ID: 1094042577

View in Genome Browser
Species Human (GRCh38)
Location 12:26133294-26133316
Sequence GGGGAGTGAGGGAGATGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1881
Summary {0: 1, 1: 0, 2: 14, 3: 201, 4: 1665}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094042577 Original CRISPR GGGGAGTGAGGGAGATGAAG GGG (reversed) Intronic
900204791 1:1427290-1427312 GGTGGGTCAGGGTGATGAAGGGG - Intronic
900249889 1:1663055-1663077 GGAGACTGAGGGAGAGGGAGGGG + Exonic
900394573 1:2447934-2447956 GGGGAGGGAGGGATAAGCAGGGG - Intronic
900395181 1:2450571-2450593 GGGGAGTGAGGGGGAAGGTGGGG - Intronic
900408827 1:2503886-2503908 GGGGAGTGAGAGAGAGCCAGAGG - Intronic
900504909 1:3025033-3025055 GGGGAGGGAAGGGGATGGAGTGG + Intergenic
900546501 1:3232190-3232212 GAGAAGTGAGGGAGATGGATCGG - Intronic
900708225 1:4094005-4094027 GGGGAGGCAGGGAGCTGCAGGGG + Intergenic
900802675 1:4747122-4747144 AGGGAGAGAAGGAGAGGAAGAGG + Intronic
901198991 1:7456160-7456182 AGGGAGGGAGGGAGATGGAAGGG + Intronic
901270807 1:7952070-7952092 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
901403483 1:9030991-9031013 GGTGAGAGATGGAGCTGAAGAGG - Intergenic
901469187 1:9443869-9443891 GGAGAAGGAGGGAGAGGAAGGGG - Intergenic
901739650 1:11333917-11333939 GGGGAGGGAGGCAGAGGCAGCGG + Intergenic
901778239 1:11575394-11575416 GGGGAAGGAGGGAGAAGAAGTGG - Intergenic
901957754 1:12798643-12798665 GGAGGGTGAGTGAGATAAAGAGG - Intergenic
901981155 1:13034772-13034794 GGAGGGTGAGTGAGATAAAGAGG - Intronic
901988419 1:13093264-13093286 GGAGAGTGAGCAAGATAAAGAGG + Intergenic
901993393 1:13133503-13133525 GGAGAGTGAGCAAGATAAAGAGG - Intergenic
902000931 1:13194157-13194179 GGAGGGTGAGTGAGATAAAGAGG + Intergenic
902020161 1:13339861-13339883 GGAGGGTGAGTGAGATAAAGAGG + Intergenic
902196268 1:14800870-14800892 GGGGACTGTGGGAGGGGAAGTGG + Intronic
902490860 1:16779428-16779450 AGGGGGTGAGGGAGAGGAAGGGG + Intronic
902701884 1:18178094-18178116 GGGGAGAGAGAGAGAGAAAGAGG + Intronic
902793924 1:18787974-18787996 GAGGAGGGAGGGAGAGAAAGGGG + Intergenic
903143796 1:21356639-21356661 GTGCAGTGAGGGAGAAGAAAAGG - Intergenic
903183789 1:21618490-21618512 GGGGACTCAGCGAGATGAGGGGG - Intronic
903240716 1:21980964-21980986 GGGGAGGGTGGGTGATGATGGGG + Intronic
903244456 1:22005587-22005609 GGGGAGAGTGGGTGATGATGGGG + Intronic
903292125 1:22320880-22320902 GGGGAATGAGGGAGAGGAGGGGG + Intergenic
903337446 1:22634610-22634632 GGGGAGTGAGCAAGACGAAGAGG + Intergenic
903426274 1:23256770-23256792 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
903438755 1:23371310-23371332 GGGGAGTGGGGAAGAGGGAGTGG + Exonic
903507975 1:23852444-23852466 GGGGGGAGAGGGAGAGGGAGAGG - Intronic
903860778 1:26363248-26363270 GGGCCCTGAGGGAGATGACGGGG - Intronic
904355813 1:29939073-29939095 GGGTAGAGAGGGAGAGAAAGGGG - Intergenic
904433826 1:30481381-30481403 GGTGATTGAGGGAGAAGAAGAGG + Intergenic
904443836 1:30551520-30551542 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
904771012 1:32881467-32881489 TGGGAGTGAGGAAGAGGGAGGGG + Intergenic
904831817 1:33310292-33310314 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
904886932 1:33745760-33745782 GGGGAGAGAAGGACATGAAAAGG + Intronic
905266929 1:36760721-36760743 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
905362369 1:37429787-37429809 AGGGAGGGAGGGAGAGAAAGAGG - Intergenic
905473768 1:38211679-38211701 TGGGAGTGGGGGAGGTGATGGGG - Intergenic
905546153 1:38801946-38801968 AGAGAGTGAGTAAGATGAAGAGG - Intergenic
905839529 1:41162879-41162901 GGAGGGTGAGCAAGATGAAGAGG - Intronic
906063540 1:42963495-42963517 GGGGAATGAGGGAGACAGAGAGG - Intergenic
906141179 1:43534495-43534517 TGGGAGTGAAGGAGAGGAAGAGG + Intronic
906187247 1:43871408-43871430 GGAGTGTGAGGGAGAGGACGGGG + Intronic
906187260 1:43871465-43871487 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187266 1:43871484-43871506 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187272 1:43871503-43871525 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187278 1:43871522-43871544 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187296 1:43871577-43871599 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187305 1:43871615-43871637 GGGATGTGAGGGAGAAGATGGGG + Intronic
906187314 1:43871653-43871675 GGGATGTGAGGGAGAAGATGGGG + Intronic
906187320 1:43871672-43871694 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187326 1:43871691-43871713 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187343 1:43871745-43871767 GGGGTGGGAGGGAGAGGATGAGG + Intronic
906187358 1:43871802-43871824 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187483 1:43872178-43872200 GGGGTGTGAGGGACAGGAGGGGG + Intronic
906427024 1:45723977-45723999 GTGGAGAGAGGGAGAGGGAGGGG - Intronic
906459524 1:46026715-46026737 GGGAAGTGAGGGAACAGAAGAGG + Intronic
906669854 1:47646448-47646470 GGGGAGGGAGGCAGATACAGAGG - Intergenic
906820201 1:48921162-48921184 GGGGAGAGGGGGAGGGGAAGTGG + Intronic
907091521 1:51729808-51729830 GGGGGGTGAAGGGGGTGAAGGGG + Intronic
907105526 1:51878940-51878962 GCGGGGCGAGGGAGAAGAAGCGG + Intergenic
907300272 1:53482618-53482640 GGGGGGTGAGAGAAAGGAAGGGG - Intergenic
907303667 1:53502619-53502641 GGGGAGAGAGGCAGATAGAGCGG + Intergenic
907440713 1:54476530-54476552 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
907505881 1:54918059-54918081 GAGGAGGGAGGGAGAGGGAGGGG - Intergenic
907761875 1:57368707-57368729 GGAGGGTGAGCAAGATGAAGAGG - Intronic
908159553 1:61393292-61393314 GGGGAGAGAGGGAGAGAAAGAGG - Intronic
908171918 1:61513314-61513336 GGGGAGTGAGGGATGGGAAATGG - Intergenic
908179391 1:61589074-61589096 GGGGAGAGAGAGAGAGAAAGAGG - Intergenic
908341316 1:63182549-63182571 AGAGAGAGAGGGAGAGGAAGAGG + Intergenic
908378188 1:63567525-63567547 GGGGAGTGAGGGAGATTGGGGGG + Intronic
908445978 1:64200460-64200482 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
908647380 1:66293160-66293182 GGGGAGGGAGGGAGAAGCACTGG + Intronic
908970034 1:69816793-69816815 GGGGAGTGCGGGTAATGAGGAGG - Intronic
909186306 1:72490876-72490898 GGGGGGTGAGGGGGATGAATAGG + Intergenic
909238230 1:73180310-73180332 GGAGAGTGAGCAAGATGAACAGG + Intergenic
909466723 1:75981263-75981285 GGCAAGTGAGAGAGATCAAGAGG - Intergenic
909583907 1:77267679-77267701 TAGCAGTCAGGGAGATGAAGAGG + Intergenic
910338252 1:86156812-86156834 GGGTAGGGAAGGAGATGAAGTGG + Intronic
910422720 1:87084781-87084803 AGGGAGAGAGGGAGAAGGAGAGG - Intronic
910482125 1:87670115-87670137 GGAAAGGGAGGGGGATGAAGAGG + Intergenic
910564863 1:88632070-88632092 GGGAAGTGAGGGTGAGGAAAAGG + Intergenic
911228144 1:95330711-95330733 GGGGAAAGAGAGAGATGATGAGG + Intergenic
911233366 1:95383615-95383637 GGAGAGAGAGAGAGGTGAAGAGG + Intergenic
911275618 1:95854220-95854242 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
911553306 1:99311270-99311292 GGGGAGTAAAGGAGATGAAAAGG - Intergenic
912266348 1:108160972-108160994 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
912459492 1:109821499-109821521 GGGGTGTGAGGGAGCAGGAGGGG + Intergenic
912664309 1:111565215-111565237 GGGGAGTGTGGTAGAAGATGAGG + Intronic
912751517 1:112292561-112292583 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
913057440 1:115175526-115175548 CAGGACTGAGGGAGATGATGGGG + Intergenic
913119698 1:115728468-115728490 GGGGGGTGATGTAGATGATGAGG + Intronic
913153288 1:116067042-116067064 AGGGAGTGAGAGTGAGGAAGAGG + Exonic
913197589 1:116470896-116470918 TGTGAGAGAGGGAGAGGAAGGGG - Intergenic
913208924 1:116567288-116567310 AGGGAGGGAGGGAGAAGAAAGGG + Intronic
913421705 1:118677026-118677048 GGTCAGTGGGGGAGATGGAGAGG + Intergenic
913450297 1:118988320-118988342 GAGGGGTGAGGGAGAGGGAGGGG + Intronic
914334754 1:146704264-146704286 AGGGAGAGAGGGAGAGAAAGGGG + Intergenic
914787774 1:150850248-150850270 GTGGGGAGAGGGAGATGGAGAGG - Intronic
914887832 1:151599584-151599606 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
915049700 1:153055692-153055714 GGGGAGTGATGATGATGAGGAGG + Intergenic
915107514 1:153543561-153543583 GGGGACTGAGGGATATGTTGTGG - Intergenic
915200279 1:154221509-154221531 GGGGAGGGAGGGCGATGGGGTGG + Intronic
915497685 1:156293276-156293298 GGGGACTTGGGGAGTTGAAGTGG - Intronic
915549249 1:156623264-156623286 AGGAAGAGAGGGAGAGGAAGGGG + Intronic
915647800 1:157286276-157286298 CGGGAGTGAGGGTGAGGAACAGG + Intergenic
915691563 1:157695929-157695951 GGGGAGGGAGGGAGGGGAGGGGG - Intronic
915929915 1:160053988-160054010 GGGGATTGAGGTGGAGGAAGGGG - Intronic
915938907 1:160106105-160106127 GGGGATTGTGGGAGATGGAAGGG - Intergenic
916079246 1:161222231-161222253 GGGGAGTAAGGGAGGAGAAGAGG - Intergenic
916322515 1:163520802-163520824 GGGGAGTGGGGATGATGAATGGG + Intergenic
916415946 1:164592082-164592104 GGGGGGAAAGGCAGATGAAGGGG + Intronic
916460963 1:165023790-165023812 AGGGAGAGAGAGAGAGGAAGGGG + Intergenic
916555452 1:165890738-165890760 TGGCAGAGAGGGAGATGGAGGGG + Intronic
916727036 1:167532785-167532807 GGAAAGGGTGGGAGATGAAGAGG + Intronic
916727639 1:167536972-167536994 GAAAAGTGAGGGAGATGAGGAGG + Intronic
916865377 1:168850736-168850758 GGGTAGTGAGGGCTGTGAAGAGG + Intergenic
917152846 1:171963370-171963392 GGGGAGAGGGAGAGATGAATAGG + Intronic
917312014 1:173688599-173688621 GGAGAGAGAGAGAGAGGAAGAGG - Intergenic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
917679684 1:177353205-177353227 GGGGTGTGAGGGCGCTGATGTGG + Intergenic
918006038 1:180543096-180543118 AGGGGGAGAGGGAGAAGAAGAGG + Intergenic
918009334 1:180572036-180572058 AGGGACAGAGGCAGATGAAGGGG + Intergenic
918192379 1:182188218-182188240 GGAGGGAGAGGGAGAGGAAGAGG - Intergenic
918443713 1:184595338-184595360 TGTGAGTGGGGGAGATGAGGAGG - Intronic
919163613 1:193863830-193863852 GGGGTGTGAGGGAAATAAAATGG - Intergenic
919513387 1:198493818-198493840 GGTGGGTGAGCAAGATGAAGAGG + Intergenic
919705348 1:200670036-200670058 AGGGAGGGAGGGAGAAGGAGAGG + Intergenic
919788638 1:201275997-201276019 GGGGAGTGAATGAGAGGCAGGGG + Intergenic
919813240 1:201422100-201422122 GGGGAATGAGGGAGAGCAAAGGG + Intronic
919981328 1:202644193-202644215 GGGGAGAAAGGGCGATGGAGGGG + Intronic
919982014 1:202647588-202647610 GAGGAGTGAGGGAGAAAGAGGGG + Intronic
920294186 1:204945897-204945919 GGTGAGTGAGAGAGGAGAAGTGG - Intronic
920744570 1:208614440-208614462 GGAGGGAGAGGGAGATGAAAGGG + Intergenic
920948784 1:210553781-210553803 AGGGAGAGAGGGAGAGGAGGAGG - Intronic
921172816 1:212564366-212564388 GAGGAGTGGGGGTGATGAACAGG + Intergenic
921192618 1:212724252-212724274 GGAGAGAGAGGGAGAGGAAGAGG - Intergenic
921301468 1:213755129-213755151 GGGGAGTGAGGCAGAAAAGGAGG + Intergenic
921411232 1:214838445-214838467 TGGGAGTAAGGGAGAGGGAGGGG + Intergenic
922132797 1:222795876-222795898 GGAGAGTGGGTAAGATGAAGCGG - Intergenic
922174760 1:223188833-223188855 GGGGAGGAAGGGGGAGGAAGAGG + Intergenic
922436795 1:225615049-225615071 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
922554401 1:226521889-226521911 GAGGAGAGAGGGAAGTGAAGAGG - Intergenic
922587786 1:226748685-226748707 GGGAAGAGAAGGATATGAAGAGG + Intergenic
922824915 1:228511247-228511269 GGGGAAAGAGAGAGATGGAGAGG - Intergenic
922993172 1:229932601-229932623 AGGGAGAGAGGGAGAGGGAGGGG + Intergenic
923093546 1:230757308-230757330 GGGAAGGGAGGCAGAGGAAGAGG - Intronic
923127180 1:231042049-231042071 TGGGAGTAAGGGAGAGGAAGGGG + Intergenic
923259094 1:232249771-232249793 GGGCAGGGAAGGAGATTAAGTGG - Intergenic
923358799 1:233187465-233187487 GGGGAGTGAGGGATACAGAGAGG - Intronic
923468415 1:234268454-234268476 GTGGAGAGAGGGAGAGGGAGAGG + Intronic
923529585 1:234803108-234803130 AGGGGGTGAGGGAGAGGAAGGGG - Intergenic
923812834 1:237339472-237339494 GGGGAATGAGGACTATGAAGAGG - Intronic
923827359 1:237515606-237515628 GGGGAGGGAGGGGGAGGAGGAGG - Intronic
923988093 1:239403954-239403976 AGGGAGGGAGGGAGAGGGAGGGG + Intronic
924073762 1:240310768-240310790 GGGGAATGAGGGAGCAGATGAGG + Intronic
924331581 1:242945790-242945812 GGGGAATGAGTGAGTTGAACTGG + Intergenic
924593553 1:245426184-245426206 AGGGAGGGAGAGAGAGGAAGGGG - Intronic
1062852827 10:758876-758898 GGGGAGGATGGTAGATGAAGGGG + Intergenic
1063776916 10:9273976-9273998 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1063776924 10:9274007-9274029 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1063776938 10:9274069-9274091 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1063876476 10:10484181-10484203 GGGGAGGGAGGGAGATAAATGGG - Intergenic
1063876493 10:10484236-10484258 GGGGAGGGAGGGAGAGGAGGGGG - Intergenic
1063876506 10:10484259-10484281 GGGGAGGGAGGGAGAGAGAGAGG - Intergenic
1063876515 10:10484282-10484304 GGGGAGGGAGGGAGAGAGAGAGG - Intergenic
1063960394 10:11301460-11301482 GGGAAGCGAGGGGGGTGAAGTGG - Intronic
1064114823 10:12568506-12568528 GGGGAGGGAGGGAGGGAAAGAGG - Intronic
1064304885 10:14156553-14156575 GGAGAGGGAGGGAGATAATGAGG + Intronic
1064351783 10:14583636-14583658 GGGGACGGAGGAAGAAGAAGAGG + Intronic
1065025141 10:21534269-21534291 GGGCAGCGAGGGAGGGGAAGGGG - Intronic
1065118418 10:22504703-22504725 GGGGAGAGAGAGACATGAGGGGG - Intergenic
1065187523 10:23183348-23183370 GGAGAGTGAGGGAGTTAGAGGGG + Intergenic
1065382199 10:25101826-25101848 GGAGAGGAAGGGAGATGCAGAGG + Intergenic
1065645160 10:27826473-27826495 TGAGAGTGAGGGAACTGAAGTGG - Intronic
1065665125 10:28050825-28050847 TGGGAGGGAGGGAGAGGAGGTGG + Intergenic
1065782570 10:29183704-29183726 AGGGAGTGAGGAAGATGGGGAGG - Intergenic
1066045678 10:31593745-31593767 AGGGAGGGAAGGAGAGGAAGAGG + Intergenic
1066101495 10:32122242-32122264 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1066266576 10:33781870-33781892 GCGCAGTCAGGGATATGAAGAGG - Intergenic
1066295607 10:34051605-34051627 TTGGAGTGAGGGAGCTGCAGCGG + Intergenic
1066357117 10:34695573-34695595 GAGGAATGAGGAAGAGGAAGAGG - Intronic
1066442051 10:35448702-35448724 AGGGAGTGTGGGGGATGGAGGGG + Intronic
1066485472 10:35838795-35838817 GGGGAGTGAGGATGATTAATGGG - Intergenic
1067052428 10:43029659-43029681 GGAGTGTGAGGGAGAGGGAGGGG - Intergenic
1067086359 10:43242501-43242523 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1067267226 10:44756948-44756970 GGGGAGATAGGGAGATGACAAGG - Intergenic
1067438113 10:46292910-46292932 GGAGGGTCAGGGAGAGGAAGGGG + Intronic
1067574930 10:47403120-47403142 GAGGAATGAGGGAGAGGAGGGGG + Intergenic
1067715784 10:48690486-48690508 GGAGGGTGAGCAAGATGAAGAGG + Intronic
1067807896 10:49405858-49405880 GAGGAGAGAGGGAGAGGGAGTGG - Intergenic
1068052528 10:51968394-51968416 GAGGAATGGGGGAGAAGAAGAGG + Intronic
1068195733 10:53713818-53713840 GGGGAGAGAGCAAGATGGAGGGG - Intergenic
1068245932 10:54367656-54367678 GGGGAGTGAGGGGGTAGGAGAGG + Intronic
1068558160 10:58481868-58481890 GGGAAGTGAAGGTGAGGAAGGGG - Intergenic
1068995976 10:63204611-63204633 GGGTAGTGAGGGAGAGTAAGGGG + Intronic
1069157681 10:65051718-65051740 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1069593007 10:69653433-69653455 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1069887940 10:71635638-71635660 GGGGAAGGAGGGAGTTGGAGAGG + Intronic
1069890447 10:71649108-71649130 GGGGAGACTGGGAGAGGAAGGGG - Intronic
1069900572 10:71704601-71704623 GGGGAGAGCAGGGGATGAAGGGG + Intronic
1069943383 10:71970236-71970258 GGGGGGTGAGGGGGATCAAGAGG - Intronic
1069982240 10:72260769-72260791 GGGGAGGGAGGGAGAGGCCGAGG - Intergenic
1070111414 10:73490729-73490751 GGGGTGAGAGGGAGAGGGAGAGG - Intronic
1070182417 10:74027135-74027157 GGGCAGTGAGGGAGAAGATGGGG + Intronic
1070265385 10:74897302-74897324 GGGGAGCGGGGGAGAGGAAGAGG - Intronic
1070367604 10:75751304-75751326 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
1070814687 10:79315278-79315300 AGGGTGTGAGGGAGGTGCAGAGG + Exonic
1071414088 10:85424800-85424822 GGGGATTTAGGGTGATGTAGGGG - Intergenic
1071444893 10:85736281-85736303 GGGGAGAGAGGGAGAAAGAGAGG + Intronic
1071554906 10:86594388-86594410 GGGGAGGGAGGGGGAGGGAGGGG + Intergenic
1071997149 10:91160730-91160752 AGGGAGTGACGGCGAAGAAGAGG + Intergenic
1072299747 10:94047794-94047816 GGGAAGGGAGGGACATGTAGAGG - Intronic
1072426395 10:95334338-95334360 GGAAAGTGAGGGGGCTGAAGGGG + Intronic
1072732024 10:97852687-97852709 AAGGAGAGAGGGAGAGGAAGGGG + Intronic
1072801463 10:98395174-98395196 GGTGAGTGAGGGGGGTGAGGTGG - Exonic
1073156417 10:101350723-101350745 GGTGAGTGAGGATCATGAAGGGG - Intergenic
1073159298 10:101375936-101375958 GGGAAGTGGGGGAAATGATGTGG + Intronic
1073192151 10:101659204-101659226 GGGGAGTGAGGGAGGTGCTGGGG - Intronic
1073208680 10:101781804-101781826 GGAGAGCGAGGAAGAGGAAGAGG - Exonic
1073253963 10:102139234-102139256 GCGCAGTGATGGAGAAGAAGAGG + Exonic
1073477591 10:103764368-103764390 GGAGAGTGAGTGAGCTGAAGAGG + Intronic
1073561268 10:104498835-104498857 TGGGGGTGAGGGAGATGAAGGGG + Intergenic
1073733621 10:106320606-106320628 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1073803891 10:107074188-107074210 GGGGAGTGCAGGAGATGAATAGG - Intronic
1074204660 10:111272275-111272297 GGGGAGAGAGGGAGAGGGGGAGG + Intergenic
1074278179 10:112024651-112024673 AGGGCCTGAAGGAGATGAAGAGG + Intergenic
1074377530 10:112951715-112951737 GGGGAGGGAGGGAGGGGAGGAGG - Intronic
1074524676 10:114253261-114253283 GGGGAGTGGGGGAGAGGAGGGGG - Intronic
1074538409 10:114345280-114345302 TGGGGGTGATGCAGATGAAGAGG + Intronic
1074557993 10:114509505-114509527 TGGGAGGGAGGGAGAGGAAGAGG - Intronic
1074654871 10:115573327-115573349 GGGGAGAAAGAGAGAAGAAGAGG - Intronic
1074704424 10:116118509-116118531 GGGAAGTGAAGCAGAAGAAGGGG - Intronic
1074825585 10:117213502-117213524 AGTGAGACAGGGAGATGAAGGGG - Intergenic
1074874412 10:117602897-117602919 TGGGAGGGATGGAGAGGAAGAGG + Intergenic
1074893429 10:117754244-117754266 GTGCAGTGAGAGACATGAAGGGG + Intergenic
1075108750 10:119560545-119560567 GGGGAGAGGGGGAGAGGGAGAGG + Intergenic
1075123537 10:119681692-119681714 GGAGAGAGAAAGAGATGAAGTGG - Intergenic
1075442336 10:122489784-122489806 TGGGGGTGTGGGAGAGGAAGGGG + Intronic
1076060961 10:127413574-127413596 GGGGAGTGAGGGCACTGACGAGG + Intronic
1076124521 10:127963279-127963301 TGGGAGTTAGTGAGATGCAGGGG - Intronic
1076252390 10:128994750-128994772 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1076318958 10:129564435-129564457 GGAGAGAGAGGAAGAAGAAGGGG - Intronic
1076332926 10:129684353-129684375 GGGGATAGAGGGAGATGCAGGGG + Intronic
1076762177 10:132611317-132611339 GGAGAATGAGGGAGGTGAGGTGG + Intronic
1076762191 10:132611362-132611384 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762247 10:132611541-132611563 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762280 10:132611631-132611653 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762297 10:132611676-132611698 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762355 10:132611856-132611878 GGAGGGTGTGGGAGGTGAAGTGG + Intronic
1077219470 11:1409220-1409242 GGGGAGTCAGGGAGAGGCTGGGG + Intronic
1077251523 11:1562969-1562991 GGCGACTGTGGGGGATGAAGGGG - Intronic
1077269374 11:1668050-1668072 GGGGAAGGAGGGAGGTGAGGGGG - Intergenic
1077360706 11:2139145-2139167 GGGAGTTGAGGTAGATGAAGAGG + Intronic
1077476833 11:2794455-2794477 GGGGAGTGAGAGAGATGGGAAGG + Intronic
1077535228 11:3120776-3120798 AGGGAGTGAGGGTGAGGAAGGGG - Intronic
1077696084 11:4393737-4393759 GAGGAGTGAGGGAGGAGCAGTGG + Intergenic
1077930587 11:6727945-6727967 GGGTGGTGAGGGGGATGATGAGG + Intergenic
1078191243 11:9093838-9093860 GAGGAGACAGGGAGAGGAAGAGG - Intronic
1078552709 11:12291321-12291343 GGGGAGAGCGGGAGAAGGAGGGG + Intronic
1078708032 11:13764211-13764233 GGGGAGTGGGGCAGAGGATGGGG - Intergenic
1079346102 11:19653879-19653901 GGGGAGTGTGGGAGGTGGAGTGG - Intronic
1079387858 11:19996892-19996914 GGGGACAGAGGGAAATGAGGTGG + Intronic
1079409819 11:20176960-20176982 GTTAAGGGAGGGAGATGAAGTGG + Intergenic
1079448140 11:20574964-20574986 GGAAAATGAGGAAGATGAAGAGG + Intergenic
1079594465 11:22225006-22225028 GGGGAAGGAGGGAGATAAAGGGG + Intronic
1079601531 11:22316746-22316768 GGGGAGAGAGAGAGAGGCAGGGG - Intergenic
1079710653 11:23679511-23679533 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1079892907 11:26080013-26080035 GGGGAGAGGGGGAGAGGAGGAGG + Intergenic
1079997038 11:27305552-27305574 GGGGGGTGAGCAAGGTGAAGAGG - Intergenic
1080173360 11:29333065-29333087 GAGCACTGTGGGAGATGAAGAGG + Intergenic
1080388125 11:31822073-31822095 GCTGAGAGAGGGAGATGAGGGGG + Intronic
1080478379 11:32619884-32619906 GGGAAGGGAGGGAGGGGAAGGGG + Intronic
1080556590 11:33422552-33422574 AGGGAGGGAGGGAGAGGAGGGGG - Intergenic
1080675134 11:34419069-34419091 AGAGAGAGAGGGAGAGGAAGAGG + Intergenic
1080783952 11:35457708-35457730 GTGGAGTGAGGGAAATGAGATGG + Intronic
1080861485 11:36153986-36154008 GGGGTGTGGGGGAGTTGGAGAGG + Intronic
1080997940 11:37627531-37627553 AGGGACTGAGGGAGATGGAGGGG - Intergenic
1081288489 11:41303106-41303128 GTGGGGTGAGGGAGAGGGAGAGG - Intronic
1081445961 11:43131728-43131750 GGGTAGAGTGGGAGAAGAAGAGG - Intergenic
1081537104 11:44004173-44004195 CAGGAGTGAGTGAGGTGAAGGGG + Intergenic
1081666669 11:44920687-44920709 GGAGAGGGAGGGAGAGGACGAGG + Intronic
1082012698 11:47460988-47461010 AGGGAGTGAGGGAGAGGATGGGG + Intergenic
1082029562 11:47594440-47594462 GGGGAGTAGGGGAGAGGGAGGGG + Exonic
1082233922 11:49799225-49799247 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1082706049 11:56496567-56496589 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1082760076 11:57118926-57118948 GGGGAGGGAGGGAGAGAAGGGGG + Intergenic
1082922010 11:58505644-58505666 GGGGAGGGAGGGGGCTGAATGGG + Intergenic
1082975727 11:59069959-59069981 GGGCAGTGGGGGGGCTGAAGGGG + Intergenic
1083006593 11:59352108-59352130 GGGGAATGGGTGAGTTGAAGTGG - Intergenic
1083118718 11:60490901-60490923 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083594041 11:63910686-63910708 TGGGAGCGGGGGTGATGAAGAGG - Exonic
1083741763 11:64714951-64714973 GGGGAGGGAGGGAGAGAAGGAGG + Intronic
1083831845 11:65238562-65238584 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1083943643 11:65912010-65912032 GGGGAGGGAGGAAGAGGAACTGG + Intergenic
1083968796 11:66059648-66059670 GGGGAGCCAGGGAGGTGAAAAGG + Intronic
1084149109 11:67279910-67279932 GGGAAGTGTGGGAGAGGAAGGGG + Intronic
1084501413 11:69537812-69537834 GGGGATTGATGGAGATGGTGGGG + Intergenic
1084624655 11:70296762-70296784 GGGGAGGGAGGGAGAGGGAGAGG + Intronic
1084839066 11:71830794-71830816 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1084901879 11:72315826-72315848 GGAGAGTGAGGCAGATCTAGAGG - Intronic
1085336268 11:75698947-75698969 AGGGATGGAGGGAAATGAAGAGG + Intergenic
1085554679 11:77409789-77409811 AGGGAGTGAGGAGGATGAAGGGG + Intronic
1085561250 11:77474184-77474206 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1086236220 11:84634191-84634213 TGAGAATCAGGGAGATGAAGGGG - Intronic
1086756940 11:90576629-90576651 GGGGAGAGAGGGAGAGGAAGAGG + Intergenic
1086770496 11:90758592-90758614 TGGGAGTAAGGGAAATGAAAAGG + Intergenic
1086795524 11:91096499-91096521 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1087044558 11:93833964-93833986 GGGAAGTGAGGAAGATGGATTGG - Intronic
1087117099 11:94537248-94537270 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1087211009 11:95446553-95446575 GGAGGGTGAGGAAGGTGAAGCGG + Intergenic
1087341622 11:96914424-96914446 AGGGAGGGAGGGAGAGGAAGGGG - Intergenic
1088381176 11:109194527-109194549 AGGGAGGGAGGGAGAAGAGGAGG - Intergenic
1088390677 11:109311232-109311254 GGGTGGTGAGGGAGAAGGAGAGG - Intergenic
1088920256 11:114255451-114255473 GGCGGGAGAGGGAGATGGAGAGG - Intergenic
1089019973 11:115203366-115203388 GGGGAGGGAAGGAAAAGAAGAGG + Intronic
1089324526 11:117648107-117648129 GTGGAGAAAGGGAGATCAAGGGG - Intronic
1089398819 11:118152832-118152854 GGGGAGGGAGGGAGCGGAGGGGG + Intronic
1089461312 11:118655966-118655988 GGGAAGGGAGGGGGATGAAGGGG - Intronic
1089528955 11:119114174-119114196 TGGGTCTGAGGGAGGTGAAGAGG - Exonic
1089587466 11:119519636-119519658 AGAGAGTGAGGGAGGGGAAGAGG + Intergenic
1089591949 11:119547282-119547304 GGAGGGTGAGCTAGATGAAGAGG - Intergenic
1089592922 11:119556247-119556269 AGGGAGGGAGGAAGAAGAAGAGG - Intergenic
1089705690 11:120276052-120276074 GGCCAGTGAGGGAAATGCAGGGG + Intronic
1089787075 11:120915448-120915470 AGGGAGAGAGGGAGATGAGATGG - Intronic
1090098004 11:123762853-123762875 GGGGAGCAAGAGAGAGGAAGGGG + Intergenic
1090132536 11:124159712-124159734 ATGGTGTGAGGGAAATGAAGAGG - Intergenic
1090162624 11:124511007-124511029 GGGGAATGAGTGAGTTGAACTGG - Intergenic
1090376918 11:126296553-126296575 GGGGAGTGAGAGATATGAGTAGG - Intronic
1090393044 11:126401879-126401901 AGGGAAGGAGGGAGATGCAGGGG + Intronic
1091197640 11:133745655-133745677 TGGGAGACAGTGAGATGAAGTGG - Intergenic
1091332937 11:134744713-134744735 AGGGAGTGAGAGAGAGAAAGAGG + Intergenic
1091585029 12:1811178-1811200 GGAGCTTGAGGGAGATGAAGGGG + Intronic
1091632174 12:2170601-2170623 GAAGAGTGAGGGAGTTGAGGTGG + Intronic
1091820592 12:3472757-3472779 GTGGAGAGAGGGAAATGAATGGG + Intronic
1091835949 12:3585881-3585903 GGGTAGTGAGGGAGCTGGGGAGG + Intronic
1091989821 12:4946392-4946414 AGGGAGTGAGAGAGAGGAAGAGG + Intergenic
1092040291 12:5378319-5378341 GGGGAGGGAGGAGGCTGAAGGGG - Intergenic
1092090096 12:5797253-5797275 GAGGAATGATGGAGAGGAAGTGG + Intronic
1092124561 12:6066126-6066148 GGGGCGTGGGGGAGATGGTGTGG - Intronic
1092453366 12:8624350-8624372 GGAGAGAGAGGGAGACGGAGAGG - Intergenic
1092503034 12:9066114-9066136 GGAGAATGAGACAGATGAAGAGG - Intergenic
1092547740 12:9466627-9466649 GGGAGGGGAGGGAGATGGAGTGG - Intergenic
1092780121 12:11978551-11978573 GGGGAGGGAGGGAGAGAGAGAGG + Intergenic
1092800124 12:12156430-12156452 GGGGAGTGAGAGTGAAGAAGGGG + Intronic
1092927014 12:13280457-13280479 GGGGAGTGATGGAGGGGCAGAGG - Intergenic
1093038333 12:14354034-14354056 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1093219275 12:16399619-16399641 GGGGAGTGATGCTGAAGAAGGGG - Intronic
1093281861 12:17204553-17204575 GGAGGGTGAGAAAGATGAAGAGG - Intergenic
1093361118 12:18229563-18229585 GGGGTGTGTGCGGGATGAAGTGG - Intronic
1094042577 12:26133294-26133316 GGGGAGTGAGGGAGATGAAGGGG - Intronic
1094505242 12:31055734-31055756 GGGAGGGGAGGGAGATGGAGTGG + Intergenic
1094599749 12:31898181-31898203 AGGGAAGGAGGGAGAGGAAGGGG + Intergenic
1094624285 12:32107565-32107587 GGGGAGTGAGGGCCAGGAAAGGG - Intronic
1095208262 12:39462955-39462977 GGAGAGTGAGGGAGAATGAGAGG - Intergenic
1095273939 12:40256730-40256752 TGGGAGTGTGGGGAATGAAGGGG - Intronic
1095342321 12:41106351-41106373 TTGGAGTGAGGGAGATGGAGAGG - Intergenic
1095358514 12:41306461-41306483 GGGGATGGAGGGAGATGGAATGG - Intronic
1095524583 12:43109911-43109933 GGGGGATGAGGGAGAGGAAGTGG - Intergenic
1095999386 12:48116141-48116163 AGGGAGTGAGGGAGAGAGAGAGG - Intronic
1096178941 12:49540133-49540155 GGGATGTGAGGGAGAGGAGGAGG - Intronic
1096524362 12:52201718-52201740 GTGGTGTGAGGGAGATGGAAGGG + Intergenic
1096712370 12:53466791-53466813 GGAGAGGGAAGGAGATGAGGGGG - Intronic
1096749086 12:53747455-53747477 GGCAAGGGAGGGAGAGGAAGAGG + Intergenic
1096779769 12:53985146-53985168 GGGGAGGGAGGAAAAAGAAGGGG - Intronic
1096788823 12:54032821-54032843 AGGGAGTGAGAGAGAGAAAGAGG - Intronic
1096820526 12:54230311-54230333 GAGAAGTGAGGAAGATGAAGGGG - Intergenic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1096951797 12:55480091-55480113 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1097129900 12:56804315-56804337 GGAGAGTGAGTAAGATGAAGGGG + Intergenic
1097289957 12:57906349-57906371 GGTGAGAGAGGAGGATGAAGAGG + Intergenic
1097343467 12:58465952-58465974 GGGGGGAGAGGGAGAGAAAGTGG - Intergenic
1098447821 12:70585554-70585576 GGGAAGTGATGGAGATGAAAGGG - Intronic
1098951646 12:76645711-76645733 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1099033128 12:77553933-77553955 GGGGAGAGAGGCAGATGGGGTGG - Intergenic
1099141394 12:78980916-78980938 GGGGGGAGAGGGAGATGGAGGGG + Intronic
1099693407 12:85991051-85991073 GGAGGGTGAGCAAGATGAAGAGG + Intronic
1099861331 12:88228716-88228738 GGGCAATGAGGGAGAAGAATGGG - Intergenic
1100028213 12:90154011-90154033 TGGGAGTGAAGCAGATGAATAGG + Intergenic
1100103635 12:91141450-91141472 GGGGAATAAGGGATGTGAAGGGG - Exonic
1100236740 12:92669225-92669247 AGGGAGTGAGAGAGAGGGAGGGG + Intergenic
1100473354 12:94913372-94913394 GGGGAAGGAGGGACAGGAAGTGG + Intronic
1100597197 12:96081928-96081950 GGGGATTGAGAGACAGGAAGCGG + Intergenic
1100672762 12:96834864-96834886 GGAGGGTGAGCAAGATGAAGAGG + Intronic
1100955989 12:99908998-99909020 GGGGAGGGAGGGACAGGAATGGG - Intronic
1101332519 12:103768582-103768604 GGGGAGGGAGGGAGAGGGAAAGG + Intergenic
1101673231 12:106896449-106896471 GGGGAGGGAAGGGGAAGAAGAGG + Intergenic
1101673291 12:106896598-106896620 GGGGAGGGGAGGAGAGGAAGGGG + Intergenic
1101725993 12:107388589-107388611 GGAGAGAGAGAGAGAGGAAGAGG - Intronic
1101843918 12:108346536-108346558 GGGGGGTGAGAGACATGCAGTGG + Intergenic
1101868138 12:108538356-108538378 GGGGAGTGGAGGAGAAGGAGAGG + Intronic
1102028190 12:109725425-109725447 GGGGAGGGAGGGGGAGGGAGAGG - Intronic
1102175183 12:110868724-110868746 GGAGAGGGAGGGAGAGGGAGAGG + Intronic
1102201336 12:111059796-111059818 GGGCAGTGAGGGAGGTGTTGGGG + Intronic
1102255672 12:111413512-111413534 GGGCAGTGAGGGACCTGGAGTGG + Intronic
1102268106 12:111506621-111506643 GGGGAGGGGGGGAGAGGGAGAGG - Intronic
1102394262 12:112574243-112574265 GGGGAGGGAGGAAGAGGAAGAGG + Intronic
1102503153 12:113366790-113366812 GGGGAGGGAGGGAGAGGAGGAGG - Intronic
1102591166 12:113957886-113957908 AGGGAGTGAGGCCGAGGAAGAGG - Exonic
1102685185 12:114719101-114719123 TGGGGGTCAGGGAGATGAAATGG + Intergenic
1102779194 12:115548851-115548873 GGTAAGTTAGGGAGAAGAAGAGG - Intergenic
1102983727 12:117262460-117262482 AGGGAGGGAGGGAGAGAAAGGGG + Intronic
1103242591 12:119426817-119426839 AGGCAGAGTGGGAGATGAAGTGG - Intronic
1103414248 12:120733234-120733256 GGGGGGAGAGGGAGAGGGAGAGG + Intronic
1103615954 12:122152408-122152430 GGGAAGAGAGGGAAAGGAAGAGG - Intergenic
1103745013 12:123116674-123116696 GAGGAGTGAGGAGAATGAAGTGG + Intronic
1103830089 12:123772177-123772199 GGTGAGGGCTGGAGATGAAGGGG - Intronic
1103948933 12:124541278-124541300 GGGGGATGGGGGAGATGGAGGGG + Intronic
1103987738 12:124778765-124778787 GGGTGTTGAGTGAGATGAAGAGG - Intronic
1104038930 12:125116864-125116886 GGGAAGGGAGGGAAAGGAAGGGG - Intronic
1104301410 12:127568421-127568443 AGGGAGTGAGAGAGAGGGAGAGG + Intergenic
1104517751 12:129443511-129443533 TGGGAGGGAGGGAGATGGAGAGG - Intronic
1104657196 12:130582111-130582133 GAGGAGGGAGGGAGGTGGAGGGG - Intronic
1104771145 12:131365602-131365624 GGGGAGTGGGGGAGAGGTGGAGG - Intergenic
1104805595 12:131587364-131587386 GGAGGGTGAGCGAGATGAAGAGG - Intergenic
1104895833 12:132163198-132163220 GGACAGTGAGGGAGGTGACGCGG - Intergenic
1104927541 12:132321561-132321583 AGTGAGTGAGGGAGATGGTGAGG - Intronic
1106062837 13:26311680-26311702 AGGAAGAGAGGGAGATGAAGCGG - Intronic
1106231651 13:27825610-27825632 GGGGAGTGAGTGAGGAGAGGTGG - Intergenic
1106402833 13:29445949-29445971 AGGGACAGAGGGAGAGGAAGAGG - Intronic
1106431989 13:29689362-29689384 TGGGAGGGATGGAGAAGAAGGGG + Intergenic
1106833138 13:33606896-33606918 TGGGAGAGAGGCAGAAGAAGCGG - Intergenic
1107160296 13:37217858-37217880 GGAGAGAGAGAGAGATGAATAGG - Intergenic
1107446589 13:40474902-40474924 TGGGGGTCAGGGAGATGAAGAGG - Intergenic
1107758492 13:43651261-43651283 GGGGAGGGAAGGAGGAGAAGAGG + Intronic
1107835833 13:44411894-44411916 GGGGAGAGAGAGAGAGGGAGGGG + Intergenic
1107835843 13:44411920-44411942 GGGGAGGGAGGGAGAGAGAGAGG + Intergenic
1107863694 13:44683405-44683427 GTGGGGTGAGGGAGACGGAGAGG + Intergenic
1108040557 13:46335744-46335766 GGGGAGTGAGGGAAAGGGAAAGG + Intergenic
1108229828 13:48325117-48325139 GTGGAGGGTGGGAGAGGAAGCGG - Intronic
1108240277 13:48457115-48457137 GGAGGGTGAGCAAGATGAAGAGG + Intronic
1109290224 13:60464796-60464818 GGGGAGTGAGTGATAAGGAGGGG + Intronic
1109438949 13:62343834-62343856 GGAGAGTGAGTAAGGTGAAGAGG - Intergenic
1109470698 13:62799933-62799955 GGAGGGTGAGTGAGGTGAAGAGG - Intergenic
1109552216 13:63917995-63918017 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1109622158 13:64925042-64925064 GGAGAGTGAACAAGATGAAGAGG + Intergenic
1109812989 13:67539981-67540003 GGTGGATGAGGGAGATGAAATGG - Intergenic
1109856217 13:68131372-68131394 GGGGAGTGAGGCATCTTAAGTGG + Intergenic
1110577492 13:77075677-77075699 GGGGGGTGAGGGGAATGCAGAGG + Intronic
1111104871 13:83631772-83631794 GGAAAGTGAGGAAGCTGAAGTGG + Intergenic
1111388449 13:87561100-87561122 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1111998263 13:95186321-95186343 GGGGAGAGACGGAGTTGAATTGG + Intronic
1112001305 13:95212250-95212272 TAGGAGTGAGGGAGAAGAAAGGG + Intronic
1112155298 13:96810302-96810324 AGAAAGGGAGGGAGATGAAGGGG + Intronic
1112536538 13:100262677-100262699 GGGGGGAGAGGGAGGGGAAGGGG - Intronic
1112577102 13:100645524-100645546 GGGCAGTCAGGGACATGGAGAGG - Intronic
1112577113 13:100645571-100645593 GGGCAGTCAGGGACATGGAGAGG - Intronic
1112879368 13:104087090-104087112 AGGGAGCGAGAGAGAGGAAGGGG - Intergenic
1112964818 13:105176401-105176423 GGGGAGAGAGAGAGAGAAAGAGG - Intergenic
1113188994 13:107722100-107722122 GAGGAGGGAGGGAGAGAAAGGGG + Intronic
1113585234 13:111460095-111460117 GGGGAAAGAGGGAGAAGGAGAGG + Intergenic
1113648275 13:112014156-112014178 GGCGAGTGCGTGAGATGAAGTGG - Intergenic
1113655858 13:112067578-112067600 GGGGTGGGAGGGAGACGGAGAGG - Intergenic
1113677149 13:112215012-112215034 GGGGAGGGAGGGAGATGGTCAGG + Intergenic
1113677168 13:112215068-112215090 GGGGAGGGAGGGAGATGGTCAGG + Intergenic
1113677187 13:112215124-112215146 GGGGAGGGAGGGAGATGGTCAGG + Intergenic
1113677206 13:112215180-112215202 GGGGAGGGAGGGAGATGGTCAGG + Intergenic
1113677225 13:112215236-112215258 GGGGAGGGAGGGAGATGGTCAGG + Intergenic
1113677246 13:112215288-112215310 GAGGAGGGAGGGAGATGGGGAGG + Intergenic
1113677293 13:112215432-112215454 GGGCAGGGAGGGAGATGGTGAGG + Intergenic
1113909864 13:113836681-113836703 GGGGAATGAGGAGGAAGAAGAGG + Intronic
1113909869 13:113836702-113836724 GGGGAATGAGGAGGAAGAAGAGG + Intronic
1113909919 13:113836841-113836863 GGGGAGTGGGGGGGAGGAGGAGG + Intronic
1114200623 14:20516725-20516747 GGGGGGTAAGGGTGAGGAAGAGG - Intergenic
1114252245 14:20971452-20971474 CGGGAGTGAGGGAGGGGAGGAGG - Intergenic
1114281102 14:21192956-21192978 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1114298644 14:21353811-21353833 GGGGAGTGATGCTGAAGAAGGGG - Exonic
1114311668 14:21473167-21473189 GGGGAGGGAAGGAGAGGAAAGGG + Intronic
1114427484 14:22636389-22636411 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1114554120 14:23551698-23551720 GAGGAGTGAGGGCGAGGAGGAGG - Intronic
1114730822 14:24990860-24990882 GAGGAGGGAGAGAGAGGAAGAGG + Intronic
1115264875 14:31490916-31490938 GAGGACTGAGGGAGCTGCAGTGG + Intronic
1115547290 14:34475468-34475490 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1116142919 14:41023093-41023115 GAGGAATGAGGGTGATGGAGTGG - Intergenic
1116189910 14:41650918-41650940 AGGGAGGGAGGGAGAGGGAGAGG + Intronic
1116289986 14:43022383-43022405 GAGGAGGGAGGGAGGAGAAGAGG - Intergenic
1116408956 14:44600799-44600821 GTGGAGAGAGGGAGAGGGAGAGG - Intergenic
1116427331 14:44807007-44807029 AGGGAGGGAGGGAGGGGAAGGGG + Intergenic
1116506106 14:45683743-45683765 GGGGAGACAGGGAGATTGAGGGG - Intergenic
1116772377 14:49142598-49142620 GGTGGGTGAGAGAGAGGAAGTGG - Intergenic
1116959791 14:50957221-50957243 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1117548859 14:56814029-56814051 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1117663125 14:58029092-58029114 GGGGAGTGAGGGGAATGGAGAGG - Intronic
1117679601 14:58190055-58190077 GGGGAGAGAGGGAGAGGGGGAGG + Intronic
1117910696 14:60636038-60636060 GGGGAGAGAGGAACAGGAAGGGG - Intergenic
1117920667 14:60723164-60723186 AGGGGGTGGGGGAGAGGAAGGGG + Intronic
1118033480 14:61840762-61840784 AGGTATTAAGGGAGATGAAGAGG + Intergenic
1118157066 14:63252698-63252720 GAGGAGTGAGGGAGAAGATTAGG - Intronic
1118171975 14:63396307-63396329 GGGGGAGGAGGGAGAGGAAGAGG + Intronic
1118514339 14:66509014-66509036 GGGAAGGGAAGGAGAGGAAGGGG - Intronic
1118662618 14:68030926-68030948 AGAGAGGGAGAGAGATGAAGGGG + Intronic
1118682286 14:68255140-68255162 GGGGAGAGAGGAAAAGGAAGAGG - Intronic
1118979592 14:70705751-70705773 GGGGTGGGCAGGAGATGAAGTGG - Intergenic
1119254767 14:73185611-73185633 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
1119593589 14:75913267-75913289 GGGGAGGGAGGGAGCAAAAGTGG - Intronic
1119643207 14:76329967-76329989 GGGGAGGGAGGGAGGGGAAGAGG + Intronic
1119854419 14:77888615-77888637 TGGGAGTAAGGGAGATGGATGGG + Intronic
1119887145 14:78152601-78152623 GGGCAGGGAGGCTGATGAAGGGG + Intergenic
1119945110 14:78685243-78685265 TGGGAGAGAGGGAGATCCAGGGG - Intronic
1120086920 14:80285981-80286003 GTGGGGAGAGGGAGATGGAGAGG - Intronic
1120433981 14:84456701-84456723 AGGGAGTGAGGGAGGGAAAGTGG + Intergenic
1120511086 14:85415258-85415280 GAGGAATGTGGGAGATAAAGAGG + Intergenic
1120811712 14:88810582-88810604 GGGGAGGGAAGGAGAGGGAGAGG - Intergenic
1120885467 14:89448523-89448545 GAGGAGAGAGGGAGAAGCAGTGG - Intronic
1121368056 14:93332739-93332761 GGGGCGTCCGGGAGAGGAAGGGG - Intronic
1121695292 14:95907587-95907609 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1121697968 14:95928371-95928393 AGGGAGGGAGGGAGAGGGAGAGG - Intergenic
1121700036 14:95945665-95945687 GGGAAGGGAGGAAGATGAGGTGG - Intergenic
1121824598 14:97000177-97000199 GGAGGGTGAGCAAGATGAAGGGG + Intergenic
1121887285 14:97555289-97555311 GGGCAGTGGGGGAGATGAAGAGG - Intergenic
1122270196 14:100565531-100565553 GGGGGGTGTGGGAGAGGAGGGGG + Intronic
1122297510 14:100713689-100713711 GGAGACGGAGGGAGATGCAGAGG + Intergenic
1122392277 14:101398118-101398140 GGGGACTGTGGCAGATGCAGTGG - Intergenic
1122447840 14:101782065-101782087 GGGGAGAGAGGGAGTGGGAGAGG - Intronic
1122447920 14:101782270-101782292 GGGGAGAGAGGGAGGGGAATGGG - Intronic
1122447928 14:101782290-101782312 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122447946 14:101782328-101782350 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122447978 14:101782429-101782451 GGGGAGAGAGGGAGGGGAATGGG - Intronic
1122447986 14:101782449-101782471 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448036 14:101782587-101782609 GGGGAGAGAGGGAGGGGAATGGG - Intronic
1122448044 14:101782607-101782629 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448062 14:101782645-101782667 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448090 14:101782746-101782768 GGAGAGAGAGGGAGGGGAAGGGG - Intronic
1122448113 14:101782824-101782846 GAGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448231 14:101783151-101783173 GGGGAGAGAGGGAGGGGGAGGGG - Intronic
1122464047 14:101918452-101918474 GAGGAGCGAGGGGGATGAAGGGG - Intronic
1122464077 14:101918519-101918541 GAGGAGCGAGGGGGATGAGGGGG - Intronic
1122464108 14:101918587-101918609 GAGGAGTGAGGGGGATGAGGGGG - Intronic
1122569593 14:102686587-102686609 AGGCAGAGAGGGAGATGAACAGG - Intronic
1122811655 14:104292264-104292286 GGGGAGGGAGGGGGCTGCAGTGG + Intergenic
1122935413 14:104953779-104953801 GGGGGATGAAGGAGATGGAGAGG - Exonic
1123046842 14:105521632-105521654 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1202902855 14_GL000194v1_random:53239-53261 GAGGAGTTGGGGAGATGCAGAGG + Intergenic
1124436353 15:29652365-29652387 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1124707976 15:31981305-31981327 GGAGAGGGAGGGAAAGGAAGAGG + Intergenic
1124866673 15:33499172-33499194 GGGGAGGGAGAGAGAGGGAGGGG - Intronic
1124866680 15:33499191-33499213 GGAGAGGCAGGGAGAGGAAGGGG - Intronic
1124900338 15:33816829-33816851 GGGGTGAGAGGGAGGTCAAGAGG - Intronic
1125087874 15:35752338-35752360 AGGGAGGGAGGGAGAAGGAGAGG - Intergenic
1125396543 15:39254967-39254989 GGCGAGTTAGGGAGGAGAAGGGG - Intergenic
1125677296 15:41509263-41509285 TGGGAGTGAAGGAGGTGAGGAGG + Intronic
1125764981 15:42128753-42128775 GGGGAGAGAGGGAGAGAGAGAGG + Intergenic
1125868316 15:43075970-43075992 GTGGAGAGAGGGAGAGGGAGAGG - Intronic
1125878194 15:43168140-43168162 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1126295198 15:47131743-47131765 GGAGAGAGAGGGAGACGGAGAGG - Intergenic
1126324407 15:47461009-47461031 GCAGAGTGAGAGAGAGGAAGTGG - Intronic
1126414668 15:48405318-48405340 ACGAAGGGAGGGAGATGAAGAGG + Intergenic
1126563933 15:50075261-50075283 GGAAAATGAGGGAGATGAAGAGG + Intronic
1126752089 15:51886655-51886677 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
1126752104 15:51886710-51886732 GTGGAGAGAGGGAGAGGGAGAGG + Intronic
1127068024 15:55260772-55260794 GGGAAGTGAAAGAGATGAATAGG + Intronic
1127306178 15:57707347-57707369 GGGAAGAGTGGGATATGAAGAGG + Intronic
1127495692 15:59509835-59509857 AGGGAGTGAGGGTGAAGCAGTGG + Intronic
1127574647 15:60279065-60279087 GGGCTGTCAGGGAGATGAATGGG + Intergenic
1127638568 15:60893953-60893975 GGGCTGTGAAGAAGATGAAGGGG - Intronic
1127644503 15:60946237-60946259 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1127866826 15:63040344-63040366 AGGGAGTCTGGGAGAGGAAGAGG + Intergenic
1127986546 15:64076835-64076857 TGGGAGTGTGGGAGCTGAGGTGG - Intronic
1127988110 15:64090764-64090786 GGGAAGGGAGGGACATGAAAAGG + Intronic
1128806466 15:70534557-70534579 GAGCAGGGAGGGAGAGGAAGTGG + Intergenic
1128826039 15:70718254-70718276 GGGGAGGGAGGGGGAGGAGGGGG + Intronic
1128836214 15:70811098-70811120 GGGGGCAGAGGAAGATGAAGTGG - Intergenic
1129020536 15:72513770-72513792 GGGGAGGGAGGGAGAGGGGGAGG - Intronic
1129177076 15:73847940-73847962 GGGGACTGGGGGAGAGGCAGAGG + Intergenic
1129236197 15:74225171-74225193 GGGGGGAGATGGAGAGGAAGGGG + Intergenic
1129250176 15:74304400-74304422 GGGGAAGGAGGGAGGAGAAGTGG - Intronic
1129313599 15:74728263-74728285 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1129678708 15:77646045-77646067 GGGGAGTGGGCGAGATAAAAGGG + Intronic
1129703758 15:77782955-77782977 GGGGAGTGAGGGAGAGAGCGGGG - Intronic
1129768391 15:78185019-78185041 GGAGAGAGAGGGAGAGAAAGGGG + Intronic
1129910019 15:79219463-79219485 GGAGAGGGAGGGAGAGGAACCGG - Intergenic
1129952546 15:79604858-79604880 GGGCAGTGAGGGAGAGGATCTGG + Intergenic
1130127378 15:81105180-81105202 GGGGAGTGAGGGAGGAAAAAAGG - Intronic
1130227771 15:82072892-82072914 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1130720377 15:86380561-86380583 AGGGAGTGAGGGAGGGGAAAGGG - Intronic
1130998495 15:88919239-88919261 GGGGAGGCATGGAGAGGAAGGGG + Intergenic
1131075924 15:89494915-89494937 CGGGAGGGAGGGAGAAGAACAGG + Intronic
1131170620 15:90175407-90175429 GGGGAGTGAGGGGGAGGGGGTGG + Intronic
1131529376 15:93179003-93179025 GGGGAAGGAGGGAGTTGAGGGGG + Intergenic
1131633414 15:94203983-94204005 GGGAAGAGGGAGAGATGAAGAGG + Intergenic
1131641494 15:94298785-94298807 GGGGAGAGAGGGAGAAAGAGAGG - Intronic
1131641558 15:94298976-94298998 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
1132160071 15:99532669-99532691 GTGGAGTGGGGGAAATGAGGAGG + Intergenic
1132385298 15:101396220-101396242 GGGGAGTGGGGAAGTTGCAGAGG - Intronic
1132629987 16:912651-912673 GGGGCGTGAGCGAGGTGGAGGGG - Intronic
1132664590 16:1075847-1075869 AGGGAGGGAGGGAGAGGGAGAGG - Intergenic
1132839833 16:1973629-1973651 GAGGAGTCAGGGAGGGGAAGAGG + Intronic
1133064674 16:3197672-3197694 GGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1133164708 16:3938491-3938513 AGGCAGTGAGGGAGGTGGAGAGG - Intergenic
1133368283 16:5228434-5228456 TGGGAGTGAGAGGGATGGAGGGG + Intergenic
1133392373 16:5420862-5420884 GGGGAGGGAGGGAGAGGAGGAGG - Intergenic
1133474878 16:6111109-6111131 GGCGAGAGAGGGAGATCATGAGG + Intronic
1133499744 16:6354575-6354597 GGGGAATGAGCCAGAGGAAGAGG - Intronic
1133703543 16:8331965-8331987 GTGCAGTGAGGGAGGTGAAGGGG - Intergenic
1133883744 16:9807192-9807214 AGAGAGAGAGGGAGATGGAGAGG + Intronic
1133981578 16:10636543-10636565 AGGGAGTGAGGGAGAAGAAGAGG + Intronic
1134316814 16:13126556-13126578 AGGGAGAGAGGGAGAGAAAGGGG + Intronic
1134316938 16:13127311-13127333 AGGGAGGGAGAGAGATGAAGGGG + Intronic
1134565437 16:15247813-15247835 GGGCAGGGAGGAGGATGAAGAGG - Intergenic
1134670063 16:16048093-16048115 GGTGAGTGTGGCAGCTGAAGAGG - Intronic
1134737059 16:16508885-16508907 GGGCAGGGAGGAGGATGAAGAGG + Intergenic
1134751397 16:16628215-16628237 GGGAGGAGAGGGAGATGGAGGGG - Intergenic
1134846968 16:17448567-17448589 GAGGAAGGAGGGAGAGGAAGAGG + Intronic
1134930461 16:18203279-18203301 GGGCAGGGAGGAGGATGAAGAGG - Intergenic
1134994064 16:18725388-18725410 GGGAGGAGAGGGAGATGGAGGGG + Intergenic
1135142699 16:19935364-19935386 AGGAAGTGAGGGAGATGATTCGG + Intergenic
1135166382 16:20142827-20142849 AGGGAGCGAGGGAGGTGGAGAGG + Intergenic
1135252124 16:20909346-20909368 TGGGGGTTAGGGAGATGAAAAGG + Intronic
1135293886 16:21262988-21263010 TGGGAATGATGGAGATCAAGAGG - Intronic
1135562617 16:23488194-23488216 GGGGAGTGTGGGTGATGGATGGG - Intronic
1135847696 16:25933779-25933801 GGGGAGTGAGGGAGAGAAGGAGG + Intronic
1135927693 16:26709840-26709862 GGGGAGGGAGGGAGGGGGAGGGG + Intergenic
1136083726 16:27869562-27869584 AGGGAGTGAGGGAGACAGAGAGG - Intronic
1136115817 16:28093616-28093638 GAGGGGTGAGGGAGAAGGAGGGG + Intergenic
1136228463 16:28873757-28873779 AGGGGGTGATGGAGAGGAAGGGG + Exonic
1136285566 16:29238452-29238474 AGGGAGGGAGGGAGGAGAAGTGG + Intergenic
1136369959 16:29830241-29830263 TGGGAGTGAGGGAAAGGAATTGG + Intronic
1136631906 16:31493796-31493818 AGAGAGTGAGGTAGCTGAAGTGG + Intronic
1136652043 16:31681330-31681352 AGAGTGTGAGGGAGAAGAAGAGG + Intergenic
1136746676 16:32597198-32597220 GGGGAGCAATGGGGATGAAGTGG - Intergenic
1137439214 16:48483835-48483857 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1137614298 16:49837725-49837747 GGGGAAGGAGGGAGAAGAAGAGG - Intronic
1137801193 16:51263710-51263732 GGGGAGTGGTTGAGATGGAGAGG + Intergenic
1138136226 16:54525326-54525348 GGGAAGTGAGGCAGCTGATGAGG + Intergenic
1138311241 16:56025545-56025567 GGGGAGTGTGGTGGATGAATGGG - Intergenic
1138340697 16:56287178-56287200 GGGAAGAGTGGGAGGTGAAGAGG + Intronic
1138401387 16:56747617-56747639 GGGGAGAGAGGGAGAGTTAGTGG + Intronic
1138418917 16:56886767-56886789 GGGGAGGAAGGGAGAGGGAGGGG - Intronic
1138538629 16:57674313-57674335 TGGGGGTGAGGGAAATGAAGGGG + Intronic
1138752514 16:59440793-59440815 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1139126930 16:64089359-64089381 GGGGAGAGAGAGAGAGGGAGAGG + Intergenic
1139260750 16:65591066-65591088 TGGGAGTGATGGAGAAGGAGAGG + Intergenic
1139341384 16:66270149-66270171 AGGGAGGGAGGGAGAAGCAGAGG + Intergenic
1139345344 16:66299533-66299555 AGGGAGGAAGGGAGAGGAAGTGG + Intergenic
1139582723 16:67882928-67882950 GGGAAGTGAGTGAGGTGAAGTGG - Intronic
1139625773 16:68187467-68187489 GGAGGGTGAGCGGGATGAAGAGG + Intronic
1139998871 16:71006972-71006994 AGGGAGAGAGGGAGAGAAAGGGG - Intronic
1140094731 16:71865025-71865047 TGACAGTGAGGGTGATGAAGAGG - Exonic
1140205277 16:72928119-72928141 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205286 16:72928138-72928160 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205295 16:72928157-72928179 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140205304 16:72928176-72928198 GGGGAGAGAGGGAGGGGGAGGGG + Intronic
1140724416 16:77799234-77799256 GGGGAGGGAGGGAGAGAGAGAGG - Intronic
1140877485 16:79166241-79166263 TGGGAGTGAGGGGAATGAGGTGG - Intronic
1140914694 16:79483150-79483172 GGGGATGGAGGGAGTGGAAGGGG - Intergenic
1141038483 16:80650975-80650997 GGGGGGCGGGGGAGATGAAGTGG + Intronic
1141114989 16:81300799-81300821 GGGGAGTGTGTGTGATGGAGGGG - Intergenic
1141149307 16:81553041-81553063 GAGGAGTTAGGGAGGTGAGGTGG + Intronic
1141173421 16:81704674-81704696 GGGCAGGGAGGAGGATGAAGGGG - Intronic
1141431703 16:83973517-83973539 AGGGACGTAGGGAGATGAAGTGG + Intronic
1141456141 16:84144053-84144075 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1141728914 16:85809015-85809037 GGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1141792915 16:86248893-86248915 GGGGGCTGATGCAGATGAAGAGG + Intergenic
1141942546 16:87287066-87287088 GGGAAGGGAAGGAGATGGAGGGG + Intronic
1141952016 16:87345341-87345363 TGGGAGGGAGGGAGGGGAAGAGG + Intronic
1142011642 16:87718376-87718398 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1142090899 16:88208606-88208628 AGGGAGGGAGGGAGGAGAAGTGG + Intergenic
1142251436 16:88993750-88993772 GGAGAGGGAGGGAGAGGAGGGGG - Intergenic
1142332147 16:89462049-89462071 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
1142354674 16:89596856-89596878 GTGGAGGGAGGGAGATCATGAGG + Exonic
1203048805 16_KI270728v1_random:856402-856424 GGGGAGCAATGGGGATGAAGTGG - Intergenic
1142581522 17:946023-946045 GGGTAGAGAGGGAGAAGGAGAGG + Intronic
1142858284 17:2745572-2745594 GGGGAGGGTGGGAGATAGAGTGG + Intergenic
1143109419 17:4545004-4545026 GGTGAGTGGGGGAGGTGGAGGGG - Exonic
1143524236 17:7463058-7463080 GGAGAGTGAGGAGGACGAAGAGG - Exonic
1143583197 17:7838296-7838318 GGGGAGGGAGGGAGGGGAGGAGG + Intergenic
1144061335 17:11585265-11585287 AGGGAGAGAGAGAGATGTAGGGG + Intergenic
1144182097 17:12761983-12762005 GGGGAGTGTGGAAGATTCAGGGG + Intronic
1144559968 17:16312932-16312954 GGGGGGAGAGGGAGAGGGAGAGG + Intronic
1144641427 17:16939503-16939525 GAGGAGGGAGAGAGATGGAGAGG - Exonic
1144647825 17:16987450-16987472 AGGGAGGGAGGGAGGTGGAGAGG + Intergenic
1144695537 17:17301667-17301689 GGAGAGTGAGCAAGACGAAGAGG - Intergenic
1144714553 17:17424873-17424895 GGAGAGTGAGCAAGGTGAAGAGG - Intergenic
1145278993 17:21454973-21454995 GGGGAGGGAGGGAGAAGGAGAGG - Intergenic
1145298211 17:21611769-21611791 GGGGAAAGAGGGAGGTGAATAGG - Intergenic
1145722703 17:27088553-27088575 GGGGAAAGAGGGTGATGAGGAGG - Intergenic
1145800174 17:27677453-27677475 TGGCAGGGAGGGAGATGAGGAGG + Intergenic
1146008897 17:29179252-29179274 GGGGGGTGGGGGAGATGGGGAGG - Intronic
1146377610 17:32305156-32305178 AGGGAGGGAGGGAGAGGGAGGGG + Intronic
1146490106 17:33274976-33274998 GGGGAGTGGGAGAAATGAGGAGG - Intronic
1146590898 17:34127268-34127290 AGGGAGGCAGGGAGATGCAGAGG - Intronic
1146901780 17:36593349-36593371 GGGGAGGTAGGGAGATCAGGTGG + Intronic
1147160259 17:38565599-38565621 GGGGAGAGAGGGAGCTGAAGAGG - Intronic
1147305824 17:39563776-39563798 GGAGAGTGAGAGTGAGGAAGGGG + Intronic
1147673545 17:42190393-42190415 GGGGAGTGGGGTAAATGGAGAGG + Intronic
1147894571 17:43742123-43742145 GGGGAGCAAGGGAGATAATGGGG + Intergenic
1147966340 17:44196235-44196257 GGGGAGTGTGGGTGGGGAAGGGG - Intronic
1147977679 17:44257415-44257437 GGGTATAGCGGGAGATGAAGCGG + Exonic
1148145622 17:45362780-45362802 GGGGAGGGAAGGAGAGCAAGGGG + Intergenic
1148169738 17:45508927-45508949 TGGGGGGGTGGGAGATGAAGTGG + Intergenic
1148206708 17:45784186-45784208 GGAGAGGGAGGGGGAGGAAGGGG + Intergenic
1148351034 17:46942479-46942501 GAGAAGTGTGGGAGATTAAGTGG - Intronic
1148386237 17:47237126-47237148 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1148406280 17:47419927-47419949 GGAGAGGGAGGGAGAGGGAGAGG - Intronic
1148466070 17:47866069-47866091 GAGAAGTGAGGGAGAGGAGGAGG - Intergenic
1148666321 17:49377689-49377711 GGGGAGGGAGGGGGAGGAAAGGG - Intronic
1148735800 17:49864269-49864291 GTGGGGTCAGGGAGAAGAAGGGG + Intergenic
1148765135 17:50034532-50034554 TGGGGGTGATGGAGAAGAAGGGG - Intergenic
1148850754 17:50553925-50553947 GGAGGGAGAGGGAGAGGAAGGGG + Intronic
1148860954 17:50604125-50604147 GGGGAGGGAGGGAGGTGATAAGG - Intronic
1148865009 17:50623870-50623892 GGGGAGGGAGGTGGAGGAAGAGG - Intronic
1149469669 17:56905833-56905855 GGAGAGTGGGGGTGGTGAAGGGG + Intronic
1149884724 17:60328497-60328519 GGAGGGTGAGGAAGATGAAGAGG - Intronic
1150213735 17:63455809-63455831 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1150222003 17:63501022-63501044 GGGGAGAGAGGAAGAGGGAGAGG - Intronic
1150446041 17:65227598-65227620 GGGGAGGGAGGGTCAGGAAGAGG - Exonic
1150508590 17:65724962-65724984 GGGCAGGAAGGGAGAAGAAGAGG - Intronic
1150521099 17:65866864-65866886 GGAGGGTGAGCAAGATGAAGAGG - Intronic
1150580900 17:66473073-66473095 GGGGAGTGGGGGAGTGGAGGAGG - Intronic
1150747835 17:67830626-67830648 AGGGAGGGAGGGAGAGGGAGCGG + Intronic
1150780443 17:68116969-68116991 GGAGAGGGAGGGAGAGGGAGAGG + Intergenic
1151000173 17:70366743-70366765 GGGGAGGAAAGGAAATGAAGGGG - Intergenic
1151187587 17:72375237-72375259 GGGAGGGGTGGGAGATGAAGTGG - Intergenic
1151215081 17:72571707-72571729 GGGGAGGGAGGATGATGGAGGGG - Intergenic
1151290703 17:73147936-73147958 GGGGAGAGAGAGAGATGGGGGGG - Intergenic
1151449218 17:74187466-74187488 CTGGAGGCAGGGAGATGAAGAGG + Intergenic
1151606778 17:75142588-75142610 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1151607561 17:75148763-75148785 TAGGGGTGAGGGAGATGAATGGG - Intronic
1151871648 17:76840820-76840842 AGGGAGTCAGGGAGAGAAAGAGG - Intergenic
1152211185 17:79004115-79004137 GGGGAGTTAGGGAGAGGAGTTGG + Intronic
1152259238 17:79257994-79258016 GGGGAGAGAAGGGGATAAAGGGG - Intronic
1152315059 17:79575327-79575349 GCAGAGTGAGGGAGACAAAGGGG + Intergenic
1152315414 17:79577765-79577787 GGGGAGGGAGAGAGGTGGAGGGG + Intergenic
1152473041 17:80500790-80500812 GGGGAGGGAGGGAGATGGACAGG - Intergenic
1152555670 17:81052088-81052110 GGGGAGGCAGGAAGAGGAAGAGG - Intronic
1152598800 17:81251220-81251242 GGGGAGCAAGGGAGATAAAACGG + Intronic
1152697315 17:81803736-81803758 GCGGAGGGAGCGAGAGGAAGGGG + Intergenic
1153279493 18:3401011-3401033 TAGAAGTGAGGGAGATGAAAAGG + Intergenic
1153400964 18:4683211-4683233 GGGGACAGAGAGAGATGGAGGGG + Intergenic
1153628456 18:7044316-7044338 TGCGAAGGAGGGAGATGAAGTGG + Intronic
1153969740 18:10215417-10215439 GGGGAAGGAGGGAGAGGAAAGGG + Intergenic
1154207032 18:12346262-12346284 TGGGAGAGAGGGAGTTGCAGAGG - Intronic
1154440375 18:14383524-14383546 GTGGGGAGAGGGAGAGGAAGAGG + Intergenic
1154957847 18:21276787-21276809 GAAGAGAGAGGGAGATGAGGTGG + Intronic
1154991113 18:21599703-21599725 GGGGAGGGAGGAAGAGGAGGAGG - Intronic
1155066218 18:22271238-22271260 GGGGAATGAGGGGGAAGAGGAGG + Intergenic
1155355091 18:24944188-24944210 GGGGGTTGAGGGAGGTGGAGAGG + Intergenic
1155602796 18:27568857-27568879 TGGGAGTGGGGGTGATGATGGGG + Intergenic
1155853580 18:30803241-30803263 GAGGAGTGAGGGAGAGAAAGAGG + Intergenic
1156058772 18:33046754-33046776 GGGGAGCGAGTCAGATGAATAGG + Intronic
1156066497 18:33148413-33148435 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
1156159613 18:34343633-34343655 GGGGATTGAGAGAGATGGTGAGG - Intergenic
1156483912 18:37452889-37452911 GGGGTGTGAGGGTTAAGAAGGGG - Intronic
1156489496 18:37487751-37487773 GGGGAGGGAGGAAGAGGAGGAGG + Intronic
1156894555 18:42230495-42230517 GGGGTGTGAGTTAGTTGAAGTGG + Intergenic
1157162217 18:45324537-45324559 GTGGGGTGAGGGGGAGGAAGGGG - Intronic
1157177311 18:45463407-45463429 GAGGATTAAGGGAGATGATGAGG + Intronic
1157334967 18:46731472-46731494 GGGGCGAGAGGGAGGTGAAGGGG - Intronic
1157392516 18:47314683-47314705 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1157407351 18:47433300-47433322 TGGAAGTGAGCAAGATGAAGAGG - Intergenic
1157442240 18:47719843-47719865 GGGGAGTGGGAGAGTTGGAGTGG - Intergenic
1157470132 18:47982541-47982563 AGGGAGGGAGGGAGAGGGAGGGG + Intergenic
1157551229 18:48583055-48583077 GGGGAGGGAGGAGGATGATGGGG + Intronic
1157570199 18:48707105-48707127 GGGGAGTGCAGGAGGTGGAGGGG + Intronic
1157674868 18:49561564-49561586 GGGAAGGGAGGGAGAAGAGGAGG + Intronic
1158148373 18:54342452-54342474 GGAGAGGGAGGGAGAGGGAGAGG - Intronic
1158413548 18:57229851-57229873 GGGGAGTGGGGGAGCTGGAGAGG + Intergenic
1158459515 18:57633876-57633898 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1158801940 18:60922140-60922162 GGGGGCTGAGGGAGACCAAGAGG - Intergenic
1158844237 18:61425005-61425027 GGAGAGAGAGGGAGAGGAACTGG - Intronic
1158848587 18:61470874-61470896 AGGGAGGGAGGGAGAGAAAGAGG - Intronic
1158898745 18:61940997-61941019 GGTGAGAGAGAGAGAGGAAGGGG + Intergenic
1159011326 18:63061625-63061647 GAGAAGTGCGGGAGATGAGGAGG - Intergenic
1159340621 18:67127671-67127693 GGAGAGAGAGGGAGATGGAGAGG + Intergenic
1159509769 18:69380946-69380968 GGGGGATGAAGGGGATGAAGAGG + Intergenic
1159532645 18:69674486-69674508 GAGGAGTGAGGGAGATGCCTGGG - Intronic
1159918258 18:74204686-74204708 GGTGAGGGTGGGAGAAGAAGGGG + Intergenic
1159918301 18:74204794-74204816 GGTGAGGGTGGGAGAAGAAGGGG + Intergenic
1159918310 18:74204821-74204843 GGTGAGTGTGGGAGAAGGAGGGG + Intergenic
1159918319 18:74204848-74204870 GGTGAGTGTGGGAGAAGGAGGGG + Intergenic
1160129586 18:76212886-76212908 GAGGAGAGAGGGAGAGAAAGAGG - Intergenic
1160158251 18:76450334-76450356 GGGGAGTGGGGGAGGGGGAGGGG - Intronic
1160175670 18:76592246-76592268 GGGGGATGAGGGGGATGAGGGGG - Intergenic
1160179255 18:76620038-76620060 GGGCGGGGAGGGAGAGGAAGAGG + Intergenic
1160394910 18:78564055-78564077 GGGGGGTGTGGGAGGTGAGGGGG - Intergenic
1160409554 18:78666670-78666692 GGGGTGTGCAGGAGAGGAAGGGG + Intergenic
1160665870 19:327896-327918 GGAGAGTGAGGGTGGTGACGTGG - Exonic
1161241308 19:3225214-3225236 GGGGAGGGAGGGAGAGGGGGCGG - Intronic
1161243059 19:3233676-3233698 GGGGAGAGAGGGAGGAGAAGAGG + Intronic
1161488300 19:4547793-4547815 GGGGAGTGAGGGAGGAGGGGAGG - Intronic
1161497984 19:4597914-4597936 GAGGGGTGAGGGAGGAGAAGGGG + Intergenic
1161613051 19:5254299-5254321 GGTGAGTGAGGGACAAGAGGGGG + Intronic
1161634225 19:5377191-5377213 GGGGAGAGAGGGAGAAGGGGAGG + Intergenic
1161756590 19:6138494-6138516 GGGGAGGGAGGGAGGGAAAGAGG + Intronic
1161790037 19:6354791-6354813 GGGGGGAGAGGGAGAGGGAGAGG - Intergenic
1161812765 19:6479950-6479972 TGGGAGTGAGGGAGTGGGAGGGG - Intronic
1161943219 19:7418786-7418808 GGGGAGAGAGGGAGGAGAGGAGG + Intronic
1161994221 19:7702600-7702622 GGAGAGAGAGGCAGAGGAAGGGG + Intergenic
1162136990 19:8561538-8561560 GGGGAGGGAGGGAAAGAAAGAGG - Intronic
1162270212 19:9608222-9608244 GGGGAGGGAGGGGGAGGGAGGGG + Exonic
1162313293 19:9920460-9920482 GAGGAGTGATGGAGAAGGAGGGG - Intronic
1162452575 19:10763860-10763882 GGGGAGTGGGGGATAGGGAGTGG + Intronic
1162502075 19:11059836-11059858 GGAGAGTGAGGAGGAGGAAGAGG + Exonic
1162581081 19:11530751-11530773 GGGGAGTGGGTAAGATGATGGGG + Intergenic
1163004517 19:14389168-14389190 AGGGAGAGGGGGAGAGGAAGGGG + Intronic
1163105163 19:15119132-15119154 GGGGAAGGAGGGAAAGGAAGAGG + Intronic
1163545215 19:17937325-17937347 GGGGAGGGAGGCAGAGGAAATGG + Intronic
1163667257 19:18609115-18609137 GCGGAATGAGGGAGAGGAGGGGG - Intronic
1163712030 19:18852650-18852672 GGGGAGGGAGGGACAGAAAGAGG - Intronic
1163712038 19:18852674-18852696 GGGGAGGGAGGGACAGAAAGAGG - Intronic
1163779682 19:19239818-19239840 GGGAAGAGTGGGAGATGAATGGG - Intronic
1163797037 19:19343702-19343724 GGGGACTAGGGGAGATGACGGGG + Intronic
1164054872 19:21614298-21614320 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1164526277 19:29015828-29015850 GGAGAGAGAGGGAGAAGGAGGGG - Intergenic
1164526296 19:29015911-29015933 AGAGAGAGAGGGAGATAAAGAGG - Intergenic
1164680418 19:30130796-30130818 AGGGAGGGAGGGAGAAGGAGAGG - Intergenic
1164889863 19:31814197-31814219 GGTGAGAGAGAGAGAGGAAGGGG - Intergenic
1165149706 19:33753579-33753601 GGGGATGGTGGGAGATGGAGGGG - Intronic
1165256680 19:34580514-34580536 GGGGGGTGTGGGAGAGGATGGGG - Intergenic
1165349659 19:35269028-35269050 GGGGAGGGAGGGAGGGGAGGGGG - Intronic
1165416045 19:35694128-35694150 GAGGAGGGAGGAAGAGGAAGAGG - Intergenic
1165444565 19:35849703-35849725 GGGGAGTCAGGGAGAAGAGGTGG + Intronic
1165463547 19:35958856-35958878 AGGGAGAGAGGGAGAGAAAGTGG + Intergenic
1165513272 19:36277245-36277267 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1165796576 19:38523448-38523470 GGGGAGGAAGGGAGAGGGAGAGG - Intronic
1166123751 19:40701418-40701440 GGAGAGTGAGGGAGAACAGGAGG + Intronic
1166142973 19:40815329-40815351 GGGGAGAGAGGGAGAAGAGAGGG - Intronic
1166168669 19:41010787-41010809 GAAGAGTGAGGGAGCAGAAGGGG - Intronic
1166347877 19:42177435-42177457 GGGGAGAGAGGGAGAGGGAGAGG + Intronic
1166350313 19:42194968-42194990 GGGGAGGGAGGGAGAAAGAGAGG + Intronic
1166507482 19:43380184-43380206 GGGGAGGGATGGAAAGGAAGGGG + Intergenic
1166507507 19:43380273-43380295 AGGGTGGGAGGGAGCTGAAGAGG + Intergenic
1166555217 19:43695025-43695047 GGGGACAGAGGAAGATGAACTGG - Intergenic
1166580674 19:43895838-43895860 AGGGAGGGAGGGAGAGGGAGAGG + Intronic
1166611498 19:44203265-44203287 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1166674923 19:44734586-44734608 GAGGAGGGAGGAAGAGGAAGAGG - Intergenic
1166746595 19:45144821-45144843 GGGGTGTGAGGGTGAGGAGGAGG - Intronic
1166750701 19:45162797-45162819 GGGGAGGGAGGGAGTGGAGGGGG + Intronic
1166790469 19:45395986-45396008 TGGGAGTGAGGGAGAAGAAAGGG + Intronic
1166808017 19:45498544-45498566 GGGGAGGGAGGAAGAGGAGGAGG + Exonic
1166908402 19:46132625-46132647 GGAGAGAGAAGGAGAGGAAGAGG + Intergenic
1167112810 19:47471926-47471948 GGGGATAGAGGGAGGAGAAGAGG + Exonic
1167163171 19:47780671-47780693 GGGGAGAGAGGGAGAAGTGGGGG - Intronic
1167235122 19:48309558-48309580 GGAGCGTGAGCAAGATGAAGAGG - Intronic
1167240819 19:48342153-48342175 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1167258927 19:48446735-48446757 GGGCAGTGATGAAGAAGAAGAGG + Exonic
1167276156 19:48541142-48541164 GGGGAGTGAGGTGGAAGAATCGG - Intergenic
1167473604 19:49688309-49688331 CGGGAGGGAGGGAGAGGAAGGGG - Exonic
1167566679 19:50261409-50261431 GGGGAGTGGGGGTGGTGAGGAGG - Intronic
1167574099 19:50309553-50309575 GAGGAGAGAGAGAGATGAGGGGG - Intronic
1167667893 19:50833308-50833330 GGGGAGGGAGGGGGATGGAGTGG - Intronic
1167789748 19:51666792-51666814 AGGGAGGGAGGGAGACGATGTGG + Intergenic
1167798163 19:51724219-51724241 GAGGAGGGAGGGAGAGGAGGGGG - Intergenic
1167851656 19:52206854-52206876 GGGGAGTGGGGCAGAGGCAGAGG - Intronic
1167952208 19:53036920-53036942 AGAGAGTGAGGGAGAGGAGGAGG - Intergenic
1167971771 19:53192392-53192414 GGAGAGTTAGGGAGAGGAGGGGG - Intronic
1168274797 19:55271682-55271704 TGGGGGTGAGGGAGAGAAAGAGG + Intronic
1168433175 19:56297361-56297383 AGGGAGGGAGGAAGAGGAAGAGG - Intronic
1168433187 19:56297406-56297428 AGGGAGGGAGGAAGAGGAAGAGG - Intronic
1168541871 19:57219489-57219511 GTGGAGTGAGGGAAATGAGAAGG - Exonic
1168720493 19:58552059-58552081 GGGTGATGAGGAAGATGAAGAGG - Exonic
925238037 2:2296612-2296634 GGGGAGTGAGAGTGAGAAAGGGG + Intronic
925418469 2:3690420-3690442 GGGGAGGGGGGGAGGGGAAGGGG - Intronic
925463921 2:4089342-4089364 CTGGAGAGAGGGGGATGAAGAGG + Intergenic
925871445 2:8274982-8275004 GGAGAGGGAGAGAGATGAGGTGG + Intergenic
926017778 2:9469640-9469662 GGGAGGTGAGGGAGAGGGAGGGG - Intronic
926049893 2:9737817-9737839 GGGGACTGGGGGAGTGGAAGTGG - Intergenic
926070455 2:9884472-9884494 GGAGGGTGAGCGAGATGAAGAGG + Intronic
926317777 2:11724220-11724242 GAGGAGAGAAAGAGATGAAGAGG - Intronic
926380246 2:12279709-12279731 GGGGAATGAAGGGGATGAAAAGG + Intergenic
926415366 2:12644204-12644226 GGGAAGTAAGGCAGAAGAAGAGG + Intergenic
926743391 2:16130549-16130571 AGGCAGTGAGGGAGAAGAAGAGG + Intergenic
926850045 2:17186237-17186259 AGGGTGGGAGGGAGATGAAGAGG + Intergenic
926871114 2:17418295-17418317 GGGGAGGGAGAGATAGGAAGAGG + Intergenic
926873022 2:17444254-17444276 GGGGAAGGAGGGAAAAGAAGTGG + Intergenic
927038414 2:19204188-19204210 AGGGGGTGAGGGAGAGGAGGAGG - Intergenic
927063698 2:19448181-19448203 GGGATGTGAGGAAGATGAAGAGG + Intergenic
927094228 2:19735506-19735528 GAGGATTGGGGGAGAGGAAGGGG - Intergenic
927232195 2:20834704-20834726 AGGGAGGGAGGGAGATAAGGAGG - Intergenic
927476217 2:23416336-23416358 GAGGAGGGAGGGAGACAAAGAGG - Intronic
927873642 2:26640114-26640136 AGGGAGGGAGGGAGGTGGAGAGG + Intronic
928022551 2:27715850-27715872 GGGGAGGGAAAGAGAGGAAGAGG - Intergenic
929067988 2:37999634-37999656 GGGAAGTGGAGGAGATGAAAGGG + Intronic
929171138 2:38934503-38934525 GGGGAGGGAGGGAGAGAAGGGGG - Intronic
929171146 2:38934522-38934544 GGGGAGGGAGGGAGAGAAGGGGG - Intronic
929192280 2:39150539-39150561 GGAGAGAGAGGAGGATGAAGAGG + Intergenic
929431738 2:41893196-41893218 GGGGAGGGAGGAAGGGGAAGGGG - Intergenic
929492516 2:42408657-42408679 GGAGGGTGAGCAAGATGAAGAGG - Intronic
929561915 2:42961446-42961468 GGGGAGAGAGGGAGGGGACGGGG - Intergenic
929738570 2:44577652-44577674 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
929739353 2:44587469-44587491 GGAGAGAGAGGGAGACGGAGAGG - Intronic
929747299 2:44672084-44672106 GGGGAGTGAGGCGGATGGGGAGG - Intronic
929782191 2:44964393-44964415 GGGAAAAGAGGAAGATGAAGAGG - Intergenic
929794630 2:45049567-45049589 GGGGAGAGGGGGAAAGGAAGAGG + Intergenic
930136271 2:47906230-47906252 GGGGTGTGGGGGGGAGGAAGAGG - Intergenic
930270564 2:49251552-49251574 AGGGAGGGAGGGAGGGGAAGAGG - Intergenic
930612075 2:53554648-53554670 GGAGGGTGAGCAAGATGAAGAGG - Intronic
931636790 2:64348057-64348079 AGGAAGTGAGGAAGATAAAGAGG + Intergenic
932054668 2:68432249-68432271 GGAGGGTGAGCGAGATGAAGAGG + Intergenic
932564612 2:72898036-72898058 GGGGAGAGGGAGAGATGAAGAGG - Intergenic
932628512 2:73318433-73318455 GAGAAGTGAGGGAGGTGAGGAGG - Intergenic
932660857 2:73650731-73650753 GGGGAGAGAGGGAAATAAGGGGG - Intergenic
932668129 2:73713730-73713752 GGGGAGAGAGGGAAATAAGGGGG - Intergenic
932876139 2:75454638-75454660 AAGGAGGGAGGGAGATGAAAAGG - Intergenic
932993126 2:76812777-76812799 GGGGGGGGAGGGAGAGGAGGAGG - Intronic
933316906 2:80726741-80726763 GGGGGGTGGGGGGGATGTAGGGG - Intergenic
933624643 2:84585412-84585434 GGAGGGTGAGCAAGATGAAGAGG + Intronic
933665464 2:84961052-84961074 GGTGAGGGTGGGAGATGGAGGGG - Intergenic
933796015 2:85920291-85920313 GGGGAATGGTAGAGATGAAGAGG + Intergenic
933901400 2:86852930-86852952 GGGGAGGGAGGGAGGGCAAGGGG + Intronic
933920234 2:87038651-87038673 GGGGGGTGAGGTAGAGGAATGGG + Intergenic
933931390 2:87155135-87155157 GGGGGGTGAGGTAGAGGAATGGG - Intergenic
933940654 2:87242110-87242132 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
934002763 2:87731242-87731264 GGGGGGTGAGGTAGAGGAATGGG - Intergenic
934075284 2:88423151-88423173 GGAGAGTGAGAAAGATGGAGAGG + Intergenic
934474601 2:94586119-94586141 GGTGAGGCAGGGAGAGGAAGGGG - Intergenic
934503804 2:94877155-94877177 GAGGAGTTGGGGAGATGCAGAGG - Intergenic
934653197 2:96104056-96104078 GGGGGGAGAGGAAGAAGAAGGGG - Intergenic
935171493 2:100614033-100614055 AGGGAAAGAGAGAGATGAAGGGG - Intergenic
935255500 2:101306698-101306720 GAAGACTGAGGGAGATGCAGAGG - Intronic
935316771 2:101842631-101842653 TGGGAGTGAGGAAGAAGAGGAGG + Exonic
935779150 2:106496307-106496329 GGGGAGGGAGGGAGGGCAAGGGG - Intergenic
935849114 2:107199470-107199492 GGGGACTGGGGGGGATGAAGTGG - Intergenic
936140460 2:109935616-109935638 GTGGAGTGAGTGAGGGGAAGGGG + Intergenic
936170277 2:110165092-110165114 GGGCAGTGAAGAAGATGTAGAGG - Exonic
936177151 2:110233561-110233583 GTGGAGTGAGTGAGGGGAAGGGG + Intergenic
936204234 2:110435870-110435892 GTGGAGTGAGTGAGGGGAAGGGG - Intronic
936352481 2:111723676-111723698 AGGGAGGGAGGGAGGTGAAGGGG + Intergenic
936361731 2:111810306-111810328 GGGGGGTGAGGTAGAGGAATGGG + Intronic
936523305 2:113226097-113226119 GGGAAGGGAGGGAGAGAAAGAGG - Intronic
936524567 2:113234017-113234039 GGAGGGTGTGGGAGGTGAAGAGG + Intronic
937062074 2:118988212-118988234 GGAGAGTGTGGGAAATGAAGAGG + Intronic
937128472 2:119489310-119489332 GGAGAGAGTGGGAGATGAGGTGG - Intronic
937497916 2:122443907-122443929 GTGGAGGGAGGGAGAAGATGGGG - Intergenic
937602266 2:123752934-123752956 GGGAAGTGGGGGAGATGAAGTGG + Intergenic
937636474 2:124161345-124161367 GTGAGGTGAGGGAGATGATGGGG + Intronic
938120086 2:128626994-128627016 CGGGAGGGAGGGAGAGGAGGAGG + Intergenic
938198006 2:129348754-129348776 GGGGATGGGGGGAGATGAATAGG - Intergenic
938308486 2:130269735-130269757 GGGCAGTGAGGGGGGTGAAAGGG - Intergenic
938743135 2:134251885-134251907 GAGGAGAGAGGGGGATGAGGAGG - Intronic
938849050 2:135241652-135241674 GAGGGGTGAGGAAGATGCAGGGG + Intronic
939179092 2:138783078-138783100 AGGGAGAGAGGGAGAAGAAAAGG + Intergenic
939223864 2:139339894-139339916 GGGGAGAGAGAGAGAGGAGGGGG + Intergenic
939467135 2:142572242-142572264 GGGGAGTGAGGAGAATGAAAAGG - Intergenic
940061505 2:149575370-149575392 GGGAAGATGGGGAGATGAAGGGG + Intronic
940449534 2:153819428-153819450 TGGGAGTGAGGGAGCTGCACTGG - Intergenic
940631578 2:156246430-156246452 AGGGAGTGCTGGAGATGTAGTGG - Intergenic
940672672 2:156689474-156689496 TGGGAGTGGGGCAAATGAAGAGG + Intergenic
941043668 2:160649445-160649467 GGAGGGTAAGGAAGATGAAGAGG - Intergenic
941218828 2:162748870-162748892 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
941317738 2:164015814-164015836 GGTGATTAAGGCAGATGAAGAGG + Intergenic
942918568 2:181343217-181343239 GGGGAGTAATGGGGATGCAGTGG + Intergenic
942991285 2:182206551-182206573 GGGGAGAGAAAGGGATGAAGAGG - Intronic
943005615 2:182385866-182385888 GGAGAGAGAGGGAGACGGAGAGG - Intronic
943100174 2:183478556-183478578 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
943375552 2:187072092-187072114 AGGGAGGGAGGGAGAGGGAGAGG + Intergenic
943577892 2:189652958-189652980 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
943648501 2:190431719-190431741 GGAGAGGGAGGGAGAGGGAGAGG + Intronic
943933947 2:193890502-193890524 GGGTAGAGAAGGATATGAAGAGG + Intergenic
943935487 2:193910080-193910102 GAGGAGTGAGAAAGATGCAGAGG + Intergenic
944142779 2:196475367-196475389 GGGGAGATAGGAAGATGAGGAGG + Intronic
944209067 2:197187679-197187701 AGAGAGAGAGGGAGAAGAAGAGG - Intronic
944479573 2:200143172-200143194 GTGGAGTGAGGGAGAAGAAAGGG - Intergenic
944530128 2:200659462-200659484 CAGGAGTGAGGGAGAAAAAGAGG - Intronic
944797770 2:203206381-203206403 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
945313993 2:208350695-208350717 AGGGAGTGAGGGAGCGGAGGAGG + Intronic
945657182 2:212639050-212639072 AGGAAGAGAGGGAGATAAAGAGG - Intergenic
945925198 2:215796266-215796288 TGGGAGAGAGGGAGAGGGAGTGG - Intergenic
946051452 2:216865946-216865968 GGCGATTGAGGGAGAAGAACAGG + Intergenic
946252860 2:218424065-218424087 GATGAGTGAGGAAGAGGAAGTGG - Intronic
946415776 2:219539026-219539048 GGGGAAGGAGGGAGCTGAGGAGG - Exonic
946428642 2:219613286-219613308 GGGGAGTGAGGGGGAAGATGGGG + Intronic
946471966 2:219968993-219969015 GGGGCGTGTGGGAGGTGAGGGGG - Intergenic
946658000 2:221969799-221969821 GGGGAAGGGGTGAGATGAAGGGG - Intergenic
946716109 2:222556619-222556641 GAGGAGTGAGGGGGATGGGGAGG - Intronic
947159110 2:227193973-227193995 GGGGAGAGAAGGAGAAGGAGAGG + Intronic
947163731 2:227240446-227240468 GGTTAGGGAGGGAGATGAACTGG - Intronic
947315062 2:228848462-228848484 CGGGAGGAAGGGAGATGAAAAGG - Intergenic
947490680 2:230591999-230592021 GGGGAGGGAGAGAGAGGGAGAGG - Intergenic
947593514 2:231397556-231397578 GGGCAGGGTGGGAGAGGAAGCGG + Intronic
947661222 2:231870026-231870048 AGGGAGGGAGGGAGAGGGAGGGG - Intergenic
948026967 2:234786103-234786125 GGGGGGTGGGGGAGAGGGAGAGG - Intergenic
948078688 2:235187849-235187871 GGGGTAAGAGGGAGAGGAAGAGG - Intergenic
948414349 2:237791477-237791499 GGGGGATGAGGGAGAGGAAAGGG - Intronic
948434601 2:237944540-237944562 GGAGAGTGAGAAAGATGGAGAGG - Intergenic
948542166 2:238698886-238698908 GGGCAGTCATGGAGATGAAGGGG - Intergenic
948558547 2:238835207-238835229 GGAGGGGGAGGGAGAAGAAGAGG - Intergenic
948677783 2:239609237-239609259 GGGGAGTGAGTGAGAGGAACAGG + Intergenic
949060347 2:241953232-241953254 GGGGGGAGAGGGAGGGGAAGGGG + Intergenic
949062690 2:241970171-241970193 GGGGTGTGGGGTTGATGAAGGGG + Intergenic
949077948 2:242073313-242073335 GTGGAGGGAGGGACTTGAAGGGG + Intergenic
1168831884 20:849968-849990 GGGGAGCGAGGCTGATGTAGAGG - Intronic
1168834853 20:871308-871330 GGCGAGCCAGGGGGATGAAGGGG + Exonic
1168870179 20:1120792-1120814 GGGGAGTGAGGTACATGAGGAGG - Intronic
1169072828 20:2743620-2743642 GGGGAGGGAGGGAGAGGCAAGGG + Intronic
1169214436 20:3785259-3785281 CAAGAGTGAGGGAGAGGAAGAGG - Exonic
1169370657 20:5026904-5026926 GTGGGGTGAGGGAGAGGGAGAGG - Intergenic
1169400922 20:5279508-5279530 AGGGAGAGAGGGAGATAGAGAGG - Intergenic
1169469523 20:5871824-5871846 GGGGAGGAAGGGGGAAGAAGGGG + Intergenic
1169971710 20:11275707-11275729 GGGGAGGGAGGGAAGAGAAGAGG - Intergenic
1170032687 20:11959284-11959306 GGTGAGAGAGGGAGAGGAGGGGG + Intergenic
1170043797 20:12065076-12065098 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1170080683 20:12471048-12471070 GGGGAGTCATGGAGAAGCAGTGG - Intergenic
1170403760 20:16014655-16014677 GGGGAGCCAGGGACAGGAAGGGG - Intronic
1170533023 20:17313579-17313601 GGGGAATGAGGTTGATGAGGGGG - Intronic
1170628149 20:18045075-18045097 GGGGAGTGAGGTAGTTGATGAGG - Intronic
1170749382 20:19131780-19131802 AGGGAGGGAGGGAGAGCAAGAGG - Intergenic
1170792706 20:19521131-19521153 GGGGAGGGAGGGAGGCAAAGAGG - Intronic
1170813689 20:19695324-19695346 GGCAAGTGAGGGAGATCCAGTGG + Intronic
1170939120 20:20833908-20833930 GGGTAGTGAGGGAGAACAATGGG + Intergenic
1171201007 20:23242201-23242223 GGGGAGGGAGGGTGCTGAAGAGG - Intergenic
1171236861 20:23534562-23534584 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1171250768 20:23645314-23645336 TGGGAGCGAGGGAGATGGAGGGG - Intergenic
1171460080 20:25293138-25293160 GGGGAGTGGGGGGGATGGGGGGG + Intronic
1171562378 20:26136905-26136927 GGGGAAAGAGGGAGGTGAATAGG + Intergenic
1171900063 20:30847952-30847974 GGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1172024379 20:31938071-31938093 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1172024389 20:31938097-31938119 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1172024397 20:31938117-31938139 AGGGAGGGAGGGAGAGGGAGAGG - Intronic
1172140990 20:32723113-32723135 GGAGAGGGAGGGAGAGGGAGAGG - Intronic
1172292159 20:33784193-33784215 GGAGAGGGAGGGAGGTGAGGAGG - Intronic
1172292183 20:33784263-33784285 GGAGGGTGAGGGAGATGGGGGGG - Intronic
1172325257 20:34029499-34029521 AGGGAGGGAGGGAGATGATTTGG + Intronic
1172717955 20:36977760-36977782 GGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1172776949 20:37413463-37413485 GGGGAGGGATGGAGATGGAGAGG - Intergenic
1172876591 20:38168130-38168152 GTGGAATGTGGGAGAGGAAGTGG - Intergenic
1173143225 20:40502955-40502977 GTGGAGAGAGAGAGATAAAGGGG + Intergenic
1173252207 20:41370019-41370041 GGGAAGGGAGTGAGAGGAAGGGG - Intergenic
1173435263 20:43026722-43026744 GGGAAGTGAGGGTGTGGAAGGGG - Intronic
1173893880 20:46534837-46534859 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1173976267 20:47188976-47188998 GGGGAGGGAGGAAGGAGAAGAGG + Intergenic
1174038682 20:47683984-47684006 TGGGGGTGAGGGAGATTTAGTGG + Intronic
1174178414 20:48659175-48659197 GGGGAGAGAGGGGAATGGAGGGG + Intronic
1174198568 20:48790926-48790948 GGGGAGGGTGGGAGCTGATGGGG - Intronic
1174298998 20:49568437-49568459 GGGGACTGAGGGGGATGTGGTGG + Intergenic
1174339321 20:49886236-49886258 GGGGAGAGACGGAGGTAAAGAGG - Intronic
1174351848 20:49974258-49974280 GGGAGGAGAGGGGGATGAAGTGG + Intergenic
1174833793 20:53837699-53837721 AGGGAGGGAGGGAGAAGAAAAGG - Intergenic
1174847852 20:53960712-53960734 GGGAAGTGAGGGAGAGAGAGAGG - Intronic
1175120224 20:56711001-56711023 GGAGAGGGAGGGAGAGGAGGTGG - Intergenic
1175120238 20:56711043-56711065 GGGGGGAGAGGGAGAGGAGGAGG - Intergenic
1175294209 20:57897318-57897340 GGGGACTGTGGGAGACGAGGAGG + Intergenic
1175345070 20:58267044-58267066 GGGGAGGGAGGGAGAAGAATGGG + Intergenic
1175408151 20:58748331-58748353 AGGGATTGAAGGATATGAAGGGG + Intergenic
1175487346 20:59355616-59355638 GGGGAGAGGGGGAGAGGGAGAGG - Intergenic
1175525895 20:59633034-59633056 GAGGAGTGTGGGAGTTGATGGGG + Intronic
1175647385 20:60686115-60686137 GGGGTGAGAGGGTGATGCAGGGG - Intergenic
1175657834 20:60787118-60787140 GGAGGGAGAGGGGGATGAAGAGG - Intergenic
1175685927 20:61028979-61029001 GGGGAGAGAGAGAGAGAAAGAGG - Intergenic
1175717161 20:61262833-61262855 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
1175748074 20:61475503-61475525 GGGGAGAGAGAGAGAGGGAGAGG - Intronic
1175772550 20:61632819-61632841 GGGGAGAGGAGGAGAGGAAGAGG - Intronic
1175774986 20:61647558-61647580 GGGGAGGGAGGGAGAGGGAGAGG - Intronic
1175914230 20:62418355-62418377 GGGGCTTCAGGGGGATGAAGTGG + Intronic
1175921320 20:62451749-62451771 GGGGAGGGAGAGAGAGGGAGAGG + Intergenic
1175966280 20:62661658-62661680 AGGGAGGGAGGGAGATGGGGGGG - Intronic
1176047792 20:63101676-63101698 GGAGAGGGAGGGAGAGGGAGGGG - Intergenic
1176047804 20:63101700-63101722 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1176125539 20:63472996-63473018 GGGGAGTGGGGGAGGGGGAGGGG + Intergenic
1176269394 20:64227809-64227831 GGGGAGAGGGTGAGATGAACGGG + Intronic
1176408477 21:6434711-6434733 GGAGAGTGAGCCAGATGAAGAGG - Intergenic
1176622219 21:9068006-9068028 GAGGAGTTGGGGAGATGCAGAGG + Intergenic
1176656854 21:9594538-9594560 GGGGAAAGAGGGAGAGGGAGAGG + Intergenic
1176719100 21:10378995-10379017 GGGGAGAGAGGGAGACAGAGGGG - Intergenic
1177872561 21:26591114-26591136 GGAGAGGGAGGGAGCTGAAAAGG - Intergenic
1178238993 21:30877352-30877374 AGGGAGGAAAGGAGATGAAGAGG + Intergenic
1178239256 21:30880451-30880473 GGGGAGTGAGGAAGAGGAAAAGG + Intergenic
1178269041 21:31172596-31172618 GGGGACCGGGGGAGAGGAAGAGG + Intronic
1178511950 21:33212757-33212779 GGGGAGAGAGGGAGAAGGAGAGG + Intergenic
1178604227 21:34021290-34021312 TGGGAGTGAGGGAGAGAGAGAGG + Intergenic
1178624148 21:34201722-34201744 GGGGGATGAGGGAGATTAAGAGG + Intergenic
1178746765 21:35259263-35259285 TGGGAGTGAGGGTGAGAAAGGGG + Intronic
1178790685 21:35697327-35697349 TGGCATTGAGGGAGAGGAAGGGG - Intronic
1179474986 21:41637305-41637327 GGGCAGGGAGGCAGATGAAAGGG - Intergenic
1179635604 21:42706772-42706794 GGGGGGTGAAGGGGATGGAGGGG - Intronic
1179683970 21:43043037-43043059 GGAGAGTGAGCCAGATGAAGAGG - Intergenic
1179958687 21:44756039-44756061 CTGGAGTGATGGAGAAGAAGAGG + Intergenic
1180128568 21:45809425-45809447 GAGGAGTACGGGAGATAAAGAGG + Intronic
1180654491 22:17408196-17408218 GGGGGGTGAGGGGGCTGAGGGGG - Intronic
1180757667 22:18173953-18173975 GGTGAGTGCTGGAGATGAGGCGG - Intronic
1180825195 22:18856716-18856738 GGGGAGTGAGGGACACAAGGAGG + Intronic
1180861099 22:19083675-19083697 GGGGGGAGAGGGAGAGGGAGAGG - Intronic
1181051547 22:20240486-20240508 GGAGAAGGAGGGAGAAGAAGCGG - Intergenic
1181187535 22:21117831-21117853 GGGGAGTGAGGGACACAAGGAGG - Intergenic
1181211663 22:21292662-21292684 GGGGAGTGAGGGACACAAGGAGG + Intergenic
1181363899 22:22358860-22358882 AGGGAGGGAGGGAGATGACAAGG - Intergenic
1181402949 22:22662360-22662382 GGGCCATGAGGGAGCTGAAGAGG + Intergenic
1181437385 22:22918643-22918665 GGGGACTTGGGGAAATGAAGGGG + Intergenic
1181651563 22:24261834-24261856 GGGGAGTGAGGGACACAAGGAGG + Intergenic
1181705812 22:24648905-24648927 GGGGAGTGAGGGACACAAGGAGG - Intergenic
1181792514 22:25278676-25278698 GGGGAGAGGGGGAGGGGAAGAGG + Intergenic
1181924721 22:26348873-26348895 GGGGAGTGAAGGGGAGGGAGGGG + Intronic
1181960912 22:26621283-26621305 GGGAAGTGAGGCAGGAGAAGAGG - Intergenic
1182050982 22:27312334-27312356 GTGGAGAGAGGGAGATTGAGAGG + Intergenic
1182065419 22:27428215-27428237 GGGCAGTCAGAGAGATGCAGAGG - Intergenic
1182103288 22:27672073-27672095 AGGGAGGGAGGGAGAGAAAGAGG + Intergenic
1182377579 22:29859009-29859031 GGAGAGGGAGGGAGAGGGAGAGG + Intergenic
1182377605 22:29859108-29859130 GGAGAGGGAGGGAGAGGGAGAGG + Intergenic
1182496746 22:30714044-30714066 GGGAAGTGGGGGAGAAGGAGAGG - Intronic
1182624898 22:31638435-31638457 GGGGATGAAGGGGGATGAAGTGG + Intronic
1182668131 22:31973630-31973652 GGGGAGGGAGGGAGGGGAATTGG + Intergenic
1183102686 22:35593542-35593564 GGGGAGAGAGGGAGAGAGAGAGG + Intergenic
1183204273 22:36407860-36407882 TGAGATTCAGGGAGATGAAGTGG + Intergenic
1183315020 22:37132327-37132349 GGGGTGTGAGTGGGATGAGGGGG - Intronic
1183317628 22:37145656-37145678 GGGGAGGCAGGGAGATGAGGAGG + Intronic
1183329608 22:37212234-37212256 GGGGAGAGAGAGAGAGGGAGAGG + Exonic
1183603483 22:38853753-38853775 GGGGAGGGAGCAAGATGCAGGGG + Intergenic
1183674477 22:39291885-39291907 GGAGAGTGAAGGAGGTGAATTGG + Intergenic
1184213947 22:43053911-43053933 GGGGAGGGAGGGAGAGCAAAGGG + Intronic
1184420328 22:44378421-44378443 GGGAAGAGAGGGAGAGGGAGGGG - Intergenic
1184422825 22:44391734-44391756 AGGGAGTGGAGGAGAGGAAGGGG - Intergenic
1184740952 22:46428854-46428876 GGGGAGGCAGGGACATGCAGGGG - Intronic
1184845052 22:47077656-47077678 GGGGAGTGAGACAAGTGAAGAGG + Intronic
1184875174 22:47269804-47269826 GGAGAATGAGGGAGCTGGAGAGG - Intergenic
1185229850 22:49673635-49673657 GGGGAGGGAGGGGGATGGAGGGG + Intergenic
1185276814 22:49953499-49953521 TGGGGGTGGGGGAGAGGAAGGGG - Intergenic
1203215290 22_KI270731v1_random:2770-2792 GGGGAGTGAGGGACACAAGGAGG - Intergenic
1203275340 22_KI270734v1_random:82619-82641 GGGGAGTGAGGGACACAAGGAGG + Intergenic
949154019 3:807680-807702 AGGGAATGAGTGAGAGGAAGAGG - Intergenic
949354494 3:3164092-3164114 GGAGAGGGAGAGAGATGGAGGGG - Intronic
949551532 3:5116090-5116112 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
949620095 3:5801098-5801120 AGGGAGGGAGGGAGAAAAAGAGG - Intergenic
949723772 3:7020349-7020371 GGGGAGAGAGAGGGATGAATAGG + Intronic
949838171 3:8291740-8291762 AGTGAGTGAGGGAGATGGTGAGG + Intergenic
949838189 3:8291818-8291840 AGTGAGTGAGGGAGATGGTGAGG + Intergenic
949936196 3:9118258-9118280 TGGGAGAGAGAGAGAGGAAGAGG - Intronic
949940394 3:9150145-9150167 GGGGTGCCAGGGAGATCAAGAGG + Intronic
949988577 3:9559364-9559386 GGGGGGAGAGGGAGAGGGAGAGG - Intergenic
950002173 3:9665473-9665495 GGGGAGAGAGGAAGAGGAGGAGG + Intronic
950004765 3:9684634-9684656 GGCGCAGGAGGGAGATGAAGAGG - Exonic
950121754 3:10486458-10486480 GGGGAGAGAGGTAGATGATGTGG - Intronic
950257537 3:11518066-11518088 GGTGAGTGGGAGAGAGGAAGGGG + Intronic
950466934 3:13161286-13161308 GGGGAGTGCGGGAGGAGAAGCGG + Intergenic
950675333 3:14551009-14551031 GGGGAGTGAGTGAGCGGGAGGGG + Intergenic
950747588 3:15102653-15102675 GGGGAGAAAGGAAGAGGAAGAGG + Intergenic
950797486 3:15521814-15521836 GGGGAGGGAGAGAGAGGGAGGGG - Intergenic
950855101 3:16097335-16097357 GGGGAGAGAGAGAGAACAAGAGG - Intergenic
951053965 3:18126195-18126217 AGGGAAAGAGGGAGAAGAAGGGG - Intronic
951467465 3:23017718-23017740 GAGGGGAGAGGGAGATGAAAGGG + Intergenic
951479982 3:23150052-23150074 TGGGAGTGAGAGGGATGAATAGG + Intergenic
951565780 3:24011373-24011395 GAGGAGTCAGGGAGAGCAAGGGG - Intergenic
951565939 3:24012547-24012569 GAGGAGTCAGGGAGAGCAAGGGG + Intergenic
952312150 3:32199926-32199948 AGGGAGTGAGGAAGAGGAATAGG + Intergenic
952405065 3:32997950-32997972 TTGGGGTGAGGGAGAGGAAGAGG + Intronic
952580374 3:34825431-34825453 AGGGAAGGAGGGAGATGGAGGGG + Intergenic
952839322 3:37630831-37630853 GGGGAGTGAGGGAGGACACGTGG + Intronic
953374296 3:42415761-42415783 GGGGAGGGAGAGGGAGGAAGAGG + Intergenic
953384767 3:42500301-42500323 GGGGAGGGAGGGAGAGGGACTGG - Intronic
953665836 3:44925844-44925866 GGGAAGAGAGGGAGATGGGGTGG + Exonic
953712956 3:45290466-45290488 GGGTAGTGAGAGTGAGGAAGGGG + Intergenic
953782656 3:45885134-45885156 GGGAACTGAGGGTGATGAAGGGG + Intronic
953903675 3:46857617-46857639 GGGGAGGGAGGGAGAAAAGGAGG + Intergenic
954131562 3:48563804-48563826 GGGGGCTGAGGGAGATAAATGGG - Intergenic
954432947 3:50480909-50480931 GGGGAGGAAGGGGGAGGAAGGGG + Intronic
954432952 3:50480919-50480941 GGGGAGGAAGGGGGAGGAAGGGG + Intronic
954510639 3:51121704-51121726 GGGGAATGAGGGAGAGAAAGGGG + Intronic
954903197 3:54037730-54037752 GGTGAATGTTGGAGATGAAGTGG + Intergenic
954908130 3:54080132-54080154 GGGAAGTGAGGGAGAGAAGGAGG - Intergenic
954912720 3:54122481-54122503 GGGGAGGGAGGGAGGAGAGGTGG - Intergenic
955173223 3:56585126-56585148 GGAGAGGGAGGGAGAGGGAGAGG + Intronic
955321129 3:57975148-57975170 TGGGGGTGAGGGTGAGGAAGAGG + Intergenic
955695581 3:61632796-61632818 GGGAGGGGAGGGGGATGAAGGGG - Intronic
955889058 3:63631378-63631400 GGAGATTGAGGGAGAATAAGGGG - Intergenic
956321946 3:68007597-68007619 GGGGAGGGAGGGAGGTGGGGTGG - Intronic
956768838 3:72507363-72507385 AGGGAATGAGGGAAATGAAGAGG - Intergenic
956910636 3:73813058-73813080 GGGGAGACAGGGGGAGGAAGAGG - Intergenic
957058957 3:75466154-75466176 AGGGAGAGAGGGAGAGGGAGAGG - Intergenic
957078773 3:75620301-75620323 GGGGAGGGAGGGAGGGGGAGCGG - Intergenic
957453019 3:80403795-80403817 GGGGAGAGAGGGAGAGAGAGAGG - Intergenic
957625886 3:82651237-82651259 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
957794366 3:84984405-84984427 GGGAGGTAAGGGAGATGGAGGGG - Intronic
958431182 3:94043576-94043598 GGGGAGGGAGAGAGGGGAAGAGG - Intronic
958431209 3:94043630-94043652 GGGGAGGGAAGGAGAGGGAGGGG - Intronic
958562904 3:95770557-95770579 GGGGGTTGGGGGAGGTGAAGGGG + Intergenic
958630088 3:96673152-96673174 GGGGAGAGAGAGAGATGGAGGGG - Intergenic
958630092 3:96673171-96673193 GGAGAGAGAGAGAGATGGAGGGG - Intergenic
958957669 3:100478986-100479008 GGGGGGAGAGGGAGAGGGAGAGG + Intergenic
959351975 3:105277007-105277029 AGGGAGAGAGGGAGAGAAAGAGG + Intergenic
959539673 3:107524381-107524403 GGTGAGTGAGCGAGACGAGGTGG - Intronic
959586213 3:108026918-108026940 GGGGGGAGAGGGAGAGGGAGAGG + Intergenic
960201932 3:114847442-114847464 TGGGAGGGTGGGGGATGAAGAGG + Intronic
960266214 3:115624033-115624055 GGGGTGTGGGGGAGATGATGTGG + Intronic
960447181 3:117763056-117763078 GGGGAGAGAGAGAGACGGAGAGG + Intergenic
960486864 3:118263293-118263315 GTGGGGTGTGGGGGATGAAGGGG - Intergenic
960715121 3:120567614-120567636 GGGGAGGGAGGGAGACAAGGGGG - Intergenic
960997970 3:123352000-123352022 GAGGGATGAGGGAGAAGAAGAGG - Intronic
961037403 3:123652167-123652189 GAGGAGTGAGAGAGAAGTAGAGG + Intronic
961345439 3:126260636-126260658 AGGGAGAGGGGGAGAAGAAGGGG - Intergenic
961625713 3:128262279-128262301 GGGGAGAGAGGGACACAAAGGGG - Intronic
961729025 3:128953608-128953630 GGAGAGGGAGGGAGAGGGAGAGG - Intronic
961940936 3:130636894-130636916 GGGGAGGAAGGGGGAGGAAGGGG - Intronic
961940985 3:130636994-130637016 GGAGGGGGAGGGAGAGGAAGGGG - Intronic
961941001 3:130637030-130637052 GGAGGGGGAGGGAGAGGAAGGGG - Intronic
962013979 3:131421816-131421838 GGGGATTGAGGGAGAGGTAAGGG + Intergenic
962072195 3:132044661-132044683 GGGGAGGGAGGGGGAGGGAGGGG + Intronic
962105112 3:132381950-132381972 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
962218960 3:133547236-133547258 GGAGAGAGAGGGAGAAAAAGAGG - Intergenic
962275717 3:134011903-134011925 GAGGAGTGTGAGAGATGACGTGG + Intronic
962910756 3:139847489-139847511 AGAGAGGGAGGGAGAAGAAGGGG + Intergenic
963742975 3:149097957-149097979 GGGGAGGGAGGGGGAGGAGGGGG + Intergenic
963776568 3:149445778-149445800 GGGGAGGGAGGGGGAGGGAGAGG + Intergenic
964254996 3:154766189-154766211 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
964434623 3:156638609-156638631 GGGGAGTGGGGAAGAGGAAATGG - Intergenic
964808285 3:160635435-160635457 GGGGAGTGAAGGGAATGATGAGG + Intergenic
964816855 3:160727001-160727023 AGGGATTCAGGGAGATGAATGGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
964936064 3:162089500-162089522 GGAGAGTCAGGGAGAAGTAGGGG - Intergenic
965026860 3:163313529-163313551 TGGGAGGGAGGGAGAGAAAGAGG - Intergenic
965202506 3:165677477-165677499 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
965301976 3:167017360-167017382 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965301990 3:167017416-167017438 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965301997 3:167017447-167017469 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302013 3:167017503-167017525 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302021 3:167017534-167017556 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302057 3:167017652-167017674 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302065 3:167017683-167017705 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302073 3:167017714-167017736 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302081 3:167017745-167017767 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302089 3:167017776-167017798 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302097 3:167017807-167017829 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302133 3:167017925-167017947 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302141 3:167017956-167017978 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302149 3:167017987-167018009 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302157 3:167018018-167018040 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302165 3:167018049-167018071 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302173 3:167018080-167018102 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
965302181 3:167018111-167018133 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
966256188 3:177918468-177918490 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
966355397 3:179073426-179073448 GGGGTGTGAGTGAAATGATGAGG - Intergenic
966485189 3:180460915-180460937 GGGGAGAGAGAGGGATGAATAGG - Intergenic
966631057 3:182075563-182075585 GGGGGTTGGGGGAGATGAAGGGG - Intergenic
967033636 3:185631459-185631481 GGGGAGGGAGGGAGGGGGAGGGG - Exonic
967420137 3:189263296-189263318 TAGGAGTTAAGGAGATGAAGGGG + Intronic
967521203 3:190435085-190435107 GGGGAGTGAGGAGGAAGAAGAGG - Intronic
967578679 3:191125772-191125794 GGAGAGAGAGGGAGAGGGAGGGG + Intergenic
967596082 3:191328385-191328407 GAAGAGAAAGGGAGATGAAGAGG - Intronic
967713276 3:192734097-192734119 GGGGAGGGTGGGAGATGTATAGG - Intronic
968036676 3:195553711-195553733 GGGAAGTGAGGGGGAAGTAGGGG - Intergenic
968047640 3:195632806-195632828 GGGTAGTGAGGGGGATGTCGGGG + Intergenic
968306973 3:197657118-197657140 GGGTAGTGAGGGGGATGTCGGGG - Intergenic
968339318 3:197941478-197941500 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
968359991 3:198139899-198139921 AAGGAGTGGGGGAGATGGAGGGG + Intergenic
968653011 4:1767432-1767454 GGGGAAGGAGGGAGAGGGAGGGG - Intergenic
968889327 4:3359263-3359285 GGAGGGTGAGGGAGAGGAGGAGG - Intronic
968947348 4:3672231-3672253 GGGGAGGGAGGCAGGAGAAGGGG - Intergenic
968957430 4:3726406-3726428 AGGGAGGGAGGGAGAGGGAGAGG + Intergenic
969049694 4:4363924-4363946 GAGGAGTGGGGGAGGTGACGAGG - Intronic
969312486 4:6362039-6362061 AGGGGGTGAGGGGGTTGAAGAGG + Intronic
969334001 4:6496039-6496061 GGGGGGTTAGGGAGATACAGAGG - Intronic
969366053 4:6694769-6694791 GGGGAGTGAGAAAGAAGGAGAGG - Intronic
969398036 4:6935567-6935589 GGGGAGAGAGGGAGAGGGAAAGG - Intronic
969481304 4:7448499-7448521 AGGGAGGGAGGGAGATGGAAAGG - Intronic
969495995 4:7526509-7526531 GCGGGGTGAGGGGGATGAATCGG + Intronic
969668491 4:8575937-8575959 AGGGAGGGAGGGAGAGGGAGGGG - Intronic
969689761 4:8698032-8698054 GGGGACCCAGGGAGATGAAGTGG + Intergenic
970175249 4:13332900-13332922 GGGGAGGGAGGGAGTTGCACAGG - Intergenic
970223804 4:13836661-13836683 GGGGTGAGAGGCAGATGGAGGGG + Intergenic
970409062 4:15790176-15790198 GGAGAGAGAGGGAGAGGGAGGGG - Intronic
970445010 4:16116133-16116155 GGGGAGTGAGGGAGCTGTGGAGG - Intergenic
970919794 4:21380434-21380456 GGAGAGGGAGGGAGAGGGAGAGG + Intronic
971111672 4:23592358-23592380 GGGGAGGGAGGGAGGGGGAGGGG - Intergenic
971149662 4:24018479-24018501 GTGGGGTGAGGGTGATGAGGGGG + Intergenic
971302293 4:25451504-25451526 AGGGAGGGAGGGAGAAAAAGAGG + Intergenic
971375060 4:26049816-26049838 GGTGAGAGAGGCAGATGAGGAGG - Intergenic
971744122 4:30557263-30557285 GGGAAGTGAGAGAGAAGAATAGG + Intergenic
973041211 4:45472269-45472291 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
973235425 4:47897740-47897762 GGAGAGAGAGAGAGATGAATAGG - Intronic
973555920 4:52082961-52082983 GGGGAGGGATGGAGACAAAGAGG + Intronic
975044454 4:69784043-69784065 GGAGAATGAGCAAGATGAAGAGG - Intronic
975047041 4:69818207-69818229 GGGGAGCAAGGGAGAGAAAGAGG - Intronic
975063658 4:70036960-70036982 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
975254300 4:72215813-72215835 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
975458582 4:74623498-74623520 GAGGAAATAGGGAGATGAAGGGG + Intergenic
975476208 4:74826099-74826121 GGAAATAGAGGGAGATGAAGAGG + Intergenic
975529518 4:75386092-75386114 GGGTAGGGAGGGAGCTGAAAGGG - Intergenic
975637246 4:76462749-76462771 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
976149254 4:82077099-82077121 GTGGGGAGAGGGAGATGGAGAGG - Intergenic
976151431 4:82096369-82096391 GGGGAGTGGGAGGGGTGAAGAGG + Intergenic
976308152 4:83582111-83582133 GGGAAGTGAAGAAGAAGAAGAGG + Intronic
976607232 4:86995285-86995307 GGGGAGGGAGGGAGAGGGGGAGG - Intronic
976675245 4:87695428-87695450 GGGGAGGGAGGGGGATGGAAGGG + Intergenic
976700840 4:87966997-87967019 GGAGGGTGAGGAAGACGAAGAGG - Intergenic
976753858 4:88477540-88477562 GGGAAGTGGGGGAGGGGAAGGGG + Intronic
976999561 4:91480951-91480973 TGTGAGTGAGAGAGAGGAAGAGG + Intronic
977481160 4:97577583-97577605 GGGGAGTGAGGGAGGTGGTAAGG + Intronic
977492579 4:97733439-97733461 GGGGAGGGTGGGAGAGGAATAGG + Intronic
977804186 4:101277046-101277068 GGGGAGTAAGAGGGATGAATAGG - Intronic
978215671 4:106199387-106199409 TGAGAGTGAGAGAGAGGAAGAGG - Intronic
978386472 4:108180512-108180534 GGGAAGAAAAGGAGATGAAGAGG + Intergenic
978421966 4:108542644-108542666 GGGGAGAGGGGAAGATGAAAGGG - Intergenic
978688836 4:111483000-111483022 GGGGAGCGAGTGAGGTGAACAGG + Intergenic
978820442 4:112958621-112958643 GGGGGGAGAGGGAGAGGGAGAGG + Intronic
978909235 4:114045752-114045774 AGAGAGAGAGGGAGACGAAGGGG + Intergenic
979097464 4:116569046-116569068 GGAGAGTGAGGGATGAGAAGAGG + Intergenic
979295141 4:119023462-119023484 GCTCTGTGAGGGAGATGAAGTGG + Exonic
979559827 4:122089275-122089297 GGGGAGAGAGTGAGAGGAAAAGG - Intergenic
979734435 4:124065031-124065053 GTGTAGGGAGGGAGAAGAAGAGG - Intergenic
980889992 4:138804587-138804609 GGGCTTGGAGGGAGATGAAGAGG - Intergenic
981023556 4:140053307-140053329 AGTCAGTGAAGGAGATGAAGGGG - Intronic
981156412 4:141441952-141441974 GGTGACTGAGGAGGATGAAGGGG + Intergenic
981768784 4:148282654-148282676 TGGGAGTGGGGGAGTTGGAGGGG + Intronic
981837985 4:149077820-149077842 GAGGAGGGAGGGAGAAGAAAAGG - Intergenic
981899523 4:149846175-149846197 AGGGAGTGAGGCAGGAGAAGAGG - Intergenic
981937241 4:150250864-150250886 GGGGAGTGTGGGGGATGTTGGGG - Intronic
982044811 4:151433376-151433398 GGAAAGTTAGGGAGAAGAAGGGG + Intronic
982065786 4:151653379-151653401 GGAGAGAGAGGGAGAGGGAGGGG - Intronic
982178920 4:152732049-152732071 GGGGAGAGAGGGAGAGAAAATGG + Intronic
982215992 4:153082931-153082953 GGGGAGAGAAGGGGGTGAAGGGG + Intergenic
982288689 4:153759589-153759611 GGGGAGGGAGGGAGTGGAGGAGG + Intronic
982336900 4:154250124-154250146 GGGGAGTGGGAGGGATGCAGTGG + Intronic
983050483 4:163040325-163040347 AGGGAGGGAGGGAGAGGCAGGGG + Intergenic
983069669 4:163253848-163253870 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
983525161 4:168753371-168753393 GGGGAGAGAGAGAGACAAAGGGG - Intronic
983604370 4:169569427-169569449 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
983872899 4:172842715-172842737 GGGGAAGGAGGGAGAGTAAGAGG + Intronic
983885238 4:172974320-172974342 GGGGAGAGAGAGAGAGAAAGAGG - Intronic
983913421 4:173265655-173265677 GGGGAGGGAGGGAGATTGGGGGG - Intronic
984014054 4:174405079-174405101 GGGAAGAGAGGGGGAGGAAGAGG - Intergenic
984102074 4:175499071-175499093 GGAGAGTGAGCAAGATGAAGGGG + Intergenic
984376248 4:178934277-178934299 TGGGAGTGATAGAAATGAAGTGG - Intergenic
984573965 4:181425950-181425972 GGGGAGCCAGGAAGACGAAGGGG + Intergenic
984654896 4:182307175-182307197 GGAAAGTGGGGCAGATGAAGAGG + Intronic
984753323 4:183299746-183299768 GGGAAATGATGGAGATGAAAGGG - Intronic
985117291 4:186604889-186604911 GAGGAGTGTAGGAGAAGAAGAGG + Intronic
985668225 5:1192849-1192871 GAGGAGTGGGGGAGATGTCGTGG + Intergenic
985743974 5:1636358-1636380 GGGTAGTGAGGGGGATGTCGGGG - Intergenic
986091900 5:4516923-4516945 GGGGGGAGAGGAAGAGGAAGAGG - Intergenic
986125629 5:4880468-4880490 AGGGAGTGAGAGACAGGAAGGGG + Intergenic
986183637 5:5416992-5417014 GGGGAGGGAGGGGGAAGGAGGGG + Intergenic
986588261 5:9341464-9341486 GGAGAGTGAGGGAGCAGGAGGGG + Intronic
986627474 5:9736189-9736211 GGGAAGTGAGGAAGAAAAAGAGG - Intergenic
986887571 5:12258660-12258682 GGAGGGTGAGGGGGATGAAAGGG - Intergenic
986923567 5:12717732-12717754 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
987217403 5:15751325-15751347 GGGGACTGAAGGATATGACGTGG + Intronic
987910158 5:24132466-24132488 GGGCAGGGAGGGAGAGGAGGAGG + Intronic
988314104 5:29601687-29601709 GGGGAGGGTGGGAGAGGAGGAGG - Intergenic
988454874 5:31378491-31378513 GGGGAGAAAGGGAGGTGAGGTGG + Intergenic
988578070 5:32445174-32445196 GCGGAGGGAGGGAGAAGGAGAGG + Intergenic
988613697 5:32752543-32752565 AGGGAGTGAGGGCGAAGGAGGGG - Intronic
988636910 5:32994766-32994788 GGGGGGAGAGGGGGATGAGGCGG - Intergenic
988680584 5:33480902-33480924 GGGAAGGGGAGGAGATGAAGGGG - Intergenic
988680655 5:33481080-33481102 GGGGAGGGGAGGAGATGGAGGGG - Intergenic
988895200 5:35664791-35664813 GGAGAGAGAGGGAGAGGAAGAGG + Intronic
989236507 5:39154281-39154303 GAGGATTGAGTGAGAGGAAGAGG - Intronic
989437281 5:41429385-41429407 GGGGAGGGAGGGAGAGAAGGCGG + Intronic
990106692 5:52272431-52272453 GGGGAGAGAGAGAGAAGAATGGG + Intergenic
990485901 5:56258846-56258868 GGGGAGAGAGGGAGGGGGAGGGG + Intergenic
990624796 5:57598734-57598756 GGGGAGTGAGGGAAAAGGAGAGG - Intergenic
990991755 5:61691168-61691190 GGGGAGAGAGGAGGATGAGGAGG + Intronic
991632991 5:68675400-68675422 GGGGAGTGAGGGAGAAGCAGGGG - Intergenic
992071693 5:73154684-73154706 AGGGAGGAAGGGAGAGGAAGGGG - Intergenic
992207821 5:74448037-74448059 GGCCTGTGAGGGAGATGAAAGGG - Intergenic
992365190 5:76083512-76083534 GGTGAGTGGGGGAGGTGAAGCGG + Exonic
992674516 5:79092329-79092351 GGGGATTGAGGGAGGTGGGGAGG - Intronic
992755077 5:79896608-79896630 GGGTAGTGGGGGAGGGGAAGTGG - Intergenic
992829151 5:80577663-80577685 GAGGAGTAGGGGAGAGGAAGTGG - Intergenic
992950434 5:81852353-81852375 GGGGAGTGAGGAAGGGGCAGCGG + Intergenic
993658139 5:90597613-90597635 AGGGAAGGAGGGAGTTGAAGTGG + Intronic
993992631 5:94678623-94678645 GGAGAGAGAGAGAGATGGAGGGG + Intronic
994001656 5:94788665-94788687 AGGGAGGGAGGGAGAAAAAGGGG - Intronic
994117687 5:96079227-96079249 GGGTAGGGAGTGAAATGAAGGGG - Intergenic
994245341 5:97470780-97470802 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
994377874 5:99035905-99035927 GGGGAGTGAGGGATGAAAAGTGG - Intergenic
994886233 5:105565109-105565131 AGGGAGTGAGTGGTATGAAGAGG + Intergenic
995236397 5:109833659-109833681 GGAGAGAGAGGGAGAGGGAGAGG + Intronic
995562069 5:113393130-113393152 GGTGAGAGAGGGAGAAGAACAGG + Intronic
995747544 5:115419310-115419332 TGGGAGTGAGAGAGATGGAGAGG + Intergenic
995781740 5:115783923-115783945 GGGAAGGGAGGGAGAAGAAAGGG - Intergenic
995895151 5:117002913-117002935 GGAGAGGGAGGGAGAGGGAGAGG + Intergenic
996008032 5:118447053-118447075 GGGGAAGGGGTGAGATGAAGTGG + Intergenic
996132007 5:119793075-119793097 GGGGAGTTATGGAGGTGGAGGGG + Intergenic
996354943 5:122585285-122585307 GTGGAGTGGGGGAGAAGAGGAGG - Intergenic
996398119 5:123033441-123033463 GGAGAGAGAGGAAGCTGAAGGGG - Intronic
996411223 5:123161664-123161686 GCTGAGTGAGTGAGGTGAAGAGG + Intronic
996997418 5:129714569-129714591 GTGGAGTGAGGGATATCAGGGGG + Intronic
997153387 5:131524574-131524596 GGAGAGAGAGGGAGAGGGAGGGG + Intronic
997321822 5:132983954-132983976 GGGGAGAGGGGGAGGGGAAGAGG + Intergenic
997380651 5:133434095-133434117 GGGGAGGGAGGGAGACCAATGGG + Intronic
997571192 5:134928881-134928903 GGGAAGTGTGGGAGAGGAATGGG + Intronic
997837562 5:137208025-137208047 TGGGTGTGAGGGAGATGAATGGG - Intronic
998053442 5:139055607-139055629 GGGGAGAGGGGGAGAGGGAGAGG - Intronic
998307436 5:141093550-141093572 GAAGAGGGAGGGGGATGAAGAGG - Intergenic
998371487 5:141664862-141664884 GGGGGGTGGGGGTGATGAGGGGG - Intronic
998446276 5:142200763-142200785 TGGGTGTTAGAGAGATGAAGAGG + Intergenic
998461557 5:142313839-142313861 AGGGAGGGAGGGAGAAGGAGGGG + Exonic
998610359 5:143681941-143681963 GGGAAGACAGGGAGAGGAAGAGG + Intergenic
998885243 5:146687071-146687093 GGGGAGGGAGAGAGAGGGAGAGG + Intronic
999129836 5:149273802-149273824 GGGGAGTGGGGGTGGTGGAGAGG - Intronic
999545994 5:152629224-152629246 TGGGAGTGGGGGAGGGGAAGTGG - Intergenic
999824959 5:155265095-155265117 GGAGAGAGAGGGAGAGAAAGTGG + Intergenic
999917336 5:156277272-156277294 AGGGAGAGAGGGAAAGGAAGAGG - Intronic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1000115371 5:158148928-158148950 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1000137883 5:158370469-158370491 GGGCAGTGGTGGAGAGGAAGAGG - Intergenic
1000158289 5:158573903-158573925 TGGGACTCAGGGAGATTAAGTGG - Intergenic
1000349034 5:160338391-160338413 GGGGGGTGGGGGAGTTGAGGGGG - Intronic
1000570854 5:162912204-162912226 GGGGATTGAGGGAGGAGGAGAGG - Intergenic
1000689471 5:164296913-164296935 GGGGAGAGAGGGGGGCGAAGAGG + Intergenic
1001078086 5:168644428-168644450 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1001566985 5:172706229-172706251 TGAGAGTGGGGGAGAAGAAGGGG + Intergenic
1001634323 5:173198852-173198874 AGGGAGAGAGAGAGAGGAAGAGG - Intergenic
1001732900 5:173973295-173973317 GGGGAAGGGGGGAGATGAAAAGG + Intergenic
1001996966 5:176169763-176169785 GGGGAGGGAGGGAGAGAAAGAGG + Intergenic
1002078364 5:176723218-176723240 GGGGATTTAGGGGGATGCAGAGG + Intergenic
1002088949 5:176793273-176793295 GGGGAGTGGGGGAGAGGGAAGGG - Intergenic
1002154426 5:177265478-177265500 GGGGAGGGAGGGAGAGAGAGAGG + Intronic
1002175048 5:177396925-177396947 GGGGACAGAGGGAGAGGAAGTGG - Intronic
1002208075 5:177577984-177578006 GAGGAGTGATGGAGATTATGAGG - Intergenic
1002453239 5:179331411-179331433 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453248 5:179331431-179331453 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453257 5:179331451-179331473 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453266 5:179331471-179331493 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453275 5:179331491-179331513 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453284 5:179331511-179331533 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453293 5:179331531-179331553 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453302 5:179331551-179331573 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453311 5:179331571-179331593 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002453320 5:179331591-179331613 GGGAAGGGAGGGAGAGGAGGGGG + Intronic
1002559668 5:180072572-180072594 AGGGACTGAGGGAGTTGAAGTGG + Intergenic
1002658398 5:180771769-180771791 GTGGAGAGAGGGAGACGGAGAGG + Intergenic
1002682894 5:180981983-180982005 AGGAAGAGAGGGAGACGAAGAGG + Intergenic
1003012552 6:2439401-2439423 GGCAAGTGAGTGAGATGAAGAGG + Intergenic
1003016015 6:2468124-2468146 GGGTAGACAGGGAGAGGAAGGGG + Intergenic
1003020411 6:2504752-2504774 GGGGTGTGGAGGAGATGAGGGGG - Intergenic
1003020419 6:2504773-2504795 GGGGTGTGGAGGAGATGAGGAGG - Intergenic
1003146744 6:3516404-3516426 GGGGAGCGGGGGAGATCATGGGG - Intergenic
1003146768 6:3516481-3516503 GGAGAGTGGGGGAGATGATAGGG - Intergenic
1003146776 6:3516519-3516541 GGGGAGCGGGGGAGATGATGGGG - Intergenic
1003146814 6:3516644-3516666 GGGGAGCCGGGGAGATGATGGGG - Intergenic
1003146821 6:3516663-3516685 GGGGAGCCAAGGAGATGATGGGG - Intergenic
1003146825 6:3516682-3516704 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003146832 6:3516701-3516723 GGAGAGTGGGGGAGATGATGGGG - Intergenic
1003146842 6:3516738-3516760 GGGGAGTGGGGGAGATGATGGGG - Intergenic
1003146849 6:3516757-3516779 GGGGAGCAGGGGAGATGATGGGG - Intergenic
1003146864 6:3516809-3516831 GAAGAGTGGGGGAGATGATGGGG - Intergenic
1003146887 6:3516882-3516904 GGGGAGCCGGGGAGATGATGGGG - Intergenic
1003146894 6:3516901-3516923 GGGGAGCCAGGGAGATGACGGGG - Intergenic
1003146899 6:3516920-3516942 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003146906 6:3516939-3516961 GGAGAGTGGGGGAGATGATGGGG - Intergenic
1003146927 6:3517014-3517036 GGAGAGTGGGGGAGATGATGGGG - Intergenic
1003146939 6:3517052-3517074 GGGGAGCGGGGGAGATGATGGGG - Intergenic
1003146946 6:3517071-3517093 GGGGAGTGGGGGAGATGTTGGGG - Intergenic
1003146964 6:3517128-3517150 GGGGAGGGGGGGAGATGTTGGGG - Intergenic
1003146996 6:3517220-3517242 GGGGAGCCGGGGAGATGATGGGG - Intergenic
1003147002 6:3517239-3517261 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003147021 6:3517296-3517318 GGGGAGTGGGGGAGATGTTGGGG - Intergenic
1003147028 6:3517315-3517337 GGAGAGTGGGGGAGATGATGGGG - Intergenic
1003197245 6:3925970-3925992 GGGGTGGGAGGGAGAAGGAGAGG + Intergenic
1003318931 6:5035599-5035621 GGGGAGGGAGGGAGGGGAGGAGG - Intergenic
1003318984 6:5035704-5035726 GGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1003318999 6:5035735-5035757 GGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1003319639 6:5038883-5038905 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1003560686 6:7177371-7177393 GGGGAGGGAGGGAGAGAAAAGGG - Intronic
1003620820 6:7697793-7697815 GGGGAAGGAGGGGGAAGAAGGGG + Intergenic
1003941882 6:11036925-11036947 GAGGAGGGAGAGAGATGGAGAGG + Intronic
1004114046 6:12749577-12749599 GGGGAGGAGGGGAGAGGAAGAGG - Intronic
1004152317 6:13133300-13133322 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1004193251 6:13483220-13483242 GGGGTTTGAGGGAGAGGAAGCGG + Intronic
1004304563 6:14488160-14488182 GGAGGGTGAGCGAGATGAAGAGG - Intergenic
1004367145 6:15022006-15022028 GGGGTGAGAGGGAGAGGGAGGGG - Intergenic
1004415177 6:15416721-15416743 GGGGGGAGAGGGAGAGGGAGAGG + Intronic
1004525054 6:16399777-16399799 GGGGAAGCAGGGAGATGGAGGGG - Intronic
1004635956 6:17467949-17467971 GGGTAGTGGGGGAGCTGAGGCGG - Intronic
1004668614 6:17773852-17773874 GGGGAGGAAGGAAGATGAATGGG - Intronic
1004893927 6:20128164-20128186 GGGGAGTGTTGGAGAAGAAGTGG - Intronic
1004901739 6:20200745-20200767 GGGGAGTGAGAGGGTTGGAGAGG - Intronic
1004987242 6:21096207-21096229 GGGTAGGGAGGGAGATGCATTGG + Intronic
1005063384 6:21797066-21797088 GGGGAGAGAGGGAGATGGGGGGG - Intergenic
1005223969 6:23620108-23620130 GGGGAGAGAGAGAGAGGGAGAGG + Intergenic
1005607227 6:27486426-27486448 GTGGGGTGAGGGAGAGGGAGAGG + Intergenic
1005843976 6:29763217-29763239 TGGGGGTGGAGGAGATGAAGGGG - Intergenic
1005958254 6:30679445-30679467 GGGGGTTGAGGGAGAGAAAGCGG + Intronic
1005959914 6:30687218-30687240 GAGGAGGGAGGGAGAGGAGGAGG + Exonic
1006014319 6:31068001-31068023 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1006075811 6:31531516-31531538 GGGGAATAAGAGAAATGAAGAGG - Intronic
1006371161 6:33644468-33644490 GGGAAGGGAGGAAGATGTAGGGG - Intronic
1006462812 6:34173376-34173398 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1006472824 6:34237795-34237817 TGGAAGTGAGGGAGATGGGGAGG + Intronic
1006546442 6:34785694-34785716 GGAGGGTGAGGGAGAGGGAGAGG - Intergenic
1006640778 6:35488508-35488530 GGGGAGGGGTGGAGATGTAGGGG + Intronic
1006650279 6:35545404-35545426 GGTGAGGGAGGGAGATGAAGTGG - Intergenic
1006801858 6:36764896-36764918 GTGGGGTGACGGAGATGCAGAGG - Intronic
1006838014 6:37010935-37010957 GGGGAGAGAAGGAGAAAAAGGGG - Intronic
1006855505 6:37130408-37130430 GGGGAGAGACTGAGGTGAAGAGG + Intergenic
1007116405 6:39346110-39346132 GGAGAGGGAGGGAGAGGGAGAGG - Intronic
1007253411 6:40511768-40511790 GGGACGTGAGGGAGAAGAAGGGG + Intronic
1007528145 6:42514926-42514948 AGGAAGTAAGGAAGATGAAGAGG + Intergenic
1007835661 6:44671822-44671844 GGGGGCTGAGGGAGAGGAGGGGG - Intergenic
1007926041 6:45650596-45650618 GGAGAGTCAGGGAGAGGGAGGGG + Intronic
1008106483 6:47444673-47444695 GGGGGGAGAGGGAGAGGGAGAGG + Intergenic
1008226899 6:48931191-48931213 TGTGAGGGAGGGAAATGAAGAGG - Intergenic
1008318126 6:50072123-50072145 GGGTAGTGAGGGAGGGGAGGAGG + Intergenic
1008863235 6:56176905-56176927 GGGGAGGAAGGGGGAGGAAGGGG + Intronic
1008869931 6:56261156-56261178 GCAGAGTGAGGGAGAGGGAGAGG - Intronic
1009315348 6:62212401-62212423 GGGGAGAGAGGGAGATGGTATGG + Intronic
1009910673 6:69923275-69923297 GGAGAGAGAGGGATATGAATAGG - Intronic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1010341175 6:74754985-74755007 GGAGGGTGAGTGAGATGAAGAGG - Intergenic
1010445330 6:75943184-75943206 GGGGGGTGAGGCTGCTGAAGAGG - Intronic
1011064386 6:83309792-83309814 AGGGAGTGGGGAAGATGAAAAGG + Intronic
1011163131 6:84414959-84414981 GGTGGGTGAGGGAGAAGGAGGGG + Intergenic
1011587902 6:88946643-88946665 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1011609937 6:89140990-89141012 AGGGAGTGAGTGAGTTGAAAGGG - Intergenic
1011949133 6:92942594-92942616 GGGGAGGGAGGGAGAAAAGGAGG - Intergenic
1011975710 6:93295018-93295040 GGGAAGGGAGGAAGATGAAAAGG + Intronic
1012052212 6:94360913-94360935 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1012111607 6:95242108-95242130 GGGGAGGGAGGGGGAGGGAGAGG + Intergenic
1012468907 6:99547934-99547956 GGGTATTGAGGGAGATGAAAGGG + Intronic
1012824429 6:104128689-104128711 GAGGGGTGAGGCAGGTGAAGGGG + Intergenic
1013150666 6:107442822-107442844 CAGTAGTGATGGAGATGAAGTGG - Intronic
1013239400 6:108229422-108229444 GGGGAGGGAGGGAGGGGGAGAGG - Intronic
1013541458 6:111114682-111114704 AGGGAGGGAGGGAAATGGAGGGG + Intronic
1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG + Intronic
1013681495 6:112529194-112529216 GGGGAGAGAGGGAGAGGGAAAGG + Intergenic
1013836354 6:114341165-114341187 AGGGAGGGAGGGAGAGGGAGAGG + Intronic
1013890338 6:115019491-115019513 GAAGAGTGATGGGGATGAAGTGG + Intergenic
1014082184 6:117300522-117300544 AGGGAGGGAGGAAGTTGAAGAGG + Intronic
1014226607 6:118855518-118855540 GAGGAGTGAGGTAGAGGGAGGGG - Intronic
1014736455 6:125100211-125100233 GGGGGGAGAAGGAGATGAAAGGG + Intergenic
1014827593 6:126064132-126064154 GGGGAGGGAGGGAGAAGATGGGG + Intergenic
1014945061 6:127487722-127487744 GGGGAATGTGGGTGAAGAAGAGG + Intronic
1015408773 6:132868274-132868296 GGAAAATGAGGAAGATGAAGAGG - Intergenic
1015452008 6:133380874-133380896 GGGGAGGGAAGAAGAAGAAGAGG - Intronic
1015699471 6:136019901-136019923 GGAGAGGGAGGAAGAGGAAGGGG + Intronic
1015771184 6:136769841-136769863 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1015871678 6:137781809-137781831 GAGAAGTGAGAGAGAGGAAGAGG + Intergenic
1016497602 6:144682119-144682141 GGGGGGTGATGGGGAGGAAGTGG - Intronic
1016616306 6:146052476-146052498 GGGGAGTTAGGGAGAGAAAGGGG + Intronic
1016758812 6:147715704-147715726 GGAGAGTGAGTAAGATGATGAGG + Intronic
1017332738 6:153218467-153218489 GGGAAGGGAGGGAAATGGAGGGG - Intergenic
1017637333 6:156456141-156456163 GGGGAGGGAGGGGGGAGAAGGGG - Intergenic
1018235154 6:161716769-161716791 GGGCAGCGTGGGAGGTGAAGTGG + Intronic
1018244014 6:161804496-161804518 GGGGAGGGAAGGGGATGGAGAGG - Intronic
1018651530 6:165995762-165995784 GGGGTGGGAGGGAGATGGAGTGG - Intergenic
1018897470 6:168030409-168030431 GGGGAGGGAGGGAGAGAGAGAGG - Intronic
1018914061 6:168121914-168121936 GGGGAGAGAGGGAGAAGGAGTGG + Intergenic
1018948484 6:168363458-168363480 AGGGCGAGAGGGAGATGGAGGGG + Intergenic
1019158205 6:170052799-170052821 GGGGAGGGAGGGGGAGGGAGAGG - Intergenic
1019158225 6:170052835-170052857 GGGGAGGGAGAGAGAGGGAGGGG - Intergenic
1019259997 7:76721-76743 GAGGAGTGGGGGAGATGGAGGGG - Intergenic
1019342047 7:512939-512961 GGGGAGGGAGGGAGACGTACAGG - Intronic
1019414126 7:919741-919763 GGAGAGGGAGGGAGATGGGGGGG + Intronic
1019502339 7:1370424-1370446 AGGGAGAGAGGAAGATGGAGAGG + Intergenic
1019512331 7:1423960-1423982 TGGGAGTGAGGGGGAAGAGGCGG + Intergenic
1019534828 7:1523461-1523483 AGGGAGTGCTGGAGACGAAGGGG + Intergenic
1019551742 7:1606679-1606701 GAGGAGGGAGGGGGAAGAAGAGG - Intergenic
1019551785 7:1606789-1606811 GAGGAGGGAGGGGGAAGAAGAGG - Intergenic
1019551823 7:1606894-1606916 GGGGAGGGAGGGGGAAGAACAGG - Intergenic
1019561919 7:1663748-1663770 AGGGAGAGAGAGAGAGGAAGAGG + Intergenic
1019668839 7:2267331-2267353 GTGGGGTGAGGGAGAGGGAGAGG - Intronic
1019705695 7:2496179-2496201 GGGGGATGAGGGGGATGCAGAGG + Intergenic
1019715183 7:2535290-2535312 GGAGAGAGAGGGAGACGGAGAGG + Intergenic
1019805049 7:3117562-3117584 GAGGAGGGAGGGAGAGAAAGAGG + Intergenic
1019897863 7:3997267-3997289 GGAGGGTGAGGAAGATGAAGAGG + Intronic
1019927867 7:4205107-4205129 GGGGAGCGAGGGGGCTGGAGGGG + Intronic
1020511560 7:9063125-9063147 GGGGAGGGAGGGAGAGAGAGAGG + Intergenic
1021000484 7:15324563-15324585 CAGGAGTGAGGGAGATGAGGGGG - Intronic
1021559288 7:21953504-21953526 GGGGTGTGTGTGTGATGAAGTGG - Intergenic
1021697086 7:23286255-23286277 GGGGAGAGAGGGGGAAGGAGGGG - Intergenic
1021894233 7:25219181-25219203 AGGGAGGGAGGGAGGAGAAGGGG - Intergenic
1021967267 7:25932863-25932885 GGGGAATGAGTGAGTTGAACAGG + Intergenic
1022149475 7:27586396-27586418 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1022230909 7:28410922-28410944 GGGGAGTGGTGGAGAGGGAGGGG - Intronic
1022313289 7:29218193-29218215 GGCGAGTGAGGGGGTGGAAGGGG - Intronic
1022423380 7:30245565-30245587 GGAGAGTGAGCAAGCTGAAGAGG + Intergenic
1022758289 7:33318729-33318751 GGGAAGGGAAGGAGAGGAAGGGG - Intronic
1023139218 7:37084179-37084201 CGGGAGGGAGAGGGATGAAGAGG + Intronic
1023291339 7:38671801-38671823 GGGGAGTGAGGGTGGGGAATGGG + Intergenic
1023916941 7:44596932-44596954 GGGGAGGGAGGGAAAGGGAGGGG + Intergenic
1023916950 7:44596951-44596973 GGGGAGGGAGGGAAAGGGAGGGG + Intergenic
1023965331 7:44961016-44961038 GGGGGTTGAGGGGGCTGAAGGGG + Intergenic
1024259479 7:47563135-47563157 AGTGAGTGAGGCAGATGGAGTGG + Intronic
1024304975 7:47921914-47921936 GGGGAGAGAGGGAGAGGGAGAGG - Intronic
1024594517 7:50920852-50920874 GGGGAGGCAGGGAGGGGAAGGGG - Intergenic
1024751445 7:52470274-52470296 GGGGAGAGAGAGAGAGGCAGGGG + Intergenic
1024934882 7:54702024-54702046 GGGGAGTGCGGGGAATGAAGTGG + Intergenic
1024963376 7:55001798-55001820 GGGGAGTGAGGGTACTGAAGGGG - Intergenic
1025852638 7:65257348-65257370 GGGGGGAGAGGGAGAGGGAGAGG - Intergenic
1025852640 7:65257354-65257376 GGGGAGGGGGGGAGAGGGAGAGG - Intergenic
1026305249 7:69134746-69134768 AGGGAGGGGGGGAGAGGAAGAGG - Intergenic
1026488846 7:70845658-70845680 GGGGAGGGAGGGGGAGGGAGGGG + Intergenic
1026488852 7:70845668-70845690 GGGGAGGGAGGGGGAGGGAGGGG + Intergenic
1026488858 7:70845678-70845700 GGGGAGGGAGGGGGAGGGAGGGG + Intergenic
1026488864 7:70845688-70845710 GGGGAGGGAGGGGGAGGGAGGGG + Intergenic
1026488870 7:70845698-70845720 GGGGAGGGAGGGGGAGGGAGGGG + Intergenic
1026658453 7:72277663-72277685 AGGAAGTGAGGGAGGTGAAGAGG - Intronic
1026941219 7:74289224-74289246 GGGAAGGGAAGGAGATGGAGCGG + Intergenic
1027159763 7:75793768-75793790 AGGGAGAGAGGGAGGGGAAGGGG + Intergenic
1027486752 7:78771139-78771161 AGGGAGAGAGGGAGAGGCAGAGG - Intronic
1028032185 7:85930217-85930239 GGGGAGAGAGAGAGAGAAAGAGG - Intergenic
1028502764 7:91537417-91537439 GGAGGGAGAGGGAGAAGAAGTGG - Intergenic
1028504301 7:91554762-91554784 GTGGAGGGAGGGTGAGGAAGTGG - Intergenic
1028595835 7:92545801-92545823 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1028816830 7:95156540-95156562 GGAGGATGAGCGAGATGAAGGGG + Intronic
1029187276 7:98748230-98748252 AGGGAGGGAGGGAGAGAAAGAGG + Intergenic
1029194245 7:98793612-98793634 GAGGAGGGAGGGAGCTGGAGGGG - Intergenic
1029472269 7:100762093-100762115 AGGGCGTGAGGAGGATGAAGAGG - Intronic
1029552931 7:101247573-101247595 GGGGACACAGGAAGATGAAGGGG + Intronic
1029608938 7:101616321-101616343 AGGGAGAGAGGCAGGTGAAGAGG + Intronic
1029622132 7:101696838-101696860 GGGGAGTTAGCAAGAAGAAGAGG + Intergenic
1029899372 7:104022871-104022893 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1029931928 7:104381547-104381569 AGGGAGTGAGGGAGGGAAAGAGG - Intronic
1029973715 7:104814042-104814064 GGAGGGTGAGCAAGATGAAGAGG + Intronic
1030166764 7:106562990-106563012 AGGGAGTGAGGGAGAGAGAGAGG + Intergenic
1030532893 7:110732174-110732196 GGGTAGAGAGGGAGCTGAAGAGG + Intronic
1030706522 7:112698077-112698099 GGGGGGTGAGGGAGAGGGAGAGG + Intergenic
1031001272 7:116417953-116417975 GGGGAGGAAGGGAGATACAGAGG + Intronic
1031041160 7:116839771-116839793 GGGGAGGGAGGATGAGGAAGAGG + Intronic
1031248692 7:119351030-119351052 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1031264523 7:119566811-119566833 GGGGAGAGAGAGAGATGGAGGGG + Intergenic
1031448766 7:121887859-121887881 GGGGTGTTGGGGGGATGAAGAGG - Intronic
1031498338 7:122480140-122480162 GGGAAGAGAGTGAGCTGAAGGGG - Intronic
1031675459 7:124605971-124605993 GGAGGGGGAGGGAGATGGAGGGG - Intergenic
1032043084 7:128577719-128577741 GGGGGGAGAGGGAGAGGGAGAGG + Intergenic
1032184022 7:129707752-129707774 GGGGACTTAGAGAGGTGAAGTGG + Intronic
1032326561 7:130934614-130934636 AGGGAGAGAGGGAGAGGAAGAGG + Intergenic
1032519890 7:132535852-132535874 GGGGATTAATGGAGATGATGGGG - Intronic
1032573519 7:133027443-133027465 AGGGAGGGGGGGAGAGGAAGAGG + Intronic
1032666685 7:134043875-134043897 GGGGAATGAGGGAAAAGATGAGG - Intronic
1032858563 7:135857690-135857712 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1033169778 7:139073417-139073439 GTGGAGTGTGGTAGAGGAAGTGG - Intronic
1033323590 7:140361542-140361564 GGAGAGAGAGGGAGACGGAGAGG - Intronic
1034004365 7:147452931-147452953 TGGGAGGGAGGGAGAAGAAAGGG + Intronic
1034204466 7:149303758-149303780 GGGGAGAGAGGGAGAGAGAGTGG + Intergenic
1034534910 7:151720664-151720686 GGGGATGGAGGGGGATGGAGGGG + Intronic
1034534932 7:151720731-151720753 GGGGATGGAGGGGGATGAAGGGG + Intronic
1034679805 7:152920026-152920048 GAGGAGGGAGGCAGATGAAGGGG - Intergenic
1034957311 7:155343018-155343040 GGGGAGTGAGAAAGAAGTAGAGG - Intergenic
1035464407 7:159065266-159065288 GGGGAGGGAGGGAGATGGGCGGG - Intronic
1035708153 8:1692505-1692527 GGGGAGTGGAGGACAGGAAGAGG + Intronic
1035979081 8:4348626-4348648 GGGGAGAGGGGGAGAGGGAGGGG + Intronic
1036561699 8:9904439-9904461 GGGGAGGGAGGGAGGAGAGGCGG + Intergenic
1036762960 8:11524730-11524752 GGGGTGTGCGGCAGAAGAAGTGG + Intronic
1036763868 8:11533660-11533682 GGAGAGGGAGGGAGATGGGGAGG + Intronic
1036791909 8:11726617-11726639 GGGGAGTGGGGGCGGTGCAGAGG + Intronic
1037246143 8:16837172-16837194 AGGGACGGAGGGAGATAAAGGGG + Intergenic
1037469252 8:19191404-19191426 GGGGGGTGAGAGAGGGGAAGGGG - Intergenic
1037497028 8:19450171-19450193 GGAGAGTGAGGAAGAGGGAGAGG + Intronic
1037585598 8:20273909-20273931 GGGGAGGGGAGGAGAGGAAGTGG - Intronic
1037731237 8:21525504-21525526 GGGGAGGGTGGGTGATGCAGTGG - Intergenic
1037816878 8:22117055-22117077 GGGGAATGAGCGAGATGGGGAGG + Intronic
1037858507 8:22388551-22388573 GGGGAGGGGCGGTGATGAAGTGG + Intronic
1038213780 8:25543114-25543136 AGGGAGTGGGTGAGAAGAAGGGG - Intergenic
1038459514 8:27704022-27704044 GGGGAGAGAGGGCAAGGAAGAGG + Intergenic
1038594941 8:28880261-28880283 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1038928292 8:32165007-32165029 GGGGGGTGGGGGAGAGGGAGAGG - Intronic
1038960440 8:32512131-32512153 GGGGGATGAGGGGGATGGAGGGG + Intronic
1039270795 8:35877893-35877915 GGGGGGTGAGGGACATGACTTGG + Intergenic
1039538926 8:38345335-38345357 GGAGAGGGAGGGAGAGGAAGAGG + Intronic
1039745514 8:40422567-40422589 GGGAAGTGAGGCAGAAAAAGGGG + Intergenic
1039766838 8:40637519-40637541 AGAGAGAGAGGGAGATTAAGGGG + Intronic
1039949064 8:42153465-42153487 GGGGTGCGAGGGAGAGGCAGCGG - Intronic
1040661902 8:49583671-49583693 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1040815491 8:51504052-51504074 AGGGAGTGAGGGAGACAGAGGGG - Intronic
1040912282 8:52531380-52531402 AGGGAGTGAGTGAGATAGAGGGG - Intergenic
1040992417 8:53366921-53366943 GGAGAATGATGGAGATGAAATGG - Intergenic
1041042233 8:53858917-53858939 GGGGGGTGGGGCAGAGGAAGTGG + Intronic
1042493333 8:69427874-69427896 GGGGAGGGAGAGGGATGAATAGG - Intergenic
1042646998 8:70997968-70997990 GGGGAGTGGGGCAGAGGAGGTGG - Intergenic
1042687801 8:71461715-71461737 GGAGGGTGAGCAAGATGAAGAGG + Intronic
1042903773 8:73752865-73752887 GGTGAGTGGGGGAAATGAAGAGG + Intronic
1043148090 8:76681190-76681212 GGAGAGCGAGGGAGAGGGAGAGG - Intergenic
1043228918 8:77772980-77773002 GGTGAGTGAGGGTGATTAATGGG + Intergenic
1043318699 8:78953786-78953808 GTGGGGTGGGGGAGATTAAGAGG + Intergenic
1043846587 8:85170587-85170609 GTGGAGAGAGGGAGAACAAGGGG + Intergenic
1043980966 8:86638915-86638937 GGGGGGAAAGGGAGAGGAAGAGG - Intronic
1044015446 8:87044977-87044999 GGGTAATGAGGGAGAAGAAAAGG - Intronic
1044114930 8:88324368-88324390 GGGAAGTGGGGGATTTGAAGAGG - Intronic
1044223499 8:89698116-89698138 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1044223509 8:89698144-89698166 GGAGAGGGAGGGAGAGGGAGAGG - Intergenic
1044409617 8:91868685-91868707 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1044708566 8:95032710-95032732 TGGGAGTGAGGGAGCAGGAGAGG + Intronic
1044723121 8:95169519-95169541 GTGGGGTGAGGGAGAATAAGTGG + Intergenic
1044767930 8:95597099-95597121 GGGGAGGGAGGGAAGGGAAGGGG - Intergenic
1044825760 8:96195361-96195383 GGGTAGAGAGGGAAATGAGGTGG + Intergenic
1045055622 8:98365629-98365651 GGGGAGGGAGGGAGGGGAACAGG - Intergenic
1045056009 8:98369069-98369091 GGGAAGGGATGGAGATTAAGAGG - Intergenic
1045357932 8:101405773-101405795 AGGGAGAGAGGGAGATGAGAGGG - Intergenic
1045622675 8:104000188-104000210 GTAGAGAGAAGGAGATGAAGAGG - Intronic
1045695954 8:104809198-104809220 GGGGAGTGAGAGGGTTGTAGGGG - Intronic
1045938392 8:107710038-107710060 TGGGAGTGGGGGAGATGGAGGGG - Intergenic
1045962694 8:107987295-107987317 CAGAAGTGAGGGAGATGAATTGG - Intronic
1046134826 8:110011964-110011986 CAGGAGAGAGGGAGATGAAAGGG - Intergenic
1046348305 8:112967396-112967418 GGAGAGTAAGGTAGATGAGGTGG - Intronic
1047097653 8:121641487-121641509 GGGGGGTGAGGGAAGTGGAGAGG + Intergenic
1047191596 8:122683418-122683440 AGGGGGTGAGGGAGAAGCAGTGG + Intergenic
1047232907 8:123012457-123012479 AGGGAGAGAGGGAGAGAAAGAGG + Intergenic
1047273272 8:123383194-123383216 GGGGAGTGGGGGGCATGAGGAGG + Intronic
1047317534 8:123748172-123748194 GGGGAGGGAAGGAGATGAGAGGG + Intergenic
1047624778 8:126645496-126645518 GGAGAGGGAGGGAAATGAAGAGG - Intergenic
1047749644 8:127870522-127870544 GGGGATTGAGGGAAGTGGAGCGG + Intergenic
1047766706 8:127996081-127996103 GGTGAGTGTGGGAGAGGAATTGG - Intergenic
1047980821 8:130180047-130180069 AGGGAGGGAGGGAGGAGAAGGGG + Intronic
1048163035 8:132038356-132038378 GGGGAGGAAGGGAGAGGAGGAGG + Intronic
1048262423 8:132956333-132956355 GGGGAGTGGGTGATATAAAGAGG + Intronic
1048451070 8:134534545-134534567 TGGGAGAGAGGGAGAAGGAGAGG + Intronic
1048451233 8:134535496-134535518 GGAGAGGGAGGGAGAGGGAGGGG - Intronic
1048696280 8:137031685-137031707 TGGGAGGGAGGGAGAGAAAGGGG - Intergenic
1048822688 8:138394344-138394366 GGGGATTGAAGGAGATGATGTGG - Intronic
1048985247 8:139731490-139731512 AGGGAGTGAGGGAGAGGTTGGGG + Intronic
1049047665 8:140165587-140165609 GGGGAAGGAGGGAGGGGAAGGGG + Intronic
1049177590 8:141203162-141203184 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049177600 8:141203197-141203219 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049177640 8:141203495-141203517 AGGGAGAGAGGGAGAGGGAGAGG + Intergenic
1049272910 8:141705541-141705563 GGGGAGATGGGGAGATGAAGGGG + Intergenic
1049272971 8:141705856-141705878 GGGGAGATGGGGAGATGATGTGG + Intergenic
1049273015 8:141706085-141706107 GGGGAGATGGGGAGATGATGTGG + Intergenic
1049361197 8:142213205-142213227 GGGGAGAGAGGGAGGCGGAGGGG - Intronic
1049418408 8:142505906-142505928 GGGAGGTGGGGGAGGTGAAGCGG + Intronic
1049774176 8:144397060-144397082 GGGCTGTGAGGGAGATGGGGTGG + Intronic
1049826798 8:144674254-144674276 GGAGAGTGAGCGAGGTGGAGAGG + Intergenic
1050009214 9:1169149-1169171 GGGGAGAGAGAGAAAGGAAGTGG + Intergenic
1050130542 9:2407225-2407247 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1050149478 9:2605047-2605069 GGGGCGTCTGGGAGATGATGAGG + Intergenic
1050151534 9:2622697-2622719 GGGGAGTGCGGGAGCGGACGGGG + Intronic
1050214326 9:3305519-3305541 GGAAAGTGAGGGTGAGGAAGAGG + Intronic
1050315513 9:4397483-4397505 GGGGAGTCAGGGGGAAGCAGTGG - Intergenic
1050444749 9:5708174-5708196 AGGGAGAGAGGGAGATGTACGGG - Intronic
1050481308 9:6089886-6089908 GAAGAATGAGGGAGAAGAAGAGG - Intergenic
1050595167 9:7197737-7197759 GGGCAGTGAGTGAGAGGAAAAGG - Intergenic
1051257882 9:15233335-15233357 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1051261696 9:15271142-15271164 GGAGGGGGTGGGAGATGAAGGGG + Intronic
1051572685 9:18578302-18578324 AGGGAGAGAGGGAGAGAAAGGGG - Intronic
1051724822 9:20078302-20078324 GGGGAGTGGGGGTGGGGAAGTGG - Intergenic
1051943030 9:22531357-22531379 AGGGAGTGAGGGAGATGTAGAGG + Intergenic
1052271387 9:26631666-26631688 GAAGAGTAAGGGAGAGGAAGAGG + Intergenic
1052316733 9:27123183-27123205 GGGAAGGGAGGGAGATGGGGCGG + Intronic
1052319744 9:27155153-27155175 TGTGAGTGTGAGAGATGAAGTGG + Intronic
1052436012 9:28430064-28430086 GGGGAGTCAGGGAGAGGGAGAGG + Intronic
1052493016 9:29190026-29190048 GGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1052855453 9:33403639-33403661 GGTGAGGCAGGGAGAGGAAGGGG + Intergenic
1052918214 9:33940035-33940057 GGGAAGAGAGGGAGAGGGAGAGG + Intronic
1052996912 9:34555963-34555985 GGTGAGGGAGGGAGATGGCGGGG - Intronic
1053168279 9:35859972-35859994 GGAGAGAGAATGAGATGAAGTGG - Intergenic
1053562426 9:39210075-39210097 TGGGAGTGAGGGCGATGATCAGG - Intronic
1053683467 9:40499982-40500004 GGTGAGGCAGGGAGAGGAAGGGG + Intergenic
1053828232 9:42048067-42048089 TGGGAGTGAGGGCGATGATCAGG - Intronic
1053933446 9:43128297-43128319 GGTGAGGCAGGGAGAGGAAGGGG + Intergenic
1054134725 9:61408964-61408986 TGGGAGTGAGGGCGATGATCAGG + Intergenic
1054280248 9:63124946-63124968 GGTGAGGCAGGGAGAGGAAGGGG - Intergenic
1054296571 9:63335480-63335502 GGTGAGGCAGGGAGAGGAAGGGG + Intergenic
1054394588 9:64639985-64640007 GGTGAGGCAGGGAGAGGAAGGGG + Intergenic
1054429237 9:65145184-65145206 GGTGAGGCAGGGAGAGGAAGGGG + Intergenic
1054501147 9:65876351-65876373 GGTGAGGCAGGGAGAGGAAGGGG - Intergenic
1054602327 9:67139387-67139409 TGGGAGTGAGGGCGATGATCAGG + Intergenic
1054825802 9:69572400-69572422 TAGGAGTGAGGGAGATGCAGGGG - Intronic
1055515706 9:77031141-77031163 AGGGAGGGAGGGAGGGGAAGAGG - Intergenic
1055972056 9:81921336-81921358 GTTGAGTGAGGGAGCTGTAGTGG - Intergenic
1055973809 9:81936408-81936430 GTTGAGTGAGGGAGCTGTAGTGG - Intergenic
1056127358 9:83548572-83548594 GGAGAGTGGGTGAGATGAATAGG + Intergenic
1056704830 9:88943185-88943207 GAGGAGAGAGAGAGATGGAGAGG - Intergenic
1056768933 9:89462973-89462995 GGGGAGCGAGGGAGAAAGAGAGG + Intronic
1056928356 9:90853978-90854000 GGAGAGGGAGGGAAGTGAAGCGG + Intronic
1057125920 9:92616096-92616118 CGGGAGGGAGGGAAATGAATGGG - Exonic
1057181548 9:93033353-93033375 GAGGAAGGAGGGAGAGGAAGAGG - Intronic
1057195908 9:93115587-93115609 AGGGAGTGAGGGAGAAGGTGAGG + Intergenic
1057195943 9:93115688-93115710 GAGGAGTGAGGGAGGGGATGAGG + Intergenic
1057271206 9:93652662-93652684 GGGAAGATAGGGAGATGCAGAGG - Intronic
1057497995 9:95575293-95575315 GGGGAGGGAGTGAGGAGAAGAGG + Intergenic
1057545771 9:96019848-96019870 GGGTGGTGAGAGAGAGGAAGGGG + Intergenic
1057700555 9:97360649-97360671 GCGGAGTGAGAGGGATGAAGAGG - Intronic
1057716348 9:97498882-97498904 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1057768037 9:97940824-97940846 AGGGAGTGAGGGCGATTATGGGG - Intronic
1057813718 9:98278599-98278621 GGGCAGGGAGGGAGGTGATGAGG + Intergenic
1057898823 9:98931711-98931733 AGGCAGTGAGGCAGATAAAGGGG + Intergenic
1058416533 9:104794542-104794564 GGAGGGTGAGGGAGAAGAAACGG + Intronic
1058433399 9:104939541-104939563 GGGGAGCGAGAGAGAGAAAGAGG - Intergenic
1058598813 9:106646598-106646620 TGGGAGAGAGGAAGAGGAAGAGG - Intergenic
1058628976 9:106966493-106966515 TGGGAGTGAGAGAGATGGAGAGG - Intronic
1058944326 9:109841953-109841975 GGAGGGTGAGGGGGATGGAGGGG + Intronic
1058985832 9:110207730-110207752 GGGGAAGGAGAAAGATGAAGGGG + Exonic
1059401281 9:114071985-114072007 GTAGGGTGAGCGAGATGAAGGGG - Intronic
1059493517 9:114690182-114690204 GGGGAGGGAGGGGGAGGGAGAGG - Intergenic
1059499321 9:114737532-114737554 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1059611632 9:115903469-115903491 GTGGAGTTGGGGAGATCAAGTGG - Intergenic
1059987912 9:119837880-119837902 GGAGAGTGATGGATATGAATGGG - Intergenic
1059996994 9:119920689-119920711 GTGGAGAGAGGGAGAAGAATGGG - Intergenic
1060208582 9:121697137-121697159 GTGGAGTGGGGAAGAGGAAGTGG + Intronic
1060278808 9:122202135-122202157 GGGCAGGGAGGGAGGTGCAGAGG - Intergenic
1060404891 9:123368299-123368321 GGCGAGTGAGAGAGGGGAAGAGG - Intronic
1060625395 9:125107815-125107837 GTGGGGAGAGGGAGATGGAGAGG - Intronic
1060919256 9:127408959-127408981 GGGAGGTGGGGGAGATGATGGGG + Intergenic
1060919454 9:127409505-127409527 GGGAAGTGGGGGAGGTGATGGGG + Intergenic
1061195693 9:129106075-129106097 GGGGAGTGCGTGTGATGAAGAGG - Intronic
1061777915 9:132978098-132978120 GGGGAGGGAGGGAGGGGAGGAGG + Intronic
1061898239 9:133659594-133659616 GGGGAGAGAGGGAGATGGATGGG + Intergenic
1061900043 9:133668324-133668346 GGAGAATGAGGGAGAGGGAGAGG - Intronic
1061916210 9:133755768-133755790 GGTGAGTGAGAAAGATGGAGAGG + Intergenic
1061956137 9:133962159-133962181 GGGCACAGAGGGGGATGAAGGGG + Intronic
1062151962 9:135024249-135024271 GGGGAGAGAGGAAGCTGAAGAGG + Intergenic
1062264656 9:135681441-135681463 GGGTAGTGAGGGCACTGAAGGGG + Intergenic
1062324643 9:136006148-136006170 GGCAGGTGAGGCAGATGAAGGGG + Intergenic
1062326282 9:136014046-136014068 GGGGAGGGGGGGAGGTGGAGGGG + Intronic
1062350907 9:136138294-136138316 GGGGAGGGAGGGGGAGGGAGGGG - Intergenic
1062510329 9:136901866-136901888 GGGGAGTGGGCGAGGAGAAGAGG - Intronic
1062582273 9:137233965-137233987 GGGGAGTGTGGGGGGTGTAGGGG - Intronic
1062627711 9:137450721-137450743 GGCGAGGGGGGGAGATCAAGAGG - Intronic
1062744699 9:138203740-138203762 AAGGAGTGGGGGAGATGGAGGGG + Intergenic
1203745417 Un_GL000218v1:38436-38458 GAGGAGTTGGGGAGATGCAGAGG + Intergenic
1203564691 Un_KI270744v1:81048-81070 GAGGAGTTGGGGAGATGCAGAGG - Intergenic
1203634567 Un_KI270750v1:98022-98044 GGGGAAAGAGGGAGAGGGAGAGG + Intergenic
1185598885 X:1325447-1325469 GGGGAGAGAGGGAGGTGGGGAGG + Intergenic
1185707196 X:2276706-2276728 GGAGAGTGATGGGGATGAAAGGG + Intronic
1185942750 X:4339478-4339500 GGGGAATGGGGGAGGTGAACTGG - Intergenic
1186047311 X:5550427-5550449 AGGGAGAGAGAGAGAGGAAGAGG - Intergenic
1186139203 X:6553288-6553310 GGGGAGAGAGGGAGGTGCAAGGG + Intergenic
1186245319 X:7610308-7610330 GTGGAGAGAGGGAGAGGGAGAGG + Intergenic
1186246615 X:7622475-7622497 GGGGATGGAGGGAGAGGAAGAGG - Intergenic
1186256682 X:7729387-7729409 GGGGAGCAAGTGAGATCAAGTGG - Intergenic
1186389819 X:9147926-9147948 GGTGGGGGAGGGAGATGAAGCGG - Intronic
1186424826 X:9455647-9455669 AGGGAGGGAGGGAGAAGGAGGGG - Intergenic
1187042699 X:15613551-15613573 GGTTAGTGAGGGAGATGTGGGGG + Intergenic
1187058735 X:15765622-15765644 GGGGAGTGAGGGATATGGAGGGG - Intronic
1187225040 X:17367594-17367616 GGGGATGGGGGGAGATGAAAAGG + Intergenic
1188400051 X:29733034-29733056 AGGGAGGGAGGCAGAGGAAGAGG + Intronic
1188526713 X:31095256-31095278 GGGGAGGGAGGGTAAAGAAGAGG + Intergenic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1189083639 X:37998152-37998174 GGAGGGTGAGAAAGATGAAGGGG - Intronic
1189354153 X:40298798-40298820 GGGGAGTCAGGGACAGGGAGAGG - Intergenic
1189365087 X:40381773-40381795 AGGGAGGTAGGGAGATGAATAGG - Intergenic
1189587445 X:42474988-42475010 GGAGAGGGAGGGAGAGGGAGAGG + Intergenic
1190438260 X:50449259-50449281 GAGGAGTGAGGGAGGAGATGAGG - Intronic
1190465684 X:50723320-50723342 GGGGAGGGAGGGGGAGGAGGGGG + Intronic
1190526611 X:51334446-51334468 TGGGAGTCAGGGAGGTTAAGCGG - Intronic
1190636989 X:52444874-52444896 GGGAAGGGTGGGAGATGAACAGG - Intergenic
1190737776 X:53267024-53267046 GGAGACTGAGGAAGAGGAAGAGG - Intronic
1190778787 X:53577510-53577532 GGAGAGGGAGGGAGAGGGAGAGG - Intronic
1190793459 X:53721144-53721166 GGAGAGAGAGGGAGAGGGAGAGG - Intergenic
1190914651 X:54802152-54802174 GGGGTGGGAGGGAGATGGGGAGG + Intergenic
1190966633 X:55307440-55307462 GGAGAGTGGGGGCCATGAAGGGG + Intergenic
1191640819 X:63428660-63428682 GGTGTGTGAGGCTGATGAAGGGG + Intergenic
1191803318 X:65105252-65105274 GGGGGGTGGGGGACAAGAAGAGG + Intergenic
1191894353 X:65976033-65976055 GGAGAGAGAGGGAGAGGGAGAGG + Intergenic
1191961878 X:66712483-66712505 GGGCAGTGAGGGAAATCATGAGG + Intergenic
1192042238 X:67635005-67635027 GGGGAGGGAGGGAGAGAGAGGGG - Intronic
1192103166 X:68287189-68287211 AGGGAGGGAGGGAGGAGAAGGGG + Intronic
1192194562 X:69019567-69019589 GGGGAGTGATGGAGACAAATTGG - Intergenic
1192225975 X:69228248-69228270 GGGGAGTGGGGGTTATAAAGGGG - Intergenic
1192252934 X:69428380-69428402 GGGGAGAGTGGGAGGTGATGAGG - Intergenic
1192267252 X:69547280-69547302 GGAGAGTGAGTAAGATGAAGAGG - Intergenic
1192373373 X:70534336-70534358 TGGGAGTGAGGGAGGTGCTGAGG + Intronic
1192456821 X:71283240-71283262 GTGGAAAGAGGGAGAGGAAGGGG - Intronic
1192610087 X:72559078-72559100 GGAGAGAGAGGGAGAGGGAGAGG - Intronic
1193092944 X:77513561-77513583 GGGGAATGAGTGAGTTGAAGTGG + Intronic
1193345440 X:80397950-80397972 GGCGAGGGAGGGAGAGGGAGAGG + Intronic
1193468688 X:81874971-81874993 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1193776828 X:85652790-85652812 GGGGGGTGAGGGAGATAAGGAGG - Intergenic
1195179011 X:102338996-102339018 GGAGGGTGAGCAAGATGAAGAGG + Intergenic
1195273687 X:103257446-103257468 GGGCAGAGAAGGAGATGATGAGG - Intergenic
1195299110 X:103509555-103509577 AAGGAGGGAGGGAGAGGAAGAGG - Intronic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1195715430 X:107813582-107813604 GGTGAGTGAGAGAGGTGAGGGGG + Intergenic
1195803674 X:108737978-108738000 GGGGAGAGAGGGAGAGGGAGAGG - Intergenic
1195970015 X:110462867-110462889 GGGAAGGGAGGAAGAGGAAGAGG + Intergenic
1196264235 X:113623164-113623186 GTGGGGAGAGGGAGATAAAGAGG - Intergenic
1196814274 X:119652739-119652761 AGGGAATGAGGGAGAGGATGAGG + Intronic
1197735713 X:129849681-129849703 GGGGGGAGAGGGAGAGGGAGAGG - Intergenic
1197735722 X:129849702-129849724 GGGGGGAGAGGGAGAGGGAGAGG - Intergenic
1197735731 X:129849723-129849745 GGGGGGAGAGGGAGAGGGAGAGG - Intergenic
1198242026 X:134796591-134796613 GGGGGGAAAGGGAGAGGAAGGGG + Intronic
1198343706 X:135739687-135739709 GGGGAGTGGGGGAGTGGAACAGG - Intergenic
1198874227 X:141205558-141205580 GGGGAGAGAGTGAAATGAATAGG + Intergenic
1199093902 X:143718908-143718930 AGGCAGTGAGGCTGATGAAGGGG - Intronic
1199430508 X:147754137-147754159 GGGGAGTGAGTGACATGATCTGG - Intergenic
1199596333 X:149509219-149509241 AGGGAGAGAGGGAGAGGGAGAGG - Intronic
1199614847 X:149648184-149648206 GGAGGGTGAGCAAGATGAAGAGG - Intergenic
1199895117 X:152119931-152119953 GGGGAATGGGGGTGATGATGGGG + Intergenic
1199953473 X:152723851-152723873 GGGGCGTGAGGGAGATGGTGAGG + Intergenic
1199956209 X:152744599-152744621 GGGGCGTGAGGGAGATGGTGAGG - Intergenic
1200064134 X:153496689-153496711 GGGGAGTCTGGGAAAGGAAGGGG + Intronic
1200134798 X:153869735-153869757 GGGCTGTGGGGGAGAGGAAGAGG - Intronic
1200202977 X:154295358-154295380 GGGGAGGGAGGGAGCTGCTGTGG - Intronic
1200822563 Y:7601987-7602009 GGGTACAGAGGGAGATGGAGAGG - Intergenic
1201146069 Y:11066403-11066425 GGGGAGAGAGGGAAAGGGAGAGG + Intergenic
1201146116 Y:11066549-11066571 AGGAAGTGAGGGAGAGGGAGGGG + Intergenic
1201146170 Y:11066710-11066732 AGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1201146500 Y:11067777-11067799 GGGGAGGGAGGGAGAGGGAGAGG + Intergenic
1201158737 Y:11153447-11153469 GAGGAGTTGGGGAGATGCAGAGG + Intergenic
1201228918 Y:11844955-11844977 GGGGAATGAGTGAGTTGAACTGG + Intergenic
1201328988 Y:12798074-12798096 AGGGAGAGAGGGAGGGGAAGGGG - Intronic
1201515660 Y:14816684-14816706 GTGGAGAATGGGAGATGAAGGGG - Intronic
1202088937 Y:21168438-21168460 AGGGAGAGAGGGAGAGAAAGAGG + Intergenic