ID: 1094041187

View in Genome Browser
Species Human (GRCh38)
Location 12:26122902-26122924
Sequence GTCCGCGGCCGCCCCCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094041187_1094041197 15 Left 1094041187 12:26122902-26122924 CCAGGCAGGGGGCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 1094041197 12:26122940-26122962 GCGCCGGTGCCTTTGCTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1094041187_1094041191 -9 Left 1094041187 12:26122902-26122924 CCAGGCAGGGGGCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 1094041191 12:26122916-26122938 GCCGCGGACCCGGCGGCCGAGGG 0: 1
1: 0
2: 1
3: 15
4: 182
1094041187_1094041198 16 Left 1094041187 12:26122902-26122924 CCAGGCAGGGGGCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 1094041198 12:26122941-26122963 CGCCGGTGCCTTTGCTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1094041187_1094041190 -10 Left 1094041187 12:26122902-26122924 CCAGGCAGGGGGCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 1094041190 12:26122915-26122937 GGCCGCGGACCCGGCGGCCGAGG 0: 1
1: 0
2: 3
3: 57
4: 609
1094041187_1094041194 -1 Left 1094041187 12:26122902-26122924 CCAGGCAGGGGGCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094041187 Original CRISPR GTCCGCGGCCGCCCCCTGCC TGG (reversed) Exonic