ID: 1094041181

View in Genome Browser
Species Human (GRCh38)
Location 12:26122891-26122913
Sequence CCCCCTGCCTGGAGCGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094041181_1094041194 10 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280
1094041181_1094041188 -8 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041188 12:26122906-26122928 GCAGGGGGCGGCCGCGGACCCGG 0: 1
1: 0
2: 1
3: 47
4: 398
1094041181_1094041189 -5 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041189 12:26122909-26122931 GGGGGCGGCCGCGGACCCGGCGG 0: 1
1: 0
2: 7
3: 78
4: 568
1094041181_1094041197 26 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041197 12:26122940-26122962 GCGCCGGTGCCTTTGCTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1094041181_1094041191 2 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041191 12:26122916-26122938 GCCGCGGACCCGGCGGCCGAGGG 0: 1
1: 0
2: 1
3: 15
4: 182
1094041181_1094041190 1 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041190 12:26122915-26122937 GGCCGCGGACCCGGCGGCCGAGG 0: 1
1: 0
2: 3
3: 57
4: 609
1094041181_1094041198 27 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041198 12:26122941-26122963 CGCCGGTGCCTTTGCTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094041181 Original CRISPR CCCCCTGCCTGGAGCGCGCG GGG (reversed) Exonic