ID: 1094034061

View in Genome Browser
Species Human (GRCh38)
Location 12:26048045-26048067
Sequence GGCCAGGAATAAAAACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094034061_1094034073 28 Left 1094034061 12:26048045-26048067 CCTCCAAGTTTTTATTCCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1094034073 12:26048096-26048118 AGTACTGGAAACTATGTCAAGGG 0: 1
1: 0
2: 23
3: 70
4: 261
1094034061_1094034072 27 Left 1094034061 12:26048045-26048067 CCTCCAAGTTTTTATTCCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1094034072 12:26048095-26048117 TAGTACTGGAAACTATGTCAAGG 0: 1
1: 1
2: 18
3: 49
4: 204
1094034061_1094034067 -3 Left 1094034061 12:26048045-26048067 CCTCCAAGTTTTTATTCCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1094034067 12:26048065-26048087 GCCACTGGCTGGAACCATTTGGG 0: 1
1: 1
2: 5
3: 16
4: 138
1094034061_1094034069 1 Left 1094034061 12:26048045-26048067 CCTCCAAGTTTTTATTCCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1094034069 12:26048069-26048091 CTGGCTGGAACCATTTGGGTAGG 0: 1
1: 0
2: 0
3: 19
4: 132
1094034061_1094034066 -4 Left 1094034061 12:26048045-26048067 CCTCCAAGTTTTTATTCCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1094034066 12:26048064-26048086 GGCCACTGGCTGGAACCATTTGG 0: 1
1: 1
2: 7
3: 26
4: 157
1094034061_1094034071 13 Left 1094034061 12:26048045-26048067 CCTCCAAGTTTTTATTCCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 205
Right 1094034071 12:26048081-26048103 ATTTGGGTAGGCTGTAGTACTGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094034061 Original CRISPR GGCCAGGAATAAAAACTTGG AGG (reversed) Intronic
901489591 1:9589722-9589744 CGCCAGGCATAAAAGCTTAGTGG + Intronic
902256836 1:15194823-15194845 GGCCAGGAAAATAAAATTGCTGG - Intronic
903554220 1:24181376-24181398 GGCCAGAGATAAGAACTTCGAGG + Intronic
904281005 1:29418218-29418240 GGCAGGGAATAAAAACTTCTTGG - Intergenic
906990335 1:50730708-50730730 GGTCAGAAATAAGAACTTAGAGG + Intronic
907666049 1:56434771-56434793 TGCCAAGAATGAAAACGTGGTGG + Intergenic
908934800 1:69362481-69362503 GGCCAGGAACCAAAATTTTGGGG + Intergenic
909181589 1:72430589-72430611 TTCCAGGAATAAAAACCTGTTGG - Intergenic
910545001 1:88405730-88405752 GGCAAGGTTTACAAACTTGGTGG + Intergenic
911172348 1:94783120-94783142 GGCTAGGAACAAAAAGTTGTGGG + Intergenic
911177206 1:94828724-94828746 GGCCAGCGATAAAAACATGGAGG + Intronic
915185976 1:154105508-154105530 GGCCTTGAATAAACATTTGGTGG + Intronic
916950944 1:169779798-169779820 GGCCAGGATAAAAAACTGGGAGG - Intronic
919862064 1:201746433-201746455 GGCAATGAATAAATACTTGCTGG - Intronic
920493617 1:206438300-206438322 GGCCAGGAGTACTGACTTGGGGG - Intronic
921621630 1:217331918-217331940 GGCCAGGATGAAATACTTTGAGG - Intergenic
923206204 1:231761228-231761250 GGCAAGAAATAAAAACATGCAGG - Intronic
1065223416 10:23518913-23518935 GGCAAGGATTAAAAATTTGTTGG - Intergenic
1066147920 10:32581562-32581584 GGTCAGGAATAAAAACTACTAGG - Intronic
1068735285 10:60407283-60407305 GGCCAGAAATAAGAGCTTAGGGG - Intronic
1069705466 10:70456624-70456646 GGTCAGTAACAAAAATTTGGAGG + Intergenic
1070997510 10:80798562-80798584 GGCCAGGAATAAAACATCTGTGG + Intergenic
1073196598 10:101696118-101696140 GGCTAGGCAGTAAAACTTGGAGG + Intergenic
1073710947 10:106039957-106039979 GGGCATGAATAAAAAGGTGGAGG + Intergenic
1075186725 10:120267380-120267402 GGTCAGGAATAAAACATAGGAGG + Intergenic
1078788421 11:14519889-14519911 GTCCAGGAACACAAACCTGGGGG + Intronic
1079057612 11:17220200-17220222 GGCAGGGAATAATAACCTGGGGG - Intronic
1080437197 11:32256004-32256026 TGCAAGGAACAAAAACCTGGAGG + Intergenic
1082248383 11:49952586-49952608 GGCCAGGAAAAAGTACATGGGGG - Exonic
1082562561 11:54635770-54635792 GGCCAGGAAAAATTACATGGGGG + Intergenic
1082595116 11:55068908-55068930 ATCCAGGAATAAAAACTAGAAGG - Intergenic
1087490373 11:98818808-98818830 GGCGAAAAATAAAAACATGGTGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088238782 11:107752598-107752620 GGCCAGGATAAGAAATTTGGTGG - Intergenic
1090991515 11:131821160-131821182 GACCAAGAATAGAAACTAGGGGG - Intronic
1093540068 12:20271820-20271842 GTCAAGGAATAGAAAGTTGGAGG + Intergenic
1093617200 12:21240845-21240867 TGCCAGGAATAAAAACTAGCAGG + Intergenic
1094034061 12:26048045-26048067 GGCCAGGAATAAAAACTTGGAGG - Intronic
1094257920 12:28456315-28456337 GGCTAGGAAGAAAAAGTTTGGGG + Intronic
1096192091 12:49626284-49626306 GGCCCTGACTAAACACTTGGGGG + Intronic
1098878146 12:75888470-75888492 CCCCTGGAATAAAAACTTTGAGG - Intergenic
1099140454 12:78967782-78967804 TGCCGAGGATAAAAACTTGGGGG + Intronic
1100455542 12:94748284-94748306 AACCAGGAATAAAATTTTGGAGG + Intergenic
1106652925 13:31711183-31711205 GCCCAGGAACAAAAACTCTGTGG - Intergenic
1110250128 13:73372061-73372083 GGCCAAGAACCACAACTTGGAGG - Intergenic
1110325311 13:74207369-74207391 GGACAGGAATAAAAAGTTTCAGG + Intergenic
1113741247 13:112713967-112713989 GGCCAGGAATGGAAGCTGGGTGG - Intronic
1116171450 14:41407727-41407749 GGCCAGAGATAAGAACTTAGGGG - Intergenic
1116377794 14:44225953-44225975 TGCCAGGAAGAAAAACTTTGAGG + Intergenic
1117027895 14:51640234-51640256 TCCAAGGAATAAAAACGTGGAGG - Intronic
1117978064 14:61318036-61318058 GGGCAGGGATAAAGAGTTGGGGG - Intronic
1119105754 14:71922015-71922037 GACTAGGAATAAAAAATAGGTGG - Intergenic
1119200290 14:72746975-72746997 GGCCAGGCATAAACACTGGCAGG + Intronic
1120397137 14:83982242-83982264 AACCATGAATAAAAACTTGCTGG + Intergenic
1123885884 15:24728035-24728057 GGCCAGAGATAAGAACTTAGAGG + Intergenic
1124656973 15:31516639-31516661 GGCCAGAGATAAGAACTTAGAGG + Intronic
1124899862 15:33812027-33812049 GGCCAGAAAAAAAATCTTAGGGG + Intronic
1125137306 15:36358402-36358424 GAACAGGAATAAAATCTTCGAGG - Intergenic
1133029554 16:3003979-3004001 GGGCGGGAAGAAGAACTTGGCGG + Intergenic
1133385667 16:5368316-5368338 GCCCAGGAAAAAGAACTGGGAGG - Intergenic
1134257460 16:12623992-12624014 GGCCAGGAACACAGACTTAGTGG - Intergenic
1136471855 16:30486035-30486057 GGCCAGGAAAGAAGACTTGTGGG - Intronic
1136693298 16:32052765-32052787 GGTCAGGAATGAAAACTGTGAGG - Intergenic
1136745149 16:32580386-32580408 GTCCAAGGATAAAAACTTGAAGG + Intergenic
1136793789 16:32995988-32996010 GGTCAGGAATGAAAACTGTGAGG - Intergenic
1137320913 16:47380650-47380672 GGCTTGGAATAAAGATTTGGTGG + Intronic
1138512923 16:57518944-57518966 GGCCAGGAGTAGACACTGGGAGG - Intronic
1138797259 16:59984048-59984070 AGCCAGCAATAAAAATTTGAAGG - Intergenic
1203047275 16_KI270728v1_random:839594-839616 GTCCAAGGATAAAAACTTGAAGG + Intergenic
1203096051 16_KI270728v1_random:1257681-1257703 GGTCAGGAATGAAAACTGTGAGG - Intergenic
1142768697 17:2081239-2081261 GGCCAGGAAGAAACACTTGCTGG + Intronic
1142908288 17:3063416-3063438 GGCCAGGAAGAAGTACATGGGGG + Exonic
1142926278 17:3240845-3240867 GGCCAGGAAGAAGTACATGGGGG - Intergenic
1142928874 17:3265780-3265802 GGCCAGGAAGAAGTACATGGGGG - Intergenic
1145081800 17:19900417-19900439 AGGAAGGAATAAAAACTTGCAGG - Intergenic
1145734008 17:27213679-27213701 GACCAGGAATGAAAAGTTGGAGG - Intergenic
1146066794 17:29642361-29642383 GGCAAGGAAAAAAACCTGGGTGG - Intronic
1149453686 17:56770237-56770259 GGCCAGGAACAAAGGCTTGGAGG - Intergenic
1150281698 17:63932650-63932672 GCCCAGGAATAGAGACTTGCCGG - Intergenic
1150853674 17:68730009-68730031 GGCCAGAGATAAGAACTTAGAGG - Intergenic
1152179022 17:78806297-78806319 CGACATAAATAAAAACTTGGTGG + Intronic
1153054479 18:932738-932760 GGTTAGAAATAAACACTTGGTGG - Intergenic
1157852402 18:51068328-51068350 CTCCAGGAAAAAAAAGTTGGGGG - Intronic
1158270115 18:55703867-55703889 GGCCAGAGATAAGAACTTGAAGG + Intergenic
1159144845 18:64441440-64441462 GGCTAGGAGTATAAACTCGGAGG - Intergenic
1162209943 19:9083208-9083230 GGCCAGGAAGAAGTACATGGGGG + Intergenic
1162211166 19:9093414-9093436 GGCCAGGAAGAAGTACATGGGGG - Exonic
1164926966 19:32138473-32138495 AGCCAGAATTAAAAACTTAGGGG + Intergenic
1164972033 19:32540724-32540746 GGCCAGAGATAAGAACTTAGAGG - Intergenic
1165689195 19:37850172-37850194 GGCCAGAGATAAGAACTTAGAGG + Intergenic
1166416654 19:42600169-42600191 GGCCAGAGATAAAATCTTAGAGG + Intronic
1166453478 19:42920205-42920227 GGCCAGAGATAAAATCTTAGAGG + Intronic
1166496523 19:43306800-43306822 GGCCAGAGATAAAATCTTAGAGG + Intergenic
1167092631 19:47355079-47355101 TGTCAGGAATACAATCTTGGTGG - Exonic
1167103676 19:47418873-47418895 GGCCAGGAAGAGACACTTGGGGG + Intronic
1167550988 19:50160870-50160892 GGCTAGTAATATAAACGTGGGGG - Intronic
1168191938 19:54744980-54745002 GGCCAGGAATAAAAGGGTGGAGG - Intronic
1168194220 19:54761536-54761558 GGCCAGGAAGAAAAGGGTGGAGG - Intronic
1168204630 19:54840512-54840534 GGCCAGGAAGAAAAGGGTGGAGG - Intronic
926457776 2:13089628-13089650 GGCCAGTAATAAAAACTATTAGG - Intergenic
927491282 2:23522745-23522767 AGTCAGGAATAAAAGCTCGGGGG - Intronic
927503924 2:23601113-23601135 GGCCAGGAGCGCAAACTTGGGGG - Intronic
928098901 2:28423420-28423442 TTCCAGGAATAAAAACTGGGAGG + Intergenic
928101995 2:28444149-28444171 GGCAAAGAATAAATACTGGGAGG - Intergenic
928451399 2:31381590-31381612 GTCCAGGAAGAAGGACTTGGGGG - Intronic
929138898 2:38650279-38650301 GGGCAAGAATAGGAACTTGGAGG - Intergenic
929363914 2:41128307-41128329 GGCCTGGCATAAAAACAGGGTGG - Intergenic
929693769 2:44096987-44097009 GGCCAGGAATACCAGCTTGGGGG - Intergenic
929852759 2:45607946-45607968 GTCCAAGAGTAAAAACTTGAAGG + Intronic
930036072 2:47086009-47086031 GGGCAGGAATAAACATTTGCTGG - Intronic
932770492 2:74498368-74498390 GGCCTGGAAAGAAAAGTTGGGGG + Intronic
935105971 2:100044090-100044112 GGCCAGGAATGAACACATGGAGG + Intronic
935208056 2:100913813-100913835 GGCCAAGGACACAAACTTGGGGG + Intronic
937555964 2:123156409-123156431 GGACAGGAAGAAAAGCTAGGTGG - Intergenic
941962068 2:171263417-171263439 GGCCAGGAATTCAACTTTGGAGG + Intergenic
943537635 2:189172152-189172174 GGCTAAGAATAAAGACTGGGTGG + Intronic
943975271 2:194468760-194468782 AGCCAGAGAAAAAAACTTGGGGG - Intergenic
944350496 2:198720984-198721006 GGCCAGGTATAAAAACTTTAAGG + Intergenic
946549254 2:220782671-220782693 AGCCAGAGATAAAAACTTAGAGG + Intergenic
1173029408 20:39341013-39341035 GGCCAAAGATAAGAACTTGGAGG + Intergenic
1174942759 20:54948912-54948934 TTCCAGGAAAAAAAAATTGGGGG - Intergenic
1175636067 20:60585312-60585334 GGCCAGGAAAAAAAATATAGCGG - Intergenic
1176181921 20:63753493-63753515 GGCCAGGCTCAAAAACCTGGGGG + Intronic
1178202162 21:30419524-30419546 GGCAAGGATTAAAAACTGGTTGG + Intronic
1178679264 21:34658759-34658781 GGTCAGCAATAAAATCATGGAGG + Intergenic
1181804816 22:25368353-25368375 GGCAAGGAATAAAACCTGGAGGG + Intronic
1181903681 22:26175983-26176005 GCCCAGGAAGAAACACATGGGGG - Intronic
1183278433 22:36917363-36917385 TGGCAGGGATAAAAACTAGGGGG - Intronic
949237978 3:1833843-1833865 GGCCAAGGGTAGAAACTTGGAGG - Intergenic
951010966 3:17678869-17678891 AGCCAGGAAAAAAAAAGTGGTGG + Intronic
951256751 3:20458626-20458648 GGCCAAGAATTAAAAACTGGAGG - Intergenic
952231253 3:31433162-31433184 GGCCAGAGATAAGAACTTAGAGG + Intergenic
955561289 3:60193789-60193811 GGCCAGTAATGAGAACATGGGGG + Intronic
958057890 3:88436869-88436891 GGCCAGTATTTAAAATTTGGGGG + Intergenic
960737151 3:120793299-120793321 GGGAAGGAATAAAAACTGTGGGG - Intergenic
961814273 3:129540739-129540761 GGGCAGGAGTGAAAAATTGGGGG + Intergenic
962019439 3:131482216-131482238 GGCCAGTAATAAAAATTAAGGGG - Intronic
962206676 3:133440623-133440645 GGCCCAGAATCAGAACTTGGGGG + Intronic
965600109 3:170446177-170446199 AGCCAGGATTATAAACTTTGCGG + Intronic
966308258 3:178562488-178562510 GGCTAAGAAAAGAAACTTGGAGG + Intronic
967594323 3:191312471-191312493 GGCCAGGAATAAAGATTTTGGGG - Intronic
968252204 3:197229554-197229576 GGCCAGGAATTTAATCTTTGTGG - Intronic
969761182 4:9183493-9183515 TACCAGGAATCAAAAGTTGGAGG + Intergenic
969780029 4:9393965-9393987 CACCAGAAATAAAAAGTTGGAGG + Intergenic
970815841 4:20155529-20155551 GGCCAGAAATAAGAACTCAGAGG + Intergenic
971391051 4:26185500-26185522 GGCCAGGAAAAATAATTTTGGGG + Intronic
971523153 4:27581084-27581106 GTCCATGGATAAATACTTGGGGG - Intergenic
972456065 4:39256642-39256664 GGCCAGCAACAACAAGTTGGTGG - Intronic
973118675 4:46491079-46491101 GGCCAGGAATTGAGACTTTGGGG - Intergenic
973259703 4:48150350-48150372 GGCGAGCAGGAAAAACTTGGAGG - Intronic
974377360 4:61095589-61095611 GGCCAGGGATGAGAACTTAGAGG - Intergenic
976029144 4:80729980-80730002 GGCCAGAGATAAAAATTTAGAGG + Intronic
977419184 4:96775631-96775653 GGCCAGAGATAAGAACTTAGGGG - Intergenic
980212185 4:129803652-129803674 GGCAAGGAATAAAAACCTAAAGG + Intergenic
980274921 4:130637908-130637930 TGCCAGGAAGAGAAATTTGGAGG + Intergenic
980831257 4:138131538-138131560 GACCAGAGATAAAAACTTAGAGG - Intergenic
982867067 4:160527048-160527070 GGCCAGGAATAAAAATGGAGGGG - Intergenic
982978026 4:162091618-162091640 GGCCACAAATGAAACCTTGGAGG - Intronic
984548056 4:181130199-181130221 GACCCGTAATAAAAACTTGCTGG - Intergenic
986122291 5:4852227-4852249 TGACAGGAAAAAAAAGTTGGAGG + Intergenic
986639225 5:9855647-9855669 GGCCAAAGATAAAAACTTGGAGG - Intergenic
989412785 5:41139849-41139871 GGGAAGTAATGAAAACTTGGTGG - Intergenic
990608303 5:57432146-57432168 GGCCAGAAGTAAACACTTTGTGG + Intergenic
992370992 5:76143992-76144014 AGGTAGGAATAAAAACTTGATGG + Intronic
995155913 5:108912763-108912785 GGCCTGGGAAAAAAATTTGGGGG + Intronic
996311712 5:122113394-122113416 GGCCAGAGATAAGAACTTAGAGG - Intergenic
998547260 5:143040417-143040439 GGCCAGTATAAAATACTTGGGGG - Intronic
1002075258 5:176704737-176704759 GGCCAGGAACACCCACTTGGGGG - Intergenic
1004189847 6:13454505-13454527 GGCCAGGAAGTAGGACTTGGGGG - Intronic
1004727828 6:18327718-18327740 GGCCAGAGATAAGAACTTAGAGG - Intergenic
1005232208 6:23715375-23715397 GGTCATGGGTAAAAACTTGGGGG + Intergenic
1005406808 6:25498099-25498121 GTCCAGGAAGAAAGGCTTGGGGG - Intronic
1005792261 6:29315903-29315925 GGTAAAGAATGAAAACTTGGGGG - Intergenic
1007061477 6:38944904-38944926 GGCCAGGGATAAAAAGAGGGGGG - Intronic
1012816375 6:104027433-104027455 GGACAGGAATATAACCTTGATGG + Intergenic
1013671244 6:112405806-112405828 GTCCAGGAACAAAGGCTTGGGGG - Intergenic
1015852283 6:137586903-137586925 GGCCAGGAATATAACGTGGGTGG + Intergenic
1017790449 6:157793402-157793424 GGGAATGAATAAAAACTTGGCGG - Intronic
1017966398 6:159270749-159270771 GTCCAGGAATTAAGCCTTGGAGG + Intronic
1018403594 6:163452520-163452542 GGCCCTCAATAAATACTTGGTGG - Intronic
1024445968 7:49479436-49479458 GGGCAGGATAACAAACTTGGGGG - Intergenic
1025586283 7:62792412-62792434 ATCCAAGAATAAAAACTTGAAGG + Intergenic
1028085077 7:86626218-86626240 GGCCAGGGATAAGAATTTAGAGG - Intergenic
1028980428 7:96962176-96962198 GGGCAGGAATAAAGAATTCGAGG - Intergenic
1031673814 7:124585049-124585071 GGCCAGAAAGAAAGACTTGTTGG - Intergenic
1032651185 7:133880134-133880156 GAACAGGAATAAAAAGGTGGGGG - Intronic
1032802333 7:135326998-135327020 AGCCAGGAACAAACACCTGGAGG + Intergenic
1033493020 7:141863026-141863048 GCCCAGGAAAAAATACATGGGGG - Intergenic
1035136400 7:156708098-156708120 AGCCAGAAAAAAAAAATTGGAGG + Intronic
1035980345 8:4363411-4363433 GAGCAGGAATAAAATCCTGGAGG - Intronic
1036343882 8:7942394-7942416 CACCAGAAATAAAAAGTTGGAGG - Intronic
1036839223 8:12103161-12103183 CACCAGAAATAAAAAGTTGGAGG - Intergenic
1036861012 8:12349404-12349426 CACCAGAAATAAAAAGTTGGAGG - Intergenic
1037446309 8:18969521-18969543 GGCCACTAATAAAAAGTTGTTGG - Intronic
1038089027 8:24233296-24233318 TGCCAGGAAAATAAGCTTGGAGG + Intergenic
1041442019 8:57907462-57907484 GGACAGGAATGACAACTTCGAGG - Intergenic
1043330011 8:79104157-79104179 TGACAGGAAAATAAACTTGGAGG - Intergenic
1046557359 8:115791101-115791123 GGCCTGGAATTAAAACTTTAGGG - Intronic
1046831728 8:118753579-118753601 GGCCAGGAATAAAACTTTAGTGG + Intergenic
1047301420 8:123616699-123616721 GGCCAGGATTGAAAACAGGGGGG - Intergenic
1048035667 8:130674956-130674978 GCCCAGGATTAAAAACATGATGG - Intergenic
1048920864 8:139228834-139228856 GGCCTGGAATATAAAGGTGGGGG - Intergenic
1051302696 9:15670050-15670072 GGCCAGGACTTAAAAGGTGGAGG - Intronic
1053225844 9:36356211-36356233 GGCCAGGTATATAACCTTAGTGG - Intronic
1053434542 9:38066706-38066728 GGCCAGGCAGAAAAACTAGAGGG + Intronic
1053600609 9:39604899-39604921 GACCAGAAATAAAAACTTGGAGG + Intergenic
1053858255 9:42358753-42358775 GACCAGAAATAAAAACCTGGAGG + Intergenic
1054252921 9:62737485-62737507 GACCAGAAATAAAAACTTGGAGG - Intergenic
1054567038 9:66771984-66772006 GACCAGAAATAAAAACTTGGAGG - Intergenic
1056670135 9:88620369-88620391 GGCCAGAGATAAAAACTTATAGG - Intergenic
1059163537 9:112057780-112057802 GGCCAGTAATGAAAACTAGAAGG - Intronic
1059290474 9:113219646-113219668 GGCCAGAGATAAATTCTTGGTGG - Intronic
1059725610 9:117005596-117005618 GGCCAGAGATAAGAACTTAGAGG + Intronic
1060835497 9:126752591-126752613 GGAAAGGAATGTAAACTTGGAGG - Intergenic
1061280150 9:129593362-129593384 GCCCAGGTATGAAACCTTGGAGG + Intergenic
1062327981 9:136021879-136021901 GTCCAGGAAACTAAACTTGGGGG + Intronic
1062704122 9:137925398-137925420 GGCCAGAGATAAGAACTTAGAGG - Intronic
1186113449 X:6279475-6279497 CGCCAGGAAAAAATACTTGTAGG + Intergenic
1188512266 X:30949120-30949142 GGCCAGGATTAGAAACTTGCTGG - Intronic
1189900909 X:45705412-45705434 GGCCAGAAATAACAACTTAAGGG + Intergenic
1194599540 X:95903586-95903608 GGCCAGAGATAAGAACTTAGAGG + Intergenic
1198408485 X:136340431-136340453 GCCCAGGAATCAAAACTCAGTGG - Intronic
1200311750 X:155085593-155085615 ACCCAGGGATAAAAAGTTGGAGG - Intronic
1200973882 Y:9186768-9186790 GACCAGGAATATAATATTGGTGG - Intergenic
1201318187 Y:12668740-12668762 GGGATGGAATAAAAATTTGGTGG - Intergenic
1202137235 Y:21678026-21678048 GACCAGGAATATAATATTGGTGG + Intergenic
1202358578 Y:24078972-24078994 GAACAGGAATATAAAATTGGTGG - Intergenic
1202512200 Y:25591141-25591163 GAACAGGAATATAAAATTGGTGG + Intergenic