ID: 1094036341

View in Genome Browser
Species Human (GRCh38)
Location 12:26075937-26075959
Sequence AGATGTAGGCTGGCGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094036341_1094036347 -9 Left 1094036341 12:26075937-26075959 CCCACCAACGCCAGCCTACATCT 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1094036347 12:26075951-26075973 CCTACATCTGAATCCTTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 174
1094036341_1094036354 28 Left 1094036341 12:26075937-26075959 CCCACCAACGCCAGCCTACATCT 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1094036354 12:26075988-26076010 CCCATCTCGACAAGCTAAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 59
1094036341_1094036345 -10 Left 1094036341 12:26075937-26075959 CCCACCAACGCCAGCCTACATCT 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1094036345 12:26075950-26075972 GCCTACATCTGAATCCTTTGAGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094036341 Original CRISPR AGATGTAGGCTGGCGTTGGT GGG (reversed) Intronic
900618073 1:3574227-3574249 AGATGGAGCCAGGCGTTGCTGGG - Intronic
900671168 1:3855921-3855943 AGATGTACTCTGGCATTTGTCGG - Intronic
904386917 1:30148916-30148938 AGATGCAGGCAGGGGTGGGTTGG - Intergenic
905125786 1:35715489-35715511 ACATGTAGGCTGGTGTGTGTAGG - Exonic
905342547 1:37289273-37289295 AGATGTAGGCTGCGGTTGGCTGG - Intergenic
906518075 1:46451225-46451247 AGATGTAGCATGGGGTTGGGGGG + Intergenic
915230530 1:154442469-154442491 AGGTGGAGGCCGGCCTTGGTGGG + Intronic
916491930 1:165309548-165309570 AGATCTTGGCTGGAGATGGTGGG - Intronic
918407089 1:184222264-184222286 AGATGAAACCTGGCTTTGGTTGG - Intergenic
919727790 1:200895184-200895206 AGACATAGGCTGGCGGGGGTGGG - Intronic
919782057 1:201227364-201227386 ACATGTGGGCCGGTGTTGGTAGG - Intronic
920126681 1:203699094-203699116 AGATGTAGGGTTTTGTTGGTTGG - Intronic
924955047 1:248917957-248917979 AGAAGGTGGGTGGCGTTGGTAGG + Exonic
1063577288 10:7273445-7273467 AAATGTGGGCGGGGGTTGGTTGG - Intronic
1064088279 10:12362165-12362187 AGATGGATGGTGGCGATGGTTGG - Intronic
1067419698 10:46134839-46134861 AGGTGTGGGCTGGGGTTTGTAGG - Intergenic
1067426320 10:46214572-46214594 AGGTGTGGGCTGGGGTTTGTAGG + Intergenic
1069054229 10:63828183-63828205 AGATGTAGGCTGAAGTTTTTAGG + Intergenic
1069870492 10:71529932-71529954 AGCTGCAGGCTGGGGTGGGTGGG - Intronic
1070827350 10:79399011-79399033 TGATGGAGGCTTGTGTTGGTGGG + Intronic
1073370266 10:102981866-102981888 TGATCTAGGATGGCCTTGGTTGG + Intronic
1074159407 10:110824718-110824740 TGATGTAGGCTGGAGTTGCTGGG - Intronic
1074359303 10:112812514-112812536 AAATACAGGCTGGCATTGGTGGG - Intronic
1074761445 10:116670034-116670056 AGGGGCAGGCTGGCGGTGGTGGG - Intronic
1074775237 10:116763163-116763185 AGATATACCCTGGTGTTGGTAGG + Intergenic
1075391809 10:122097614-122097636 AGCTGGAGGCTAGGGTTGGTAGG + Intronic
1077502082 11:2913940-2913962 AGGTGTGGGCTGCGGTTGGTGGG + Intronic
1079834284 11:25313068-25313090 ATATGTACTCTGGCGTTGCTGGG + Intergenic
1084442177 11:69180874-69180896 TGATCTAGGCTGGGCTTGGTTGG + Intergenic
1092611353 12:10176487-10176509 AGGTGAAGGCTGGCGTGGTTGGG + Intronic
1094036341 12:26075937-26075959 AGATGTAGGCTGGCGTTGGTGGG - Intronic
1095544912 12:43354934-43354956 AGAGGTAGGCTGAAGTGGGTTGG + Intronic
1099243266 12:80163670-80163692 TGATCTAGGCTGGCCTTGGCTGG + Intergenic
1102562426 12:113771762-113771784 AGATGAAGGCTGGGTGTGGTGGG - Intergenic
1104976204 12:132553087-132553109 AGAAGTGGGCTGGGGTGGGTGGG - Intronic
1118302838 14:64630618-64630640 AGTTGTAGTCTGGGGATGGTAGG - Intergenic
1118774073 14:68962460-68962482 AGATTTAGGCTGGGGAGGGTGGG - Intronic
1121227141 14:92329240-92329262 AGATGTGGGCTCACGTTTGTGGG - Intronic
1122915887 14:104858816-104858838 AGATGGAGGGTGGAGATGGTGGG - Intergenic
1122916350 14:104860764-104860786 AGATGGAGGGTGGAGATGGTGGG - Intergenic
1126657860 15:50999512-50999534 TGATTTAGGTTGGAGTTGGTTGG + Intronic
1127716749 15:61655845-61655867 AGATGTAGGCTGGCTTTGAGGGG - Intergenic
1129362081 15:75030247-75030269 AGATGTTGGCTGGGGTGGGAGGG + Intronic
1130233412 15:82113664-82113686 AGATGTCAGCTGGGGGTGGTAGG - Intergenic
1133840731 16:9407112-9407134 AGATGTAGGCTGGAATTAGCTGG + Intergenic
1134388990 16:13801188-13801210 AGATGTAGGCTGGTCTTGATTGG - Intergenic
1134388993 16:13801212-13801234 AGATCTAGGCTGGTCTTGGTTGG - Intergenic
1134388998 16:13801236-13801258 AGACCTAGGCTGGTCTTGGTTGG - Intergenic
1137718007 16:50610809-50610831 AGATTAAGGCTGGGCTTGGTGGG + Intronic
1138641473 16:58391389-58391411 GGATATAGGCTTGGGTTGGTTGG + Intronic
1140257301 16:73348411-73348433 GGATGGAGGCTGGGGTTGGGGGG - Intergenic
1140637016 16:76926821-76926843 AGATCTAGGATGGCCTTGGCTGG + Intergenic
1141821186 16:86447159-86447181 AGATGTAGGCTGAGATTGGGGGG - Intergenic
1143490169 17:7281583-7281605 AGAGTTTGGCTGGAGTTGGTGGG - Intergenic
1145200623 17:20941711-20941733 AGGTGAAGGCTGGCGTGGGCAGG - Intergenic
1145416379 17:22716855-22716877 AAGTGTAGGCTGGTGATGGTGGG + Intergenic
1146736566 17:35243404-35243426 AGATGTAGGCTGCGCTGGGTCGG - Intronic
1148954193 17:51339866-51339888 AAATGTAGGCTGGGTGTGGTGGG - Intergenic
1150075839 17:62191423-62191445 AGATGCAGGGTGGTGGTGGTGGG - Intergenic
1150839747 17:68596753-68596775 TGATGGAGCCTGGCGTTGGCTGG + Intronic
1155393320 18:25360331-25360353 AGATGGAGGCGGGGGTGGGTGGG - Intergenic
1157426328 18:47587543-47587565 AGATGTAGGATGGCGTTGCGGGG - Intergenic
1160458310 18:79018664-79018686 AGATGGAGGCGGGGGTTGGACGG - Intergenic
1162860757 19:13504809-13504831 AGATGTAGGCAGGCAAGGGTGGG - Intronic
1167792291 19:51689820-51689842 AGATGGGGGCTGGGGCTGGTAGG + Intergenic
928408885 2:31038539-31038561 AGATGGAGTTTGGCGTTGGCCGG + Intronic
930677620 2:54221193-54221215 TGATCTAGGCTGGGTTTGGTTGG - Intronic
930878691 2:56248250-56248272 AGATGTATTCTGGGGTTGGCTGG + Intronic
931312176 2:61092527-61092549 AGATGTATACTGGCGATTGTGGG + Exonic
933283078 2:80354273-80354295 ACATGTAGGAGGGAGTTGGTGGG + Intronic
933863970 2:86499371-86499393 AGATGTGGGATGGGGTGGGTGGG + Intergenic
933983319 2:87571211-87571233 ACAGGGAGGCTGGCGTTGTTGGG + Intergenic
936310529 2:111379583-111379605 ACAGGGAGGCTGGCGTTGTTGGG - Intergenic
937635133 2:124146954-124146976 GGATGTTGGCTGGGGTTGGGGGG + Intronic
940738707 2:157482409-157482431 AGGTGTAAGGTGGCCTTGGTAGG + Intronic
941317307 2:164009200-164009222 GGATGAAGGCAGGGGTTGGTTGG + Intergenic
945632393 2:212296843-212296865 AGACTTAGGATGGAGTTGGTGGG - Intronic
947111231 2:226721548-226721570 AGACTGAGGCTGGCCTTGGTGGG + Intergenic
947519882 2:230837421-230837443 TGATGTAGGCTGGGCTTAGTGGG - Intergenic
1171519686 20:25766248-25766270 AAATGTAGGCTGGTGATGGTGGG + Intronic
1171557234 20:26090245-26090267 AAATGTAGGCTGGTGATGGTGGG - Intergenic
1172453485 20:35046821-35046843 AGAAGTGGGCTGGGGGTGGTGGG - Intronic
1174030334 20:47619356-47619378 AAATGTAGGCTGGGTGTGGTGGG + Intronic
1176653830 21:9572532-9572554 AAATGTAGGCTGGTGATGGTGGG + Intergenic
1183238371 22:36637397-36637419 AAATGCAGGCTGGCCTTGCTAGG - Intronic
1184343974 22:43901693-43901715 AGCTGAAGGCTGTCCTTGGTGGG - Intergenic
1184993692 22:48187277-48187299 GGATGTAGTCTGGGGTTGGGAGG - Intergenic
952505556 3:34004171-34004193 AGAGGTAGGCTGACCTTGGAAGG + Intergenic
957212011 3:77271699-77271721 AGATGTACCCTGGTGTTTGTTGG + Intronic
957716124 3:83931082-83931104 AGAAGTAGAATGGAGTTGGTTGG + Intergenic
958258705 3:91354181-91354203 AGACGTAGGCTGGGGGTGCTAGG + Intergenic
958747827 3:98158726-98158748 AGATCTAGGATGGGTTTGGTAGG + Intergenic
962992273 3:140589015-140589037 AGAAGTAGGGTAGGGTTGGTGGG - Intergenic
965761252 3:172079352-172079374 AGATGGAGTTTGGCCTTGGTGGG + Intronic
968083259 3:195861812-195861834 GGCTGTAGGCTGGCCTTCGTGGG - Intergenic
969897242 4:10316922-10316944 AGATGTAGGTTGGATGTGGTAGG - Intergenic
970750170 4:19349579-19349601 TGATGTAGGATGGCTTTGGTTGG + Intergenic
971863322 4:32137575-32137597 AAATGAAGGCTTGGGTTGGTAGG + Intergenic
980714875 4:136615736-136615758 AGTTGGAGGCTGAGGTTGGTGGG - Intergenic
982444328 4:155472209-155472231 AGAGGTAGCCTGGGGTTGTTTGG + Intergenic
989110428 5:37902003-37902025 AGATGCAGGAGGTCGTTGGTGGG + Intergenic
990275470 5:54191378-54191400 AGATGTATGCTGGTGATGGTGGG + Intronic
992679448 5:79139504-79139526 AGATGCAGGCTGGCCTGGGAAGG - Intronic
1004440209 6:15642460-15642482 GCAGGTAGGCTGGCGTTGGGTGG - Intronic
1006938846 6:37738036-37738058 AGATGAGGGATGGAGTTGGTTGG + Intergenic
1008996556 6:57666394-57666416 AGATGTAGGCTGGGGGTGCTAGG - Intergenic
1009156238 6:59818816-59818838 AAATGTAGGCTGGCATTGGGTGG + Intergenic
1015577662 6:134690157-134690179 AGATGCAGGATGGGGTTGGTTGG - Intergenic
1017738387 6:157382614-157382636 AGATGTAGCCTGCCGTGGGAAGG + Intronic
1019282681 7:208207-208229 AAATGTAGGTTGGTGTTTGTTGG + Intronic
1025280173 7:57621198-57621220 AAATGTAGGCTGCTGATGGTGGG + Intergenic
1025304560 7:57844303-57844325 AAATGTAGGCTGCTGATGGTGGG - Intergenic
1027664946 7:81033787-81033809 AGATGAAGGCTGGGTGTGGTGGG - Intergenic
1036436996 8:8743677-8743699 AGATGCAGGCTGGCTTCTGTAGG - Intergenic
1037438364 8:18888785-18888807 AGATGTAAGCTGGATTTGTTGGG + Intronic
1038503249 8:28062965-28062987 AGATGCAGGTTGGGGGTGGTGGG - Intronic
1039493303 8:37963937-37963959 AGCAGCAGGCTGGCTTTGGTAGG - Exonic
1040314026 8:46251468-46251490 GGATGTAGAGTGGCGTGGGTGGG + Intergenic
1045051484 8:98331163-98331185 AAATGTAGGATGTTGTTGGTTGG - Intergenic
1049193302 8:141301036-141301058 AGTTTTAGGCAGGCGTTTGTGGG - Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052768306 9:32664007-32664029 TAATTTAGGCTGGCGTTAGTTGG - Intergenic
1055438670 9:76317882-76317904 AGATCTAGGCTGGGCTTGGCAGG - Intronic
1056203982 9:84302832-84302854 AGAAGTAGTCTGTTGTTGGTAGG - Intronic
1057144549 9:92749229-92749251 AGATATAGGCTGGCAGAGGTGGG - Intronic
1058182043 9:101810086-101810108 AGATGTAGGCTGACATGGTTTGG + Intergenic
1058951275 9:109906134-109906156 AGAGATTGGCTGGGGTTGGTGGG - Intronic
1062429062 9:136518941-136518963 TGATTTAGGCTGGCGGTGGGTGG - Intronic
1203631551 Un_KI270750v1:75984-76006 AAATGTAGGCTGGTGATGGTGGG + Intergenic
1186026705 X:5321214-5321236 AGATGTAGGATGGGGTGGGGGGG - Intergenic
1191091036 X:56621866-56621888 AGAAGTAGGCTAGCCTTTGTTGG + Intergenic
1193509409 X:82381927-82381949 AGATGTAGTATAGTGTTGGTTGG + Intergenic