ID: 1094038867

View in Genome Browser
Species Human (GRCh38)
Location 12:26102045-26102067
Sequence CCTTATCTATAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094038867_1094038873 27 Left 1094038867 12:26102045-26102067 CCATCCCCATTCTATAGATAAGG No data
Right 1094038873 12:26102095-26102117 TTTCCCATGTTTATGCAATTAGG No data
1094038867_1094038872 3 Left 1094038867 12:26102045-26102067 CCATCCCCATTCTATAGATAAGG No data
Right 1094038872 12:26102071-26102093 CAGACAAAAAGATGTATAAGTGG No data
1094038867_1094038875 30 Left 1094038867 12:26102045-26102067 CCATCCCCATTCTATAGATAAGG No data
Right 1094038875 12:26102098-26102120 CCCATGTTTATGCAATTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094038867 Original CRISPR CCTTATCTATAGAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr