ID: 1094041823

View in Genome Browser
Species Human (GRCh38)
Location 12:26126564-26126586
Sequence GGTCGCGGGAAGCGGCGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094041817_1094041823 -8 Left 1094041817 12:26126549-26126571 CCGGGGACGGATCTGGGTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 71
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041810_1094041823 9 Left 1094041810 12:26126532-26126554 CCCGCCGGGCACGGGTTCCGGGG 0: 1
1: 0
2: 0
3: 19
4: 139
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041799_1094041823 21 Left 1094041799 12:26126520-26126542 CCCCCGGCCCGCCCCGCCGGGCA 0: 1
1: 0
2: 5
3: 72
4: 536
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041813_1094041823 5 Left 1094041813 12:26126536-26126558 CCGGGCACGGGTTCCGGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041801_1094041823 19 Left 1094041801 12:26126522-26126544 CCCGGCCCGCCCCGCCGGGCACG 0: 1
1: 0
2: 4
3: 60
4: 521
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041808_1094041823 10 Left 1094041808 12:26126531-26126553 CCCCGCCGGGCACGGGTTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041806_1094041823 13 Left 1094041806 12:26126528-26126550 CCGCCCCGCCGGGCACGGGTTCC 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041805_1094041823 14 Left 1094041805 12:26126527-26126549 CCCGCCCCGCCGGGCACGGGTTC 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041802_1094041823 18 Left 1094041802 12:26126523-26126545 CCGGCCCGCCCCGCCGGGCACGG 0: 1
1: 1
2: 1
3: 72
4: 634
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041800_1094041823 20 Left 1094041800 12:26126521-26126543 CCCCGGCCCGCCCCGCCGGGCAC 0: 1
1: 0
2: 10
3: 112
4: 799
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1094041812_1094041823 8 Left 1094041812 12:26126533-26126555 CCGCCGGGCACGGGTTCCGGGGA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094041823 Original CRISPR GGTCGCGGGAAGCGGCGGCT GGG Intronic
900109479 1:999500-999522 AGGCGCGGGCGGCGGCGGCTTGG - Intronic
900524687 1:3122837-3122859 GCTCTAGGGAGGCGGCGGCTGGG + Intronic
902323645 1:15684490-15684512 CGGCGCGGGAAGCGGCGGCGGGG + Exonic
903142165 1:21345306-21345328 GGTCGCGGGCAGCGGTGCCGCGG - Intronic
905183211 1:36178940-36178962 GGTCGCGGGAAGAGGCGGAGCGG + Exonic
905370363 1:37479771-37479793 GGGCGGGGGAAGCACCGGCTGGG - Intronic
905626590 1:39493597-39493619 GGTTGCGGGAAGCAGAGGCTTGG - Intronic
905670302 1:39786859-39786881 GGTTGCGGGAAGCAGAGGCTTGG + Intronic
905789791 1:40783958-40783980 GGGCGCGGGCGGCGGGGGCTAGG - Intergenic
907201004 1:52726703-52726725 GGTGGCGGGCGGCTGCGGCTAGG - Intronic
913075530 1:115338137-115338159 GGGCGCGGGCAGGGGTGGCTGGG - Intronic
915246464 1:154559044-154559066 GGGCGGGGGAAGCGGCGCCCGGG - Intergenic
915637164 1:157195221-157195243 GGGCCCGGGAACCGGCGGCCGGG - Intergenic
918066386 1:181104937-181104959 GCTTGAGGGAAGCGGCGGCACGG - Intergenic
922096003 1:222443305-222443327 GGAGGCGGGAAGCGGTGGGTGGG - Intergenic
923538631 1:234871885-234871907 GGTTGGGGGAAGGGGAGGCTAGG + Intergenic
1067275483 10:44829456-44829478 GGACCCGGGAAGGGGCGTCTAGG - Intergenic
1069651748 10:70053921-70053943 GCTCGCGGGGCGCGGCGGTTGGG + Intronic
1073035687 10:100562851-100562873 GGTGGCGGGAGGAGGCGGCCGGG + Intergenic
1073216618 10:101840068-101840090 GGTGGCGGGGAGGGGCGGCGCGG + Intronic
1077214581 11:1390112-1390134 GGACGCGGGGGGCGGCGGCGCGG + Intronic
1081700026 11:45146968-45146990 GGGGGCCGGGAGCGGCGGCTGGG + Intronic
1083656994 11:64234589-64234611 GGCGGCGGGCAGCGGCGGCGGGG - Exonic
1083895210 11:65616287-65616309 GGGCGCGGGCAGCAGCGGCGGGG + Exonic
1084310228 11:68312516-68312538 GGGCGCGGGTGGCGGCGGCGGGG + Intergenic
1085044041 11:73343208-73343230 GCTCCCCGGAGGCGGCGGCTGGG - Intronic
1092256214 12:6928011-6928033 GGGCGCGGGCGGCGGCGGGTCGG + Intronic
1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG + Intronic
1096191532 12:49623353-49623375 GGACCCGGGACGCGGCGGCGCGG + Intronic
1097439832 12:59596060-59596082 GGTGGCGGGAAGGGGAGGCGCGG - Intronic
1104568242 12:129903787-129903809 GGACGCGGGCAGAGGCGGCTCGG + Intergenic
1104929382 12:132329795-132329817 GGGCGCGGGGAGCGGGGGCGGGG + Intergenic
1113542011 13:111115901-111115923 GGTCGGGGGGAGGGGCGGCGCGG + Intronic
1113841579 13:113364207-113364229 GGGCGGGGGGAGGGGCGGCTGGG + Intergenic
1114627955 14:24141548-24141570 GGGCGCGGGAAGGCGGGGCTCGG - Exonic
1115769596 14:36656059-36656081 GGTGGCCGGGAGAGGCGGCTGGG + Intergenic
1117842051 14:59870448-59870470 GGGCCCGGGAAGCGGCGTCGCGG - Exonic
1119808742 14:77499146-77499168 GTTCGCGGGAAGCTGCGGCCCGG + Intergenic
1121648173 14:95535191-95535213 GGGCGCGGGCGGCGGCGGCTCGG + Exonic
1122975294 14:105168445-105168467 GGGCGCGGGCGGCGGCGGCGGGG - Exonic
1123036766 14:105474797-105474819 GGGCGCGGGCGGCGGCGGCCCGG + Intronic
1125606376 15:40941964-40941986 GGCCGCGGGAAGCGGAGCCGCGG + Intergenic
1129220400 15:74128845-74128867 GGGGGCGGGGAGCGGCGTCTTGG - Intronic
1131215226 15:90530312-90530334 GCGCCCGGGAACCGGCGGCTGGG + Intronic
1132579815 16:679816-679838 AGGGGCGGGAGGCGGCGGCTGGG + Intronic
1133225009 16:4336953-4336975 GGGGGCGGGCAGTGGCGGCTTGG - Exonic
1133236672 16:4390580-4390602 GGACGAGGGAGGCGGAGGCTGGG + Intronic
1135976143 16:27109937-27109959 GGGAGCGGGGAGCGGCGGGTGGG - Intergenic
1136396481 16:29995300-29995322 GGCCGCGGGAGGCGGAGGCGGGG - Exonic
1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG + Intergenic
1139418081 16:66830697-66830719 GGGCGCGGGAAGCCGGCGCTCGG - Intronic
1141407627 16:83807983-83808005 CGTCGCGAGAAGCAGCGGCCCGG + Exonic
1142501577 17:336094-336116 GGCCTCGGGAAGCACCGGCTCGG - Intronic
1146759156 17:35460793-35460815 GCCCGCGGGAAGTGGCGGCCTGG + Intergenic
1147793080 17:43025281-43025303 GGGCGGGGGAGGCGGCGGCGGGG + Exonic
1148122731 17:45222198-45222220 GGCCGCGGGCATCGGCTGCTTGG - Exonic
1150445586 17:65225122-65225144 GGTCGCCGGATGAAGCGGCTGGG - Exonic
1151747112 17:76017709-76017731 AGCAGCGGGAAGGGGCGGCTGGG - Intronic
1152112489 17:78365045-78365067 GGTCGCGGGAAGCCGTGGCATGG + Intergenic
1152362552 17:79839383-79839405 GGGCGCGGGCAGCGGCGGGCCGG - Exonic
1157152657 18:45233748-45233770 GGGCGGGGGAAGCGGGGGGTGGG - Intronic
1158150158 18:54358304-54358326 GGTCGCGGGACGCGGCGGAGGGG + Intronic
1159798518 18:72869307-72869329 GGTGCCGGGAAGCGGAGGCCGGG - Intergenic
1160745550 19:709385-709407 GGACCCGGGCAGCGGCGGCTCGG + Intronic
1160930707 19:1568343-1568365 GGCCGCGGGAGGCGGCGGGAGGG - Intergenic
1161388117 19:4007706-4007728 GGTCACGTGACGCGACGGCTGGG + Exonic
1161898326 19:7099268-7099290 GGGCGGGGGAAGCCGAGGCTCGG + Intergenic
1161925210 19:7294388-7294410 GGCCGCGGGAAAAGGCGGCGCGG + Intergenic
1162959506 19:14117687-14117709 AGACGCGGGAAGCAGGGGCTGGG - Exonic
1165157441 19:33796796-33796818 GGCCGCGTGAAGCGGGGGCCGGG + Intronic
1166055448 19:40285368-40285390 GGGGGCGGTAAGCGGGGGCTGGG - Exonic
1167463828 19:49639978-49640000 GGTCGTGGGCGGCGGCGGCGTGG - Exonic
1167578345 19:50328377-50328399 GGGCGCGGGCGGCGGCGGCCTGG - Exonic
926393677 2:12419985-12420007 GGTGGCAGGAAGCGGTGGATTGG - Intergenic
930700990 2:54457218-54457240 GGGCGGGCGCAGCGGCGGCTCGG - Intronic
931117492 2:59180470-59180492 TGTCGCCTGAAGCGGAGGCTCGG - Intergenic
937658605 2:124405037-124405059 GGTGGCGGGTGGGGGCGGCTGGG + Intronic
941463090 2:165794035-165794057 GGTGGCGGGAAGCGGCGGCCGGG + Exonic
942459548 2:176159807-176159829 GGAAGCGGGAAGTCGCGGCTTGG + Intronic
945119615 2:206443917-206443939 GGCCGCAGGAAGCGCCGGCAAGG - Exonic
1171512440 20:25696502-25696524 GGTTGCGTGTAGTGGCGGCTCGG - Intronic
1175226733 20:57448980-57449002 GCTCGCGGGAAATGGAGGCTCGG + Intergenic
1176233289 20:64042593-64042615 GGTCAGGGGAAGAGGCGGCCGGG + Intronic
1176281578 20:64316621-64316643 GGGAGCGGGCAGCGGCGGCGGGG + Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1181831725 22:25565182-25565204 GGCCGCAGGGGGCGGCGGCTTGG - Intronic
1182271186 22:29154552-29154574 GGCGGCAGGAGGCGGCGGCTGGG - Intronic
1183437701 22:37804978-37805000 GGGCGCGGGGGGCGGCGGCCGGG + Intergenic
1183726104 22:39590487-39590509 GGCAGAGGGAAGCGGAGGCTGGG - Intronic
1184713591 22:46267952-46267974 GGTCGCGGAAAGGGGCGGGGCGG - Exonic
955856504 3:63278591-63278613 GGGCGGGGGATGCCGCGGCTTGG + Intronic
963289935 3:143477356-143477378 GGTGGCGGGAGGGGGCGGCGGGG - Intronic
963827499 3:149970920-149970942 GGTAGCGGGCGGCGGCGGCGCGG + Exonic
968949627 4:3683834-3683856 GGTCTCGGGGAGGAGCGGCTGGG - Intergenic
972072328 4:35038081-35038103 GGTGGCGGGATGCGGGGGATGGG - Intergenic
981504226 4:145482172-145482194 GGGCGCGGGCAGCGGCGGGAAGG + Intronic
983620653 4:169757846-169757868 GGTGGCGGGAAGCGCAGGCCCGG - Exonic
986330662 5:6714067-6714089 GGGCGTGGGCCGCGGCGGCTCGG + Intergenic
988547818 5:32174382-32174404 AGGCGCCGGAAGCGGCGGCCGGG + Intergenic
989229814 5:39073902-39073924 GGGCGAGGGAAGCGGGCGCTGGG + Intronic
999782172 5:154858400-154858422 GGTCGCGGGAAGCAGCGCGCAGG - Exonic
1001529917 5:172454533-172454555 GGGGGCGGGCGGCGGCGGCTGGG - Intergenic
1002927176 6:1611314-1611336 GGGCGCGGGCGGCGGCGGCGCGG - Exonic
1003135966 6:3435048-3435070 GGGTGCTGGAAGCGGCTGCTGGG + Intronic
1004193875 6:13487277-13487299 GGTCCCGGGCTGCGGCGGCGCGG - Exonic
1007557789 6:42781910-42781932 GGGCGCGGGGAGCGGCGCCCCGG + Intronic
1019377369 7:699978-700000 GGGCGGGGGAAGGGGCGGCAGGG + Intronic
1019474156 7:1236121-1236143 GGCGGCGGGCGGCGGCGGCTCGG - Exonic
1030138735 7:106284668-106284690 AGGCGCGGGCGGCGGCGGCTGGG - Intronic
1033240449 7:139674883-139674905 GATGGCAGGAAGCGGCAGCTGGG - Intronic
1034339012 7:150340670-150340692 GGGCGCGGGAGGAGGCGGCTCGG - Exonic
1034522608 7:151632265-151632287 GGACGCGGGCAGCGGGGGCCGGG + Intronic
1038540338 8:28385842-28385864 GGGCGCGGGACGCTGCGGCAGGG - Intronic
1038828449 8:31032866-31032888 GGTCGCGGGCGGCGGCGGGGCGG - Exonic
1039513018 8:38106390-38106412 GGTCGATGTAAGCGGTGGCTTGG + Exonic
1048209156 8:132440571-132440593 GGTCGTGGGAAACTGAGGCTTGG + Intronic
1049094337 8:140539632-140539654 GGATGCAGGAAGCGGGGGCTTGG + Intronic
1049663073 8:143829123-143829145 GGTCGCGTGAGGCGGGGGCGGGG - Intronic
1049755298 8:144308831-144308853 GGCCTGGGGAAGGGGCGGCTTGG + Intronic
1053050668 9:34958395-34958417 GGTCCCGGTAAGCGGGGGCGGGG + Exonic
1057054342 9:91949610-91949632 GGGGGCGGGCGGCGGCGGCTGGG - Intronic
1060599594 9:124869188-124869210 GGGGGCGGGAAGCGGCTGCCCGG - Exonic
1061726091 9:132582726-132582748 GGGCAGGGGCAGCGGCGGCTGGG + Exonic
1061898273 9:133659850-133659872 GATCGCGGGAAGAGGCTTCTTGG - Intergenic
1062615472 9:137394106-137394128 GGGTTAGGGAAGCGGCGGCTGGG - Intronic
1187547363 X:20266947-20266969 GGGCGCGGGAACCGGCGGGGGGG - Intronic
1190329312 X:49226052-49226074 GCTCGGCGGAGGCGGCGGCTGGG + Exonic
1196645901 X:118116938-118116960 GGTGGCGGGGAGCCGGGGCTAGG + Intronic