ID: 1094041194

View in Genome Browser
Species Human (GRCh38)
Location 12:26122924-26122946
Sequence CCCGGCGGCCGAGGGAGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094041183_1094041194 9 Left 1094041183 12:26122892-26122914 CCCGCGCGCTCCAGGCAGGGGGC 0: 1
1: 0
2: 1
3: 21
4: 246
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280
1094041184_1094041194 8 Left 1094041184 12:26122893-26122915 CCGCGCGCTCCAGGCAGGGGGCG 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280
1094041181_1094041194 10 Left 1094041181 12:26122891-26122913 CCCCGCGCGCTCCAGGCAGGGGG 0: 1
1: 0
2: 3
3: 15
4: 124
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280
1094041176_1094041194 20 Left 1094041176 12:26122881-26122903 CCAGCTTCTGCCCCGCGCGCTCC 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280
1094041187_1094041194 -1 Left 1094041187 12:26122902-26122924 CCAGGCAGGGGGCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 22
4: 275
Right 1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG 0: 1
1: 0
2: 3
3: 33
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094041194 Original CRISPR CCCGGCGGCCGAGGGAGCGC CGG Exonic