ID: 1094030847

View in Genome Browser
Species Human (GRCh38)
Location 12:26010034-26010056
Sequence GGTGGCATCCTGATGCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094030845_1094030847 -4 Left 1094030845 12:26010015-26010037 CCTGGAGTGAGGGTGAGGGGGTG 0: 1
1: 0
2: 4
3: 87
4: 615
Right 1094030847 12:26010034-26010056 GGTGGCATCCTGATGCCCACAGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094030847 Original CRISPR GGTGGCATCCTGATGCCCAC AGG Intronic
900523551 1:3117490-3117512 GGTGGCATGGCGATGCCCCCAGG - Intronic
900606881 1:3527683-3527705 GGGGGCAGACTCATGCCCACTGG + Intronic
901186829 1:7378997-7379019 GGTGCCACCCTGAGGCGCACAGG - Intronic
901509662 1:9710519-9710541 GTTGACTTCCTGCTGCCCACAGG + Exonic
902195345 1:14794087-14794109 GGTTGCATCCTGAGGAGCACAGG - Intronic
906318649 1:44803663-44803685 CCTGGCATCCTGATGGCCAACGG - Exonic
906645951 1:47475216-47475238 TGTAGCATCCTGTTGCCCTCAGG + Intergenic
913218071 1:116637125-116637147 GATGGAATCTTGAGGCCCACTGG + Intronic
915715597 1:157941770-157941792 TGTGGCAGCCTGAAGTCCACAGG + Intergenic
916172480 1:162011225-162011247 CAGGGAATCCTGATGCCCACAGG - Intronic
916503820 1:165409615-165409637 GATGGCATCCTTCTGGCCACGGG - Exonic
917928138 1:179805939-179805961 GGCGGCCTCCAGATGCCCAGAGG - Intronic
918038160 1:180895551-180895573 GCTTGCATTCTGATACCCACTGG - Intergenic
920339614 1:205267761-205267783 GGTGCCACCCTGATGCACTCGGG + Intronic
1064155036 10:12896925-12896947 GGTGGCAGGCTGCTGTCCACGGG - Exonic
1065944391 10:30593663-30593685 GGTGGCGTCCGGATGCCAAGGGG - Intergenic
1067046842 10:42989883-42989905 GGTGGCAGCCTGCAGCCCTCTGG - Intergenic
1067689657 10:48493623-48493645 GGCCTCAGCCTGATGCCCACAGG - Intronic
1070565968 10:77604102-77604124 GTTGGCATCCTGCTGCACACAGG - Intronic
1074094825 10:110302296-110302318 ACTGGCACCCTGAAGCCCACAGG + Intronic
1075827400 10:125370896-125370918 TGTGGCTTCATGATGCCCCCTGG + Intergenic
1075991430 10:126842020-126842042 GGCAGCTTCCTGGTGCCCACTGG - Intergenic
1076258175 10:129045139-129045161 GGTGGCATCCAGAGGCACGCTGG - Intergenic
1076659296 10:132044616-132044638 GGTGGCGTCCTGCTGCCCTGAGG - Intergenic
1076892888 10:133293486-133293508 GGTCCCATCCTGATGACCATGGG - Intronic
1077354484 11:2108877-2108899 GGAGGCATCCTGAGGCCCTGGGG + Intergenic
1078985806 11:16595575-16595597 GGTGGTATCTTGTTGCCCAGGGG - Intronic
1082690474 11:56296765-56296787 TCTGCCATCCTGCTGCCCACTGG + Intergenic
1083622865 11:64057564-64057586 GCTGGCATCCTGAGGCCATCTGG + Intronic
1084064708 11:66697173-66697195 GTTGGGCTCCTGATGCCCATGGG + Intronic
1084273830 11:68042095-68042117 TGTGGCTTCCTGGCGCCCACAGG - Intronic
1084450777 11:69235325-69235347 GGAGGCATGGTGATGACCACAGG - Intergenic
1084728922 11:71060652-71060674 GCTGTCAGCCTGAGGCCCACAGG + Intronic
1084996832 11:72988562-72988584 AGTGGCATCCTGAGGATCACAGG + Intronic
1089270483 11:117298565-117298587 TGTGCCATCCTGGTCCCCACAGG - Intronic
1089322248 11:117634292-117634314 CGAGTCTTCCTGATGCCCACTGG - Intronic
1089662703 11:119995977-119995999 GATGACATCTTCATGCCCACAGG + Intergenic
1092214954 12:6674672-6674694 CCAGGCATCCTGATTCCCACTGG - Intronic
1094030847 12:26010034-26010056 GGTGGCATCCTGATGCCCACAGG + Intronic
1095579568 12:43781379-43781401 GCTGGTATCCTGTTGCTCACAGG + Intronic
1095631455 12:44381601-44381623 GTTGGCACGATGATGCCCACGGG + Intronic
1096650492 12:53059863-53059885 CGGGGCATGGTGATGCCCACAGG - Exonic
1097021951 12:56026942-56026964 GGGGGCATCCGGCTGCCCAATGG + Exonic
1104612550 12:130241306-130241328 GGTGGCTTCCTGAAGCCAAGGGG + Intergenic
1106624482 13:31406559-31406581 GGTAGCTTCCTGATGGCCAGTGG - Intergenic
1112561057 13:100514387-100514409 CCTGCCATCATGATGCCCACAGG + Intronic
1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG + Intergenic
1119674515 14:76543971-76543993 GGGGGCATCGTGAGGCCCAGGGG - Intergenic
1127066763 15:55248165-55248187 GGTGGCATGCTAAAGCACACAGG + Intronic
1127068601 15:55265915-55265937 GGTGGCCTTCTGTTGCCCAGAGG - Intronic
1129470184 15:75749324-75749346 TGTGGCAACCTGGGGCCCACAGG - Intergenic
1131255572 15:90859792-90859814 GGTGGCAGCCAGGTCCCCACAGG + Intergenic
1133946197 16:10350576-10350598 GGTGTCATTCTGTTGCCCAGTGG - Intronic
1136990853 16:35150698-35150720 GGTGGGGTCCTGGTGCCCAGTGG + Intergenic
1137547423 16:49414111-49414133 GGTTGCGTCCTGGTGCCCACAGG - Intergenic
1137715577 16:50596235-50596257 GGTGGCCTCCTGATTCCAGCTGG - Intronic
1137895288 16:52205488-52205510 GGTGGGGCCCTGGTGCCCACGGG - Intergenic
1138558002 16:57784142-57784164 GGTGGGAGCCTGCTGTCCACTGG + Intronic
1140092708 16:71850989-71851011 AATGGCAACCTGGTGCCCACTGG + Exonic
1140197486 16:72867144-72867166 GGCGGCATCCTCAACCCCACAGG + Intronic
1141149860 16:81556567-81556589 GGTGGAATCCTGGTAACCACAGG + Intronic
1141422214 16:83924734-83924756 GGTGGCATCGTGAGCCACACTGG - Exonic
1141428303 16:83957537-83957559 GGTGGCCTCCTGTGGCCCTCAGG - Intronic
1143836464 17:9696724-9696746 GGTGGCCTCCCAGTGCCCACGGG + Intronic
1144267622 17:13586355-13586377 GGTGGCATACGGATGCACACTGG - Intronic
1144301385 17:13925294-13925316 GGTGGCTTCCTCATGCCAGCTGG - Intergenic
1144431853 17:15199300-15199322 GGTACCAACCTGATGCCCACTGG - Intergenic
1146444879 17:32925818-32925840 TGTGGCATCCTGATGGCCAGGGG - Intergenic
1148213338 17:45821097-45821119 GCTGGCATGATCATGCCCACAGG - Intronic
1151984693 17:77534733-77534755 GGTGTCATGCAGATGCCAACAGG + Intergenic
1152531521 17:80922074-80922096 TGTGGCCTCCTGAAGCACACGGG + Intronic
1152602651 17:81272515-81272537 GGTGGCATCCTTATCCCCAACGG - Exonic
1154000060 18:10475085-10475107 GGCCCTATCCTGATGCCCACAGG - Intronic
1158197118 18:54900506-54900528 GGTGTCCTCCTTATACCCACCGG - Intergenic
1159607619 18:70491892-70491914 TGTGGAATGCAGATGCCCACAGG - Intergenic
1160494623 18:79365614-79365636 GGAGACATCCTTCTGCCCACTGG - Intronic
1160990812 19:1859633-1859655 GGAGGCAGCCTGAGGCCCACTGG - Intronic
1162513085 19:11131536-11131558 GGTGTCATCCTGGTCCCCCCGGG - Exonic
1162521172 19:11180421-11180443 AGTGACTTCCTGAGGCCCACAGG + Intronic
1164461466 19:28452651-28452673 GGTGGCTTCCTGATGGCCAGGGG - Intergenic
1164754187 19:30677906-30677928 GGAGGCACCCTGATGGGCACAGG + Intronic
1167044651 19:47042572-47042594 GGTGACATCCAGGTGGCCACCGG + Intronic
930339479 2:50094573-50094595 TGTGGCTTGCTGATGCCCAGTGG + Intronic
931086880 2:58842017-58842039 CATGGCATCATGCTGCCCACGGG - Intergenic
931926133 2:67074548-67074570 TGTGGCCTCCAGATGGCCACTGG + Intergenic
932174195 2:69584702-69584724 GGTGGTATCCTCACGCACACAGG + Intronic
935982497 2:108641078-108641100 GGTGGCATCATGATGAGCCCGGG - Intronic
937312246 2:120909495-120909517 CCTGGCAACCTGATGCCCAGAGG + Intronic
937326650 2:120993423-120993445 GGTGGCTCCCTGATGCACAGTGG - Intergenic
937423908 2:121781604-121781626 GGTAGAAGCCTGGTGCCCACAGG - Intergenic
937821569 2:126316299-126316321 AATGACATCCTGATGGCCACAGG - Intergenic
937892218 2:126947371-126947393 GTCAGGATCCTGATGCCCACAGG + Intergenic
941073964 2:160986708-160986730 GGTAGGACCATGATGCCCACCGG + Intergenic
945968626 2:216214863-216214885 GGTGGGATCCTTATGGCCAAGGG + Intergenic
1168890465 20:1292644-1292666 CATGGCTTCCTGTTGCCCACAGG + Intronic
1169309040 20:4519640-4519662 GTTGGCATCCAGGTCCCCACTGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1170876983 20:20259205-20259227 GGTGGCTCCCTGATGTCAACAGG + Intronic
1173254870 20:41387176-41387198 GGTGCCTTCTTGCTGCCCACTGG + Intergenic
1174626536 20:51919648-51919670 GGTGGCAAACTGAGGCCCTCGGG + Intergenic
1175791451 20:61742812-61742834 GTTGGCATCCTGGTGCCTACTGG + Intronic
1175943211 20:62547367-62547389 GCTGGCCTCCTGCTGCCCGCTGG + Intergenic
1176249983 20:64116044-64116066 GGTGGCAGCCCGAAGGCCACAGG - Intergenic
1178442008 21:32605898-32605920 TTTTGCATTCTGATGCCCACTGG - Intronic
1179906964 21:44427497-44427519 CCTGGCATCCTGTTCCCCACAGG + Intronic
1180221824 21:46364135-46364157 GTTGCCATCCTGAAGCCCCCTGG + Intronic
1180231138 21:46427363-46427385 TGTGGCATCAGGGTGCCCACAGG + Intronic
1180819375 22:18815209-18815231 GATGGAATCTTGAGGCCCACCGG + Intergenic
1181205600 22:21249654-21249676 GATGGAATCTTGAGGCCCACCGG + Intergenic
1182832116 22:33312902-33312924 GGTGGCTTCCTGATGCTTAGTGG + Intronic
1183379248 22:37482706-37482728 GATGGCATCCTGGAGACCACAGG + Intronic
1203221323 22_KI270731v1_random:45759-45781 GATGGAATCTTGAGGCCCACCGG - Intergenic
1203269503 22_KI270734v1_random:41062-41084 GATGGAATCTTGAGGCCCACCGG + Intergenic
950209796 3:11114363-11114385 GGTTGCATACTGCTGCCCAAAGG + Intergenic
950220556 3:11192036-11192058 GGTTTCATCCTGACTCCCACTGG + Intronic
961489928 3:127248089-127248111 GGTGGGATCCTTATGGCCAATGG + Intergenic
961530607 3:127537682-127537704 GGTGGCAACCGCATGACCACAGG - Intergenic
965247464 3:166292056-166292078 CCTGGAATCCAGATGCCCACTGG + Intergenic
967674805 3:192284269-192284291 GGTGACATGCTGATGATCACAGG + Intronic
967784023 3:193470439-193470461 AGTGACATCCTGAAACCCACAGG - Intronic
968577962 4:1376718-1376740 GGTGGCCTCTTGAGGCCCAACGG - Intronic
969273898 4:6121863-6121885 GCTGGCAGAGTGATGCCCACAGG - Intronic
969350881 4:6597236-6597258 GGTGGGGTCCAGATGCCCACGGG - Exonic
979087552 4:116432316-116432338 GGTGCCCTCCTTATGCCCAGAGG - Intergenic
979522986 4:121689709-121689731 AGTGGCTTCCTGTTGCCTACAGG - Intronic
980936878 4:139233956-139233978 GGTAGCTTCCTGATGACCAGGGG + Intergenic
982369587 4:154620342-154620364 TGTGGCAGCCTGAGGCCCAGTGG - Intergenic
985698810 5:1358418-1358440 GGTGCCATCCTGAGCCCCGCTGG + Intergenic
985959025 5:3285762-3285784 GGTGGCATCCTGATTACCTGTGG - Intergenic
989342631 5:40393272-40393294 GACTGCATCCTGATGGCCACTGG - Intergenic
997420720 5:133764610-133764632 GGTGGATCCCTGAAGCCCACAGG + Intergenic
997505317 5:134412154-134412176 GCTGGCATCCAGCTGCCAACTGG - Intergenic
997613820 5:135232890-135232912 GGAGGCATCCTGAGGGCCACTGG + Intronic
997889949 5:137667064-137667086 GGTTGCAAACTGCTGCCCACAGG + Intronic
998662847 5:144259812-144259834 AGTGGCTTCTTGATGGCCACAGG - Intronic
999398444 5:151246007-151246029 GGTGGCTTCTTGATGGCCAGGGG + Intronic
1001241637 5:170075887-170075909 GGTGCCAGGCTGAGGCCCACCGG + Intronic
1003134609 6:3424672-3424694 GGTGGCAATCTGTAGCCCACAGG + Intronic
1005277386 6:24234380-24234402 ATTGGCTTCCTGTTGCCCACGGG - Intronic
1006293224 6:33156963-33156985 TGTGGGATCCTGAGGCCCCCAGG - Intergenic
1006626981 6:35404561-35404583 GGTGTTTCCCTGATGCCCACTGG - Intronic
1009451849 6:63810459-63810481 TGATGCATCCTGAAGCCCACCGG + Intronic
1010020535 6:71154862-71154884 GGTAGCCTCCTGATGCCCCAAGG + Intergenic
1013424802 6:110001392-110001414 GGTGGCTTCCAGATGCCTAAGGG - Intergenic
1022418867 7:30201759-30201781 GGTGACCTGCTGAGGCCCACAGG + Intergenic
1028570333 7:92279473-92279495 GGTCACATCCAAATGCCCACAGG - Intronic
1030254622 7:107494933-107494955 GGTGGAATCCTGAGAGCCACAGG + Intronic
1036549666 8:9805229-9805251 TGTGGCATCCTGAGGCCCAGTGG - Intergenic
1038647500 8:29373534-29373556 GGTGGGATCCTCTTCCCCACCGG - Intergenic
1039907908 8:41799634-41799656 GGAGGCACCATGTTGCCCACCGG - Intronic
1039977877 8:42382669-42382691 GCTGCCATACTGATGCCCCCTGG + Intergenic
1044748182 8:95391460-95391482 AGTGGTATCCTGCTGGCCACGGG - Intergenic
1047549551 8:125854986-125855008 TGTGGCAGCCTGATGACCTCTGG - Intergenic
1047782667 8:128122919-128122941 GGTGGCATCCTAAGGCAAACAGG + Intergenic
1048885194 8:138903922-138903944 TGGGGGATCCTGATGCACACTGG + Intronic
1049683069 8:143928289-143928311 AGCGGCATCCTGGTGCCCACAGG + Intronic
1055062275 9:72082217-72082239 GGTGGCAGCCTGATGTCAGCTGG + Intergenic
1055429864 9:76232302-76232324 GATGGCAGCATTATGCCCACGGG + Intronic
1055990616 9:82102025-82102047 GGTGGTCTGGTGATGCCCACAGG + Intergenic
1056105888 9:83345857-83345879 GGTAGGATCCAGAAGCCCACTGG - Intronic
1057272323 9:93658096-93658118 GGTGGGTGCCTGCTGCCCACAGG - Intronic
1060202047 9:121657045-121657067 GGAGGCAACCAGATGCCAACGGG - Intronic
1060805716 9:126574941-126574963 AGTGGCATCCTCATCCCCAGTGG - Intergenic
1061407162 9:130398727-130398749 GGTGGCTTCCTGAGACGCACAGG + Intronic
1061899298 9:133664873-133664895 GGTGGCCTTCAGATGTCCACGGG + Intronic
1062551693 9:137090438-137090460 GGAGGCAGGCTGCTGCCCACTGG + Intronic
1203791231 EBV:152840-152862 GGTGGGATCATGAAGCCCCCAGG - Intergenic
1193113687 X:77755720-77755742 GGCACCAGCCTGATGCCCACGGG + Intronic