACACAGTGCTGGGTCCCCAGGG + Intergenic
1009656093 6:66546503-66546525 GACACTGTGGTGATTCCTCAAGG + Intergenic
1009746108 6:67818264-67818286 TACACTATGCTGCCTCTCAAGGG - Intergenic
1009955988 6:70453971-70453993 GACACTGTGGTGATTCCTCAAGG - Intronic
1010109776 6:72212880-72212902 GGCACTGTGCAGTTACCCAAAGG - Intronic
1011147896 6:84239063-84239085 GACAGTGTGGTGATTCCTAAAGG + Intergenic
1011194398 6:84766687-84766709 GAGACTCTGCTGCTGCCCAGGGG + Intergenic
1012685837 6:102247518-102247540 GACAGTGTGCTGATTCCTCAAGG + Intergenic
1013613767 6:111822062-111822084 GACACTGTGGTGATTCCTCAAGG + Intronic
1014065150 6:117116156-117116178 GACAATGTGGTGATTCCCCAAGG + Intergenic
1016294493 6:142560264-142560286 GACACTGTGGTGATTCCTCAAGG - Intergenic
1018246377 6:161828502-161828524 GCCACTGTGCTTCTGCCCAAAGG + Intronic
1019629148 7:2037387-2037409 GATACTGTGCTTCTTACAAATGG + Intronic
1020966996 7:14883352-14883374 ACCACTGTGCTCCATCCCAAAGG - Intronic
1021098896 7:16565585-16565607 AACTATGTGCTGATTCCCAAGGG + Intronic
1022220306 7:28307735-28307757 GGCACTGTGCTGGGTCCCAGAGG + Intronic
1023037783 7:36148095-36148117 GAGACTGGACTGCTTCCCCAGGG + Intergenic
1024347319 7:48326179-48326201 TCCAGTGTGCTGCTTCCAAAAGG - Intronic
1024630460 7:51242960-51242982 GACTTTGGGCAGCTTCCCAAGGG - Intronic
1026221664 7:68403292-68403314 GACACAGTGTTTCTTCCCTATGG + Intergenic
1029038974 7:97553123-97553145 TACATTATGCTGGTTCCCAATGG + Intergenic
1029375092 7:100172298-100172320 AACACTTTGCTGCTTCTCTAAGG - Intronic
1030266706 7:107629092-107629114 GCCACTGGGCTGCATCCCCAGGG - Intronic
1031152439 7:118070024-118070046 GACAGTGTGGTGATTCCCCAGGG + Intergenic
1032322289 7:130896438-130896460 GACACTGTGCTATTACACAAGGG + Intergenic
1039987989 8:42464055-42464077 GACAGAGTGTTTCTTCCCAAAGG + Intronic
1040355447 8:46613462-46613484 GACACTGTGGTGATTCCTCAAGG + Intergenic
1042036176 8:64536547-64536569 GACAGTGTGCTGATTCCTCAAGG - Intergenic
1043841523 8:85110684-85110706 GACAATATGCTGCATTCCAAAGG + Intronic
1044828497 8:96221820-96221842 GCCACTGTGCTGAATCCAAATGG - Intergenic
1045823434 8:106368960-106368982 GACACTGTGGTGATTCCTCAAGG - Intronic
1047231122 8:122998966-122998988 GACAGTGTGGTGATTCCTAAAGG - Intergenic
1048000843 8:130378392-130378414 GACACTGAGCTGCCTCCTGAAGG + Intronic
1048323452 8:133420396-133420418 GACACTGTGAGGTTTCCCATTGG - Intergenic
1048919174 8:139212201-139212223 CACAGGGTGCTGCTTCCCTATGG - Intergenic
1049999957 9:1066717-1066739 GACACTGTGATGATTCCTCAAGG - Intergenic
1050265085 9:3881490-3881512 GAAAGTGTGCTGCTTCTCAGAGG + Intronic
1052516943 9:29494173-29494195 GACACTGTGGTGATTCCTCAAGG + Intergenic
1053049642 9:34949430-34949452 GACAGTGTGCTGATTCCTCAAGG + Intergenic
1053354040 9:37431576-37431598 CACACTGTGGTGCTTCTCAGTGG + Intronic
1055155256 9:73055049-73055071 GACATTGTCCTGCTTGCCAACGG - Intronic
1055208932 9:73765762-73765784 GACACTGTGATGATTCCTGAAGG + Intergenic
1056430825 9:86526440-86526462 GCCATTATGCTGCCTCCCAAAGG + Intergenic
1056810416 9:89759602-89759624 CCCTCTGTGCTGCTACCCAAGGG - Intergenic
1185468885 X:370938-370960 GACACTGTCCGGCGTCCCCACGG - Intronic
1187432397 X:19237100-19237122 GAGCCTTAGCTGCTTCCCAAAGG + Intergenic
1190982027 X:55464543-55464565 GACACTGTGGTGCTTGAGAAGGG + Intergenic
1190986671 X:55508637-55508659 GACACTGTGGTGCTTGAGAAGGG - Intergenic
1191120790 X:56902299-56902321 GACACTGTGATGATTCCTCAAGG + Intergenic
1191973945 X:66849524-66849546 GACAGTGTGGTGCTTCCTCAAGG - Intergenic
1192059659 X:67811250-67811272 CACACTTTGCTGTTTCCAAATGG - Intergenic
1193647944 X:84091623-84091645 GACAGTGTGGTGATTCCTAAAGG + Intronic
1194594252 X:95837498-95837520 GGCTCTGTGCTGCTCCCCACTGG + Intergenic
1194706369 X:97180120-97180142 GACAGTGTGCTGATTCCTCAAGG - Intronic
1194949651 X:100109952-100109974 GACAGTGTGGTGATTCCTAAAGG - Intergenic
1195826456 X:109006344-109006366 GACACTGTGGTGATTCCTCAAGG + Intergenic
1195887736 X:109657776-109657798 GACACTGTGGTGATTCCTCAAGG - Intronic
1196414048 X:115452206-115452228 GACACTGGTTTGCTTCTCAAAGG + Intergenic
1197197948 X:123722149-123722171 GACAGTGTGGTGATTCCCCAAGG + Intronic
1199763492 X:150923760-150923782 CTCTCTGTGCAGCTTCCCAAGGG - Intergenic
1199808613 X:151327317-151327339 TCCACTCTGCTGCTTCCCTAGGG - Intergenic
1199860906 X:151799904-151799926 GACTCTGTGCTGGGTCCCAGGGG - Intergenic
1199900682 X:152169087-152169109 TACACTGTGCTGCTTTCTATAGG + Intronic
1199940794 X:152625762-152625784 GACACGGTGCTGGTTCACAATGG - Intergenic
1201734221 Y:17239983-17240005 GACAGTGTGGTGATTCCTAAAGG - Intergenic