ID: 1094041176

View in Genome Browser
Species Human (GRCh38)
Location 12:26122881-26122903
Sequence GGAGCGCGCGGGGCAGAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094041176_1094041186 -4 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041186 12:26122900-26122922 CTCCAGGCAGGGGGCGGCCGCGG 0: 1
1: 1
2: 4
3: 36
4: 411
1094041176_1094041188 2 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041188 12:26122906-26122928 GCAGGGGGCGGCCGCGGACCCGG 0: 1
1: 0
2: 1
3: 47
4: 398
1094041176_1094041194 20 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280
1094041176_1094041185 -10 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041185 12:26122894-26122916 CGCGCGCTCCAGGCAGGGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 224
1094041176_1094041191 12 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041191 12:26122916-26122938 GCCGCGGACCCGGCGGCCGAGGG 0: 1
1: 0
2: 1
3: 15
4: 182
1094041176_1094041190 11 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041190 12:26122915-26122937 GGCCGCGGACCCGGCGGCCGAGG 0: 1
1: 0
2: 3
3: 57
4: 609
1094041176_1094041189 5 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041189 12:26122909-26122931 GGGGGCGGCCGCGGACCCGGCGG 0: 1
1: 0
2: 7
3: 78
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094041176 Original CRISPR GGAGCGCGCGGGGCAGAAGC TGG (reversed) Exonic