ID: 1094032550

View in Genome Browser
Species Human (GRCh38)
Location 12:26029272-26029294
Sequence GCCTCACATATGTTTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094032543_1094032550 17 Left 1094032543 12:26029232-26029254 CCAGCATGTCTGCATTAGGGAGA 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1094032550 12:26029272-26029294 GCCTCACATATGTTTTAGCTGGG 0: 1
1: 0
2: 2
3: 20
4: 216
1094032540_1094032550 23 Left 1094032540 12:26029226-26029248 CCATTACCAGCATGTCTGCATTA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1094032550 12:26029272-26029294 GCCTCACATATGTTTTAGCTGGG 0: 1
1: 0
2: 2
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094032550 Original CRISPR GCCTCACATATGTTTTAGCT GGG Intronic