ID: 1094032778

View in Genome Browser
Species Human (GRCh38)
Location 12:26032272-26032294
Sequence CATTTTCCCCGAAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094032778 Original CRISPR CATTTTCCCCGAAAGGAAGT GGG Intronic
900655580 1:3755178-3755200 CATTTTTACCGAAGGAAAGTAGG + Intronic
903194303 1:21673419-21673441 CGTTCTCTCTGAAAGGAAGTGGG - Intergenic
904389555 1:30173021-30173043 GATTATCCCAGAAAGGACGTGGG + Intergenic
906708641 1:47913125-47913147 CATTTTCCCCAAAAGTCTGTTGG - Intronic
909070631 1:70989274-70989296 CATTTTCTACGCAGGGAAGTTGG + Intronic
913159558 1:116132851-116132873 CATTTTCCCCGTAAAGTAGGAGG + Intronic
915353620 1:155242092-155242114 CATTTTCCAGGCAAGGAAATGGG - Intronic
916665169 1:166960156-166960178 CCTTTTCCCCAACAGGAATTAGG - Intronic
919144500 1:193616693-193616715 CATTTACCATGAATGGAAGTTGG - Intergenic
920130935 1:203731333-203731355 CATTTTCCCAGGAGGGAAGATGG - Intronic
923631396 1:235650799-235650821 TTTTTTCCCTGAAAGGAAGAGGG - Intergenic
924052103 1:240089511-240089533 CATTTTCCCACAAAGGAAATTGG - Intronic
1064471529 10:15640574-15640596 CTCTTTCCCCTAAAGGTAGTTGG - Intronic
1066648934 10:37637694-37637716 CATGTTAACAGAAAGGAAGTGGG + Intergenic
1068537773 10:58259200-58259222 CATTTACCCCTAAAGGAACAAGG + Intronic
1069965676 10:72113403-72113425 CATCTTCCCAGAATGGATGTTGG + Intronic
1070917336 10:80163398-80163420 CGGTTTCCCTGAAAGGAAGCAGG + Exonic
1071117577 10:82240521-82240543 CTTTTTCCCCTAATGGAATTAGG - Intronic
1075707550 10:124510663-124510685 CATTTTCCCCGGAAGCATGGAGG + Intronic
1076102065 10:127790513-127790535 CATTTTCTTTGCAAGGAAGTAGG + Intergenic
1078723279 11:13903576-13903598 CATTTTCCCCGGGAAGAAGGAGG - Intergenic
1080099425 11:28442261-28442283 TATTTTCCCAGGAAGGAAGGAGG + Intergenic
1083987475 11:66225351-66225373 CTTTTTCCCCCAAAAGATGTTGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1086814919 11:91358202-91358224 CATTTTTCCCAAAAGAAAATGGG - Intergenic
1088060894 11:105648243-105648265 TATTTTTTCCAAAAGGAAGTAGG + Intronic
1089033665 11:115361596-115361618 CATTTTCCTCGAAATAAATTTGG - Intronic
1090948503 11:131452097-131452119 CAGCTTCCTCGAAAAGAAGTGGG + Intronic
1092456468 12:8648120-8648142 CATTTTCACAGGGAGGAAGTCGG + Exonic
1092615965 12:10215708-10215730 CATTGTGCCCCAAAGGAACTCGG - Intronic
1092927888 12:13288650-13288672 CAATTTCCAAGAAAGGAAGAGGG + Intergenic
1094032778 12:26032272-26032294 CATTTTCCCCGAAAGGAAGTGGG + Intronic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1105406934 13:20141147-20141169 CATTTTTCCTGAAAGAAAGTGGG + Exonic
1106623859 13:31398397-31398419 CAATCTCCCAGACAGGAAGTGGG + Intergenic
1107753344 13:43593261-43593283 CCTTCTCCCTGAAAGGAGGTAGG - Intronic
1108747064 13:53406756-53406778 CATTTGCAAAGAAAGGAAGTAGG - Intergenic
1110869698 13:80435935-80435957 CATTCTCTCCTATAGGAAGTTGG + Intergenic
1111896830 13:94152511-94152533 CATTTACCCCAAGAGTAAGTAGG + Intronic
1113001610 13:105644903-105644925 CATTTTCCCTGAAAGAAAAAAGG - Intergenic
1113188058 13:107712619-107712641 CATTCTCCCCGAAACGAAGCTGG - Intronic
1115632758 14:35261798-35261820 GAATTTACCCGAGAGGAAGTGGG + Intronic
1118848896 14:69570140-69570162 CATATTCCCAGAAAGAAACTAGG + Exonic
1121950789 14:98169516-98169538 CATTTTCCCAGAATGGGAGTTGG - Intergenic
1122674871 14:103404229-103404251 CATTTTCCTGGACAGAAAGTTGG + Intronic
1122818610 14:104328153-104328175 CATTTTCCACTAAAGGAAACAGG - Intergenic
1128186020 15:65644146-65644168 CATTTTACCAGAGAGGAAATAGG + Intronic
1130844519 15:87732448-87732470 CATTTTCCATGAGAGGAGGTAGG + Intergenic
1133183514 16:4077381-4077403 CATTTACTCCTAAAGGACGTTGG - Intronic
1133505144 16:6404454-6404476 AATTTTCCCCTAAAGTAACTTGG + Intronic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1140270108 16:73457909-73457931 CATCTTCCTGGGAAGGAAGTTGG - Intergenic
1143915208 17:10286559-10286581 CACATTCCAGGAAAGGAAGTGGG + Intergenic
1144229377 17:13185125-13185147 CATTTGCCCCGGAAGTAATTAGG - Intergenic
1144233473 17:13232780-13232802 AATTTTCTCTGTAAGGAAGTGGG + Intergenic
1149429065 17:56582310-56582332 CATGTCCTCCGAAAGGAAGATGG - Intergenic
1150601450 17:66654386-66654408 CATTTTTCCCAAAAGGTGGTTGG - Intronic
1151175370 17:72283932-72283954 CATTTCACCCCAAAGGATGTAGG - Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1154020579 18:10660991-10661013 CATTTTCCCAGAAAGAAACTTGG + Intergenic
1159697907 18:71583956-71583978 CATTTTCCCCAACAGGCAGTTGG - Intergenic
1160721564 19:599417-599439 CATCTCCTCCGAAAGGATGTGGG + Intronic
1163256614 19:16159841-16159863 CATTTTCCAGGTAAGAAAGTAGG - Intergenic
1163455952 19:17405754-17405776 CAGTTTCCCAGAAAGGAGGTGGG + Intronic
1168319157 19:55498990-55499012 CATTATCCCAGCAACGAAGTGGG + Intronic
924998610 2:386270-386292 CAGTTTCCCTGAGAGGAGGTGGG + Intergenic
926711915 2:15888736-15888758 AATTTTCCTCTAAAGGCAGTGGG + Intergenic
927243288 2:20937005-20937027 CAAATTCCCCCAAAGTAAGTTGG + Intergenic
927397580 2:22671578-22671600 AATTTTCCCCAATAGGAACTGGG - Intergenic
929284294 2:40117942-40117964 CATTCTTCCTGAAAGGGAGTTGG + Intronic
929582065 2:43087663-43087685 CATTTTCCAGATAAGGAAGTTGG + Intergenic
933158302 2:78997890-78997912 TGTTTTCCAAGAAAGGAAGTTGG - Intergenic
934078611 2:88448960-88448982 CATTTTCCCCGAAAGAGGATTGG - Intronic
937138896 2:119580902-119580924 CACTTCCCACGAAAGGAAGCTGG + Intronic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
941112576 2:161431781-161431803 TATTTTCCCCAAAAGCAATTGGG + Intronic
941359900 2:164539042-164539064 CATTTTCCACTGAAGCAAGTTGG - Intronic
941930193 2:170930656-170930678 TTTTTTCCCCGAAAGGAAAAGGG + Intronic
943704431 2:191020388-191020410 CAGTTTCCCCGAAAGCACGTGGG - Intronic
1174888417 20:54361854-54361876 TCTTTTCCCCCAAAGCAAGTTGG - Intergenic
1176692397 21:9931466-9931488 CATTTTTCCCGATTGGATGTTGG + Intergenic
1179076038 21:38122557-38122579 CATTTTCCCAGACAGGAATTTGG + Intronic
1181929144 22:26385471-26385493 CATTTTCCTTAAAAGGAAGGAGG + Intergenic
950728800 3:14937986-14938008 CATTTTGCACGTAAGGAAATGGG + Intergenic
954038730 3:47868243-47868265 CATTTGCAAAGAAAGGAAGTTGG - Intronic
954369915 3:50164834-50164856 CATTTTCCAGAAAAGGCAGTGGG - Intronic
955924552 3:63992702-63992724 CCTTCTCCCCGGAAGCAAGTAGG - Intronic
955938713 3:64127889-64127911 CGTTTTCCCCTACAGGAAGAGGG + Intronic
956006833 3:64788697-64788719 CATTTGCCCTCAAAGGAAGAGGG + Intergenic
956564742 3:70623828-70623850 TAATTTCCCCAAAAGGAAGTTGG - Intergenic
960111243 3:113847613-113847635 CATTCTCCCCCAAATAAAGTAGG + Intronic
960385662 3:117018980-117019002 TTTTTTCCCCCAAAGGGAGTGGG - Intronic
960525531 3:118705508-118705530 CACTTTCTCCCAAATGAAGTGGG + Intergenic
961122087 3:124381415-124381437 CATTTTACCCCAAAGGCAGTGGG + Intronic
962071645 3:132039763-132039785 CATTTTCCTGGAAAAGAGGTTGG + Exonic
962757193 3:138474272-138474294 CTTGTTGCCAGAAAGGAAGTGGG + Exonic
967091473 3:186138242-186138264 TATTTTCCCCCTTAGGAAGTTGG + Intronic
973885720 4:55318966-55318988 AATTTTCCCATAAAGGAAGTTGG - Intergenic
975288724 4:72651177-72651199 CATGTTCCCACAAACGAAGTGGG - Intergenic
977583072 4:98746048-98746070 TACTTTCCCTGAAAGGAATTTGG + Intergenic
980364989 4:131791704-131791726 CATTTTTCCCGATTGGATGTTGG + Intergenic
981484433 4:145270420-145270442 CATTTTCCCCCAAAAAAACTTGG + Intergenic
982343038 4:154324397-154324419 CATTTTCCACCAAAGGAACCAGG - Intronic
983915351 4:173286249-173286271 CATTTTCTCCCAAAGGAAACTGG - Intronic
985891232 5:2716588-2716610 CATTTTCTCGAAAATGAAGTTGG + Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
995826140 5:116301909-116301931 CATTCTTCCCTAAAGGATGTGGG - Intronic
996159198 5:120141454-120141476 CATTTTCCCCTGAATGAAGATGG + Intergenic
997281515 5:132650810-132650832 CATTTTCACAGAGATGAAGTTGG - Intergenic
999828363 5:155295838-155295860 CTTTTTCCCTGAAAGGAAACAGG - Intergenic
1000252219 5:159506471-159506493 CATTTTCCCCAAAAGAAGGGTGG - Intergenic
1000942421 5:167378183-167378205 CATATTACCAAAAAGGAAGTTGG - Intronic
1002494470 5:179602395-179602417 CCAGTTCCCCGAAAGGAAGGGGG - Intronic
1005422827 6:25670606-25670628 CATTTTCCCTCACAGGAATTAGG - Intronic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1012497498 6:99850133-99850155 CCTTTTCCCCTATAGGCAGTTGG + Intergenic
1012624740 6:101392508-101392530 CAGTTTCCCCCAGAGGAAGTTGG - Intergenic
1015202294 6:130596416-130596438 GATTTTCCTTGAAAGGAAGGTGG + Intergenic
1015576609 6:134678563-134678585 CATTTCTCCTGATAGGAAGTGGG + Intergenic
1020898121 7:13968600-13968622 CACTTTCCCTTATAGGAAGTAGG - Intronic
1037066500 8:14584774-14584796 CATTTTCCGTGATAGGAATTAGG + Intronic
1037997894 8:23366898-23366920 CATTTTCCCCATCTGGAAGTTGG - Intronic
1038115844 8:24554273-24554295 CATATTCCCCCAAAGGATGATGG + Intergenic
1040894399 8:52350616-52350638 TATGTTCCCAGACAGGAAGTGGG + Intronic
1043019906 8:74987247-74987269 TATTTTACCCTAAAGAAAGTAGG + Intronic
1047294642 8:123560165-123560187 AATTTTCCCCCAAAGGAAAGGGG - Intergenic
1048020779 8:130537180-130537202 CATTTTCCCCTAAGGTAATTAGG + Intergenic
1051507266 9:17840757-17840779 CACTTAACCTGAAAGGAAGTGGG - Intergenic
1051645891 9:19268010-19268032 CACTTTCCCATAAAGGAAGATGG - Intronic
1053117345 9:35517141-35517163 CCTCTTCTCTGAAAGGAAGTGGG + Intronic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1053629345 9:39917549-39917571 CATTTTTCCCGATTGGATGTTGG + Intergenic
1053776421 9:41545996-41546018 CATTTTTCCCGATTGGATGTTGG - Intergenic
1054214542 9:62333153-62333175 CATTTTTCCCGATTGGATGTTGG - Intergenic
1054365312 9:64332489-64332511 CATTTTTCCCGATTGGATGTTGG + Intergenic
1054672939 9:67822200-67822222 CATTTTTCCCGATTGGATGTTGG + Intergenic
1056432745 9:86544743-86544765 CCTTTTCCCCCTAAGGATGTAGG + Intergenic
1185512870 X:676334-676356 CAGTTTCCCAGCAAGGAACTGGG - Intergenic
1186382724 X:9077956-9077978 CATTTTCCCCTAAGGGCATTTGG + Intronic
1188303650 X:28535637-28535659 CATTTCCCCAGAAAAGAATTAGG - Intergenic
1188838557 X:34987835-34987857 TATCTTCCCCCAAAGGAGGTGGG + Intergenic
1193788230 X:85786664-85786686 AATTTTCACCTAAAGGAACTAGG + Intergenic
1194080082 X:89451568-89451590 TATTCCCCCTGAAAGGAAGTGGG + Intergenic