ID: 1094043383

View in Genome Browser
Species Human (GRCh38)
Location 12:26141263-26141285
Sequence CTGTGTTTGGGGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 1, 1: 2, 2: 5, 3: 146, 4: 1079}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094043377_1094043383 -4 Left 1094043377 12:26141244-26141266 CCAGGTAGATGCAGCACTACTGT 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG 0: 1
1: 2
2: 5
3: 146
4: 1079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094043383 Original CRISPR CTGTGTTTGGGGATGGAGGA AGG Intronic
900387259 1:2416348-2416370 ATGGGTTTGGGGATTGAGGAAGG + Intergenic
900578766 1:3397353-3397375 CTGTACTTGGGTGTGGAGGAAGG - Intronic
900670011 1:3846286-3846308 CAGTGGTTGGGGGTGCAGGATGG - Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900895348 1:5479362-5479384 CTGCCTGTGGGGATGCAGGAAGG + Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901386176 1:8910766-8910788 GTGTGGTGGGGGATGGAGGGGGG + Intergenic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902723543 1:18320648-18320670 CTGTCTTTTGGGATGGACCAGGG - Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903056441 1:20639439-20639461 TTGTCGTGGGGGATGGAGGAAGG + Intronic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903236971 1:21956545-21956567 CTGTGCTTGGGGTTGGGGAAGGG - Intergenic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903281486 1:22252508-22252530 CTGGGCTGGGGGCTGGAGGAGGG + Intergenic
903633365 1:24795024-24795046 CTGTACTTGAGGGTGGAGGATGG + Intronic
903665548 1:25005273-25005295 CAGTGTTTGGGAATGAATGAAGG - Intergenic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904194552 1:28775348-28775370 CCGTGCCTGCGGATGGAGGAGGG + Intergenic
904404252 1:30275620-30275642 GTGTTTGTGGGAATGGAGGAGGG - Intergenic
904417323 1:30371305-30371327 ATGTGTTTGAGAATGGAGTACGG + Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905369730 1:37476647-37476669 CTGTGCTGGGGGATGGGGGTGGG - Intronic
905856126 1:41315492-41315514 CTGTGCTTGGAGGTGGAGGTGGG - Intergenic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
907440527 1:54475562-54475584 CCGGGTTTGGGCATGGGGGAGGG + Intergenic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908321075 1:62979484-62979506 CTACCTTAGGGGATGGAGGATGG - Intergenic
908543835 1:65146500-65146522 CTTTGATTGGGGTTGGTGGAGGG - Intergenic
908629131 1:66082967-66082989 TTGTGATTGGCTATGGAGGAGGG - Intronic
908871891 1:68622622-68622644 CTGAGTTTGAAGATAGAGGAAGG - Intergenic
909349174 1:74629575-74629597 CTGTAGCTGGGCATGGAGGAGGG - Intronic
909614059 1:77587144-77587166 GTGTTGCTGGGGATGGAGGATGG + Intronic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910205170 1:84742531-84742553 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910366837 1:86474970-86474992 GTGTGTTTGGGGATGGGGCTTGG - Intronic
910400438 1:86832705-86832727 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
911073994 1:93855336-93855358 GTGGGTTTGGGGATGGGGGATGG + Intergenic
911150686 1:94594723-94594745 CAGAGTTTGGGAAAGGAGGAAGG - Intergenic
911305931 1:96232397-96232419 GTTTGTTTGAGTATGGAGGAAGG + Intergenic
911351233 1:96758359-96758381 CTGTCTTTGAAAATGGAGGAGGG + Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912760215 1:112359773-112359795 CTGTATTTGGGCAGAGAGGAGGG - Intergenic
913223999 1:116682665-116682687 CTGAGCTTGAGGATGGGGGAGGG + Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
913588475 1:120299683-120299705 ATGTGTTGGGGGGTGAAGGAGGG - Intergenic
913619710 1:120598686-120598708 ATGTGTTGGGGGGTGAAGGAGGG + Intergenic
914050115 1:144124457-144124479 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
914129067 1:144840994-144841016 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
914570493 1:148911555-148911577 ATGTGTTGGGGGGTGAAGGAGGG - Intronic
914602337 1:149218714-149218736 ATGTGTTGGGGGGTGAAGGAGGG + Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915354618 1:155248576-155248598 CTTTGATTGGGGATGGAGCGTGG - Intronic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916030682 1:160875243-160875265 CTGTGTTTCAGGATAGAGAATGG + Intergenic
916267045 1:162901009-162901031 CTGGCTTTGGAGATGGAGAAAGG - Intergenic
916439770 1:164812161-164812183 CTTTGATTGGGGGTGGGGGAAGG + Intronic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916777712 1:167985412-167985434 CTGGGTTTGAAGATAGAGGAAGG - Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917436761 1:175029960-175029982 CTGTGTGTGGGAACCGAGGATGG - Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917845599 1:179017503-179017525 CTGTGTTTGCGTATGGAGGAAGG + Intergenic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918092889 1:181312741-181312763 CAGGGTTTGGGCATGTAGGAAGG + Intergenic
918245731 1:182657505-182657527 CTGGGCTTGGGGAGGGAGCAGGG - Intronic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918391269 1:184065518-184065540 ATGTGTTTGGGGGTGAAGAAAGG - Intronic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
918808972 1:189091505-189091527 TGGTGTTAGGGGATGGGGGAGGG - Intergenic
918923587 1:190749195-190749217 CTGTGTTTGCCAATGTAGGATGG - Intergenic
919946191 1:202320506-202320528 GTGTGTTTGGGGCTGGGTGAGGG - Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920047105 1:203140426-203140448 CTGTTTCTGGGGATGGGGAAGGG + Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920219236 1:204384271-204384293 CTGTATTTGGGCTTAGAGGAAGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920577573 1:207072742-207072764 AAGTGTTGGGGGATGGAGGGCGG + Exonic
921147990 1:212377696-212377718 CCCTGTTTGGGCTTGGAGGAAGG + Exonic
921868703 1:220113561-220113583 CTTATTTTGGGAATGGAGGAAGG + Intronic
921971221 1:221151289-221151311 CTGGCTTTGAGAATGGAGGAAGG - Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922765571 1:228154903-228154925 CTGTGATTGGGAGTGGAGGTAGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923697749 1:236270850-236270872 CTGGGGTAGGGGATGGATGATGG + Intronic
923748190 1:236722933-236722955 CTGGATTTGGGGTTGGAGGAGGG + Intronic
923812754 1:237338039-237338061 CTGGCTTTGAGGGTGGAGGATGG - Intronic
924583377 1:245341049-245341071 CTGGGATTGGGAAAGGAGGATGG - Intronic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1062810384 10:459193-459215 GTCTGTTTGGGGGTGGGGGAGGG - Intronic
1062815745 10:498703-498725 TTGTACTTGGGGATGGAGGTTGG - Intronic
1063131471 10:3181546-3181568 CCGTATCAGGGGATGGAGGAAGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063578182 10:7280739-7280761 TGGTGCTTGGGGAAGGAGGAGGG - Intronic
1063608026 10:7540036-7540058 AAGTTTTTGGGGATGGAGGGAGG - Intergenic
1063608350 10:7542214-7542236 CTCTGTTTTGGGAAGTAGGACGG - Intergenic
1063726507 10:8643005-8643027 CTGAGTTTTGGGTTGGATGAAGG - Intergenic
1063874694 10:10461835-10461857 CTTTTTTTGGGGATGGTGGGAGG - Intergenic
1065698355 10:28401164-28401186 CTGGCCTTGGAGATGGAGGAAGG - Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067172867 10:43922293-43922315 CCGTGTTTGGGGAGGAAGGGAGG - Intergenic
1067189712 10:44059221-44059243 TTGAGTTTGGGGATGTAGTAGGG + Intergenic
1067454250 10:46404938-46404960 CTGCCTTTGAGGATGGAGGAAGG - Intergenic
1067552641 10:47246319-47246341 CTGTGTTTGGGAAGGGAGCTGGG + Intergenic
1067632953 10:47979694-47979716 CTGCCTTTGAGGATGGAGGAAGG + Intergenic
1068067261 10:52147606-52147628 TTGTGTTTGGGGAAAGAGTAGGG + Intronic
1068576939 10:58694710-58694732 ATGTGTTTGGGGGTGGTGGTGGG + Intronic
1068831584 10:61501775-61501797 CTCTTTTTGGGGAAGGATGATGG + Intergenic
1068981348 10:63065826-63065848 TTGAGTTTGGGGATGGGGGGAGG - Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1069332663 10:67311460-67311482 CTGTGGCTGGGGATTGAGAAGGG + Intronic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1069562676 10:69441818-69441840 GTGTGTTTGGGGGTGGAAGTGGG - Intergenic
1069630845 10:69896236-69896258 CTGTGTCTTGGGGTGGAGCAAGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071355530 10:84789847-84789869 CTGGATTTGGGCTTGGAGGAGGG + Intergenic
1071976051 10:90956477-90956499 CTGGCTTTGAGGATGGAAGAAGG + Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072219112 10:93312804-93312826 ATGTGTTTGGAGTTGGAGGAAGG - Intronic
1072427712 10:95343985-95344007 CTGTGGTTGGGGATGAAGGGAGG - Intronic
1072748570 10:97959521-97959543 CTGAGTTTTGGGTTGGATGAAGG + Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1074119296 10:110481529-110481551 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
1074150334 10:110753846-110753868 CTGTCTTTGAGGATGGAGAAGGG - Intronic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074179885 10:111050375-111050397 CTGTCTTGGGGGTTGCAGGATGG + Intergenic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074538011 10:114342620-114342642 TTGGCTTTGGGGATGGAGGAAGG + Intronic
1074910968 10:117908486-117908508 CTGCTTATGGGGAGGGAGGAAGG - Intergenic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075223603 10:120605126-120605148 GGGTGTTTGGGGATGGAGGGTGG + Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076550500 10:131274857-131274879 CTGGGATTGTGGATGGAGGCAGG - Intronic
1076612556 10:131735802-131735824 CTGGCTTTGAGGATGGAGGGCGG + Intergenic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078512679 11:11997330-11997352 CTGTGTTTGGGGTTTGATGAAGG - Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078653882 11:13220439-13220461 CTATGTTTGGGGGTGGGGAAAGG - Intergenic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1078920705 11:15827433-15827455 GTATGTTTGGGAATGGAGGAAGG - Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079446581 11:20562245-20562267 CTGTGCTTGGGGCAGGAGGTTGG - Intergenic
1079579840 11:22050271-22050293 CTGTGGTTGGGAGTGGGGGAGGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080286528 11:30620551-30620573 TTCTTTTTGGGGATGGAGGCAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1081084868 11:38787237-38787259 TTGTGTTTGGGAGTGGAGGCAGG - Intergenic
1081337754 11:41887716-41887738 TGGGGTTTGGGGATGGGGGAGGG + Intergenic
1081492936 11:43581202-43581224 CTGAGTTGGGGGATCGCGGACGG + Intronic
1081950762 11:47040670-47040692 CTTTGTTTTGGGTTGGATGAAGG - Intronic
1082737946 11:56877119-56877141 CTGTTGCTGGGGATGGAGGGTGG - Intergenic
1082766789 11:57175172-57175194 CTAGCTTTGGAGATGGAGGAAGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1084447438 11:69212097-69212119 TTGGGTTGGGGGACGGAGGAGGG - Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084603679 11:70160792-70160814 CTGTGCTTGGGGATGGTGCCTGG + Intronic
1084702369 11:70795796-70795818 CTGGCTTTGGAGACGGAGGAAGG + Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1084941435 11:72615334-72615356 CTAGGTTTGGGGGTGGATGAAGG + Intronic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086878686 11:92128843-92128865 CTGAGATTGGGGGTGTAGGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087118710 11:94550381-94550403 GTGTGTGTGGTGTTGGAGGAGGG - Intronic
1087308219 11:96508322-96508344 GTGTGTTTGGGGGTGGGGGTGGG + Intergenic
1087433060 11:98078107-98078129 CATTGTTTGGGGATGGAGGGCGG - Intergenic
1087463389 11:98473178-98473200 CTGGCTTTGATGATGGAGGAAGG - Intergenic
1087901735 11:103649102-103649124 AGGTGCTTGGGGAGGGAGGAAGG + Intergenic
1088392566 11:109330954-109330976 GGGGGTTTGGGGATAGAGGAGGG + Intergenic
1088559738 11:111101248-111101270 CTGGCTTTGGGGATGGAGAGAGG + Intergenic
1088706075 11:112465871-112465893 TTGTGTTTGTAGATGGAGCAAGG + Intergenic
1088795294 11:113262277-113262299 CTGTGCTTAGGGATTGGGGATGG - Intronic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1088998672 11:115029372-115029394 CTGTCTTTAAGGATAGAGGAAGG + Intergenic
1089173500 11:116532462-116532484 CTATATCTGGGGATGGGGGAAGG + Intergenic
1089272891 11:117314462-117314484 GTGTGTTTGGGGTGGGCGGAGGG - Intronic
1089307585 11:117536294-117536316 CGCTGTTTGGGGATGGAGACGGG + Intronic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089787757 11:120920370-120920392 ATGTGTTTGGGGACCGAGGTGGG - Intronic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1090034231 11:123234528-123234550 CTGTGTGTGGTTATGGGGGATGG - Intergenic
1090075040 11:123575229-123575251 CTGGGTTTGGGGAAGGATGAAGG + Intronic
1090078035 11:123591691-123591713 CCGCCTTTGGGGGTGGAGGAGGG + Intronic
1090137227 11:124210495-124210517 CTGTGGTTGGAGATGGAGTGTGG - Intergenic
1090172621 11:124617990-124618012 ATGTGTTGGGGGATGGGGGTAGG + Intronic
1090513882 11:127404027-127404049 ATGTGTTTAGGGGTGGAGGGAGG - Intergenic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1090849290 11:130557832-130557854 TTGTGTTTGTTGATGGAGGTTGG + Intergenic
1091312142 11:134582163-134582185 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1091398647 12:169759-169781 CTTTATTTGGGGCTGGTGGAGGG - Intronic
1091725821 12:2845792-2845814 TCGTGTGTGGGGATGGAGTAAGG + Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091868770 12:3869041-3869063 CTGACTTTGGAGATGAAGGAAGG - Intronic
1092001576 12:5036988-5037010 CTGGCTTTGATGATGGAGGAGGG + Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092990763 12:13896693-13896715 ATGTGTTGGGGGATTGGGGAGGG + Intronic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093423291 12:18999377-18999399 CTGTGTTTGGTGTTGGAGTTTGG + Intergenic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1093496365 12:19762735-19762757 CTGGCTTTGGAGATAGAGGAAGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094241395 12:28229819-28229841 CTGTGTTTGTGGCTAGAAGAAGG + Intronic
1095580007 12:43786951-43786973 CTGTGTTTGGTGATGCTTGAAGG - Exonic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1096729709 12:53598605-53598627 CTGTGTTTTGGACTGGAGGTAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097589536 12:61557284-61557306 CTGGCTTTGGAGATGGATGAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1098396945 12:70029048-70029070 ATGTGTTTGGGGATGGGGTTAGG + Intergenic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1100042011 12:90331372-90331394 CAGTGTTTGTATATGGAGGAGGG + Intergenic
1100219829 12:92492981-92493003 CTGTGTTGGGGTTGGGAGGAGGG + Intergenic
1100297908 12:93279849-93279871 CTTTGTTGGGGGATGGAACATGG - Intergenic
1100326010 12:93540414-93540436 CTGGCTTTGAGGTTGGAGGAAGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1101211501 12:102539373-102539395 CTCTGGCTGGGGATGGAGAATGG + Intergenic
1101523223 12:105504109-105504131 CTGGCTTTGGGCATGGAAGAAGG + Intergenic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1102053219 12:109878422-109878444 CTGAGTTGGGGGATGGGGCACGG - Intronic
1102088009 12:110159823-110159845 ATGTGTTTGGGGCTGGAGGTGGG + Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102548753 12:113675459-113675481 CTGCATCTGGGGCTGGAGGAGGG - Intergenic
1102562252 12:113770471-113770493 CAGTGCTTGGGGAAGGAGTAGGG - Intergenic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103288329 12:119822051-119822073 TTGTTTTTGGTGATGGAGGGAGG - Intronic
1103746057 12:123124711-123124733 CCGGGTTGGGGGATGGGGGAGGG - Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1103951354 12:124553155-124553177 CTGGCTTTGAGGATGGAGAAGGG - Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104315844 12:127700204-127700226 CTGTGTTTGGTGATGGGGTGCGG - Intergenic
1104539713 12:129652579-129652601 CTGGGTTTTAGGATGCAGGAAGG + Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104564937 12:129872092-129872114 CTGTGATTGAGGTTGGTGGAAGG - Intronic
1104873672 12:132018051-132018073 CTGTGTATTGGCACGGAGGAGGG + Intronic
1105005235 12:132717334-132717356 GGGTGTTTGAGGGTGGAGGAGGG + Intronic
1105005249 12:132717378-132717400 GGGTGTTTGAGGGTGGAGGAGGG + Intronic
1105628171 13:22134241-22134263 CTAAATTTGGGGATGGAGAATGG + Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1106006590 13:25775716-25775738 CTATGTTTGTCTATGGAGGAAGG + Intronic
1106259747 13:28056069-28056091 CTGGGGTTGGGGGTGGAGTAAGG - Intronic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106735373 13:32583674-32583696 CTGGCTTTGCGGATGGAGGAAGG + Intergenic
1106754497 13:32809370-32809392 CTGGCTTGGAGGATGGAGGAAGG - Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1109800924 13:67377711-67377733 CTGTGTGTGGGAGTGGGGGAGGG - Intergenic
1109973433 13:69800139-69800161 CTGACTTTGGGGATAGAAGATGG - Intronic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110499696 13:76212868-76212890 CTGTTTTTGTGGATGAAGAATGG - Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1111819596 13:93196280-93196302 CTGTGTTTTGAGATGGATGAAGG - Intergenic
1112182465 13:97097711-97097733 CTCTATTTGAGGGTGGAGGATGG - Intergenic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113109102 13:106802843-106802865 GTGTGTTGGGGGGTGGAGGCGGG + Intergenic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113531654 13:111031950-111031972 CTCAGCTTGAGGATGGAGGAAGG + Intergenic
1113747266 13:112754062-112754084 CAGTGTTTTGGGATTGAGGAGGG + Intronic
1113966349 13:114155677-114155699 CTGAGTGTGGGGGTGGAGGGTGG + Intergenic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114280971 14:21192325-21192347 CTGCGTGTGGGGTTGGGGGAGGG - Intergenic
1114483981 14:23052395-23052417 CTGGGTGTGGGGGTGGAGAAGGG - Intronic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1115156131 14:30341262-30341284 CTTTGTTTGGGGTTGGATGAAGG - Intergenic
1115495710 14:34002418-34002440 CTGGCTTTGACGATGGAGGAAGG + Intronic
1115872093 14:37816272-37816294 CTGTTATTGGGGGTGGAAGAGGG - Intronic
1116029102 14:39549546-39549568 TTTTGGTGGGGGATGGAGGATGG + Intergenic
1116502678 14:45639361-45639383 CTGGGGTTGGGGTTGGAGGACGG + Intergenic
1116625934 14:47263321-47263343 AGGCTTTTGGGGATGGAGGATGG - Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1116739739 14:48739272-48739294 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
1117010255 14:51463815-51463837 CTGTTTTTGGGGGTGATGGAGGG + Intergenic
1117336782 14:54762747-54762769 CAGGGTTTGGGGTTGGGGGAGGG - Intronic
1117380384 14:55156288-55156310 CTGTTTTTGGTGATGGGGGTGGG - Intronic
1117411877 14:55457334-55457356 TTGGGGTTGGGGGTGGAGGAGGG + Intergenic
1117645452 14:57846854-57846876 GTCTGTTTGGAGATTGAGGAGGG - Intronic
1117722342 14:58639219-58639241 CTGTGATTGGTGGTGGAGGTGGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118759336 14:68869894-68869916 CTCAGTTTGGGGATGAAGTAAGG + Intergenic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1119085080 14:71731933-71731955 ATGTGTTTGGGGGATGAGGAAGG + Intronic
1119145932 14:72314176-72314198 CTGTGTTCGGGGTTGGAAGTTGG + Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119733501 14:76966105-76966127 GTGTGTGTTGGGGTGGAGGATGG + Intergenic
1119739373 14:77004214-77004236 CTGAGTTGGGGGTTGGGGGAAGG + Intergenic
1120186017 14:81394706-81394728 CTGGCTTTGGAGATAGAGGAAGG + Intronic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1120982847 14:90306329-90306351 CTGTGTTTGGTCAGTGAGGAGGG - Intronic
1121450409 14:94003416-94003438 GTGTGTTTTGGGATTGATGATGG - Intergenic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121727571 14:96164443-96164465 TTGTCTTTGAGGATGGAGGAGGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1122789181 14:104177190-104177212 CCGTGTGTGGGGCTGGAGGGTGG - Exonic
1123419978 15:20123720-20123742 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1123445883 15:20329812-20329834 CAGGCTTTGAGGATGGAGGAAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123529199 15:21130256-21130278 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1124792267 15:32739614-32739636 ATGTGTTTGTGGATTGAAGAAGG - Exonic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1126909705 15:53404693-53404715 CTCTCTTTGGGGAAAGAGGACGG + Intergenic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128229131 15:66022753-66022775 CTGGGGTTGGGGGTGGAGGGTGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317447 15:66670041-66670063 CTGGGTCTGGGGATTGGGGATGG + Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1128908191 15:71487252-71487274 CTCTGTTTGGAGATGGAAGGTGG + Intronic
1129514173 15:76146848-76146870 CTGGGTGTGGTGATGGAGGTAGG - Intronic
1129694898 15:77734949-77734971 CTGTGTTGGTGGATGCAGCAGGG - Intronic
1130749756 15:86698478-86698500 CTGTGTATGGGGGTGCAGGTGGG - Intronic
1130835356 15:87644803-87644825 CTGTGTTAAGGGATGCAGGCAGG - Intergenic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131119082 15:89812197-89812219 CAGTGGTCGGGGATGGAGCATGG - Intronic
1131359003 15:91772670-91772692 ATGTGTTTGGGGGCGGGGGAGGG + Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131600838 15:93847162-93847184 CTGTTTGTGGGGTTGGGGGAGGG + Intergenic
1131621096 15:94068904-94068926 CTAATTTTGAGGATGGAGGAAGG + Intergenic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1132029623 15:98429224-98429246 CTGGGTTTGAAGATGAAGGAAGG - Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1132494349 16:253999-254021 CTGTGCTTGAGGCTGGTGGAAGG + Intronic
1132626862 16:895376-895398 CAGTGTTTGGTGATGGACCAGGG + Intronic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133398796 16:5469665-5469687 CAGGGGCTGGGGATGGAGGAAGG - Intergenic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133517852 16:6527355-6527377 CTTTGTTGGGGGAGGAAGGAAGG - Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1133829439 16:9308170-9308192 CTGTGTCTGGGAACAGAGGAAGG + Intergenic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134237265 16:12476796-12476818 CTGTGTTTGGGGTTGATGGGTGG + Intronic
1134600514 16:15530072-15530094 CTGGCTTCGGAGATGGAGGAGGG - Intronic
1134748579 16:16607423-16607445 CTGTATTCGGGGCTGGATGAAGG + Intergenic
1134996887 16:18746193-18746215 CTGTATTCGGGGCTGGATGAAGG - Intergenic
1135040425 16:19113851-19113873 CTGCCTTCGGGGAGGGAGGATGG + Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1135586129 16:23672497-23672519 CTGTGTTTTGGTAGGGAGGGAGG + Exonic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136073819 16:27804871-27804893 CTGGGATTGGGGGCGGAGGAGGG + Intronic
1136073867 16:27805002-27805024 CTGGGATTGGGGGTGGGGGAGGG + Intronic
1136076495 16:27820814-27820836 CGGTGTCTGGGGTTGGAGGCTGG - Intronic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1137374415 16:47940536-47940558 CTGGGATGGAGGATGGAGGATGG - Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138499221 16:57428628-57428650 ATGTGGTTGGGGATGGAAGGGGG + Exonic
1138561104 16:57801649-57801671 CAGTGTTGGGGTATGGAGGTGGG + Intronic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1138919266 16:61507179-61507201 GTGTGTTTGTGGATAGAGCAGGG + Intergenic
1140031342 16:71341555-71341577 CTCTGGATGGGGATGGAGGGGGG + Intergenic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140892241 16:79295078-79295100 CTTTTTTTGGGGGTGGGGGAGGG + Intergenic
1140987644 16:80173905-80173927 CTGGGTTTAAGCATGGAGGAAGG + Intergenic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141315654 16:82960314-82960336 CTGTGCTTTGGGCTTGAGGATGG + Intronic
1141317306 16:82974723-82974745 CTGTCTTTGAAGATAGAGGAAGG + Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141354684 16:83334098-83334120 CTGGCTTTGAGGATGGAGAAAGG - Intronic
1141478227 16:84288224-84288246 GTGGCTTTGGAGATGGAGGAAGG - Intergenic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143987189 17:10924827-10924849 GTTTGTTTTGGGTTGGAGGAAGG + Intergenic
1144067082 17:11634283-11634305 TTTTGCTTGGGGATGAAGGAAGG - Intronic
1145911322 17:28544964-28544986 CTGGGTTTGGGAATGCAGGTTGG - Intronic
1146098981 17:29960193-29960215 CACTGCTGGGGGATGGAGGAGGG + Intronic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146519656 17:33516418-33516440 GTGTGTGTGTGTATGGAGGAGGG + Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146608761 17:34286130-34286152 CAGTGTTTGGGAATGGGGAATGG + Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1147008966 17:37428455-37428477 CTGGCTTTGAGGATGGAGAAAGG - Intronic
1147161975 17:38573633-38573655 CTGTGATAGGGGTTGGATGATGG - Intronic
1147357166 17:39907162-39907184 CTGTTTTTGAGGATGTGGGAAGG - Intronic
1147485129 17:40805444-40805466 CTGTCTTTGAAGATGAAGGATGG + Intergenic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147810249 17:43163847-43163869 TAGTGTTGGGAGATGGAGGATGG + Intergenic
1148695035 17:49553654-49553676 CTGTGTTTGGTGATTAATGAAGG - Intergenic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149588160 17:57807557-57807579 CTGGCTTTGAGAATGGAGGAAGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150802030 17:68290577-68290599 CTGTGTTTGGGGGTCGGGGGAGG + Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151679289 17:75615168-75615190 CTGTGCCTGGGGCTGGAGGGAGG + Intergenic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152036153 17:77874368-77874390 CTGTGTTTGGTGATGGTGCAGGG - Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153597320 18:6740939-6740961 CTGGGTTCGGGGAAGCAGGAAGG + Intronic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154160844 18:11980496-11980518 CAGTGTTTGGGGTTAGCGGAGGG + Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155513534 18:26600864-26600886 ATGTGGTTGGGGATGGAAGGGGG - Intronic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1155970913 18:32082894-32082916 CCCTGTTTGGGGAGAGAGGATGG - Intergenic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156788159 18:40940156-40940178 ATGAGTTTGGGGATTTAGGAAGG - Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157337600 18:46752979-46753001 CTGTGTTTGGCCCTGGAGTAGGG - Intronic
1157489929 18:48116124-48116146 CTGTCCTTGGGGGTGGGGGACGG - Intronic
1157638345 18:49185193-49185215 CTTTTCTTGGGGATGGGGGATGG - Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1157812802 18:50709663-50709685 ATGTCATTGGGGATGGGGGAAGG + Intronic
1157816343 18:50731920-50731942 CTGTATTTGGGGGTGGGGGAAGG + Intergenic
1157881900 18:51328721-51328743 CTGGCGTTGAGGATGGAGGAAGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1159124634 18:64208560-64208582 CGGTGTGTGGGGGTGGGGGATGG - Intergenic
1159695075 18:71546797-71546819 CTGTCGTTGGGGGTGGAGTAGGG + Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160335976 18:78039996-78040018 CTGGCCTTGAGGATGGAGGAGGG - Intergenic
1160566713 18:79790522-79790544 CAGGGTTTGGGAGTGGAGGAAGG + Intergenic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160737930 19:673067-673089 CGGGATTTGGAGATGGAGGAAGG - Intergenic
1161467855 19:4442131-4442153 CCGTGTTGGGGGTGGGAGGAAGG + Intronic
1162015131 19:7841521-7841543 CTGTGTTTGGGGGTTGTGGGGGG - Intronic
1162639531 19:11997227-11997249 CTTTCTTTGGGGAGGAAGGAGGG - Intergenic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1164520415 19:28974867-28974889 CTGTGTTTGAGGCTGCAGTACGG - Intergenic
1165162098 19:33822646-33822668 CTGGTTTTGGGGATGAAGGAAGG - Intergenic
1165602363 19:37065469-37065491 CTGGCTTTTGAGATGGAGGAAGG + Intronic
1166089325 19:40497948-40497970 CTGGGTTTGGGGCTGGGGTAGGG - Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166220798 19:41363349-41363371 CTGCGTTAAGGGGTGGAGGAAGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166855331 19:45780370-45780392 CTGGATTTGGGGCTGGGGGAAGG + Exonic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167490502 19:49790231-49790253 CTGCCTTTGGGGATGGGGGAAGG - Intronic
1167507665 19:49879439-49879461 CTGTGTTTGGCTGTGGAGCAAGG - Intronic
1167667047 19:50828365-50828387 CTGTGGTTGGGGGTGGAGACAGG + Intronic
1167676033 19:50886556-50886578 CTGTGATTGGAGATGGAGACAGG - Intergenic
1167696304 19:51017335-51017357 CTGGGTTTGGGGTTGGAGCTGGG + Intronic
1167750164 19:51374631-51374653 CTGAGTTTGGGGATGGAGTTGGG - Intergenic
1167782189 19:51605977-51605999 GTGTGTGTGGGGGTGGAGGGAGG - Intergenic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
1168491032 19:56809035-56809057 CTGGGTTGTGGGGTGGAGGAAGG + Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
1202689504 1_KI270712v1_random:77020-77042 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
925340106 2:3130315-3130337 CTGGCTTTGGTGGTGGAGGAAGG - Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
925987747 2:9229954-9229976 GTGTGTTTGTGTATGGAGCAAGG + Intronic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928314299 2:30233779-30233801 CTGTGTCTGGGGCTAGAGAAAGG + Intronic
928363016 2:30680728-30680750 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
928414382 2:31079472-31079494 CTGTGTTTGGGGTTAAATGAAGG + Intronic
928686888 2:33759242-33759264 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
929732648 2:44512019-44512041 CTCTGCTTGTGGGTGGAGGAAGG + Intronic
929935144 2:46289230-46289252 CTCTGCCTGGGGATGGAGGTGGG - Intergenic
930001861 2:46866965-46866987 CTCTGTGTGGGGATGGAGTGGGG + Intergenic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930739574 2:54816825-54816847 CTGCATTTGGGACTGGAGGAAGG + Exonic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
930978646 2:57495003-57495025 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
931757818 2:65389390-65389412 GTGTGTTGGGGGAGGAAGGAGGG + Intronic
931849080 2:66234932-66234954 CTGAGTTTTGGGTTGGATGAAGG + Intergenic
932060772 2:68495563-68495585 CTATGTTTGGGTCTAGAGGATGG + Intronic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
932454462 2:71838839-71838861 CTTGCTTTGGGGGTGGAGGAGGG + Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
933168429 2:79098789-79098811 CTGTTTTTTGGAATGGAGGATGG + Intergenic
933244347 2:79958499-79958521 CTGGGCTTGAAGATGGAGGAAGG + Intronic
933293762 2:80467227-80467249 CTGTCTTTGTGCATGAAGGATGG - Intronic
933902205 2:86858166-86858188 CTGTGTTTCGGGATGCAAGCCGG - Exonic
933928939 2:87128167-87128189 CTGTGTTTTGGTAAGAAGGAAGG - Intergenic
933956930 2:87379072-87379094 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934000273 2:87703953-87703975 CTGTGTTTTGGTAAGAAGGAAGG - Intergenic
934241051 2:90270962-90270984 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934272127 2:91545723-91545745 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934848223 2:97677118-97677140 CAGGGCTTGGGAATGGAGGATGG - Intergenic
935186885 2:100742761-100742783 CAGTGTCAGGGAATGGAGGAGGG + Intergenic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935686310 2:105687098-105687120 TGGGGTTGGGGGATGGAGGAGGG + Intergenic
935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
936148108 2:109995349-109995371 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
936196585 2:110376099-110376121 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
936364006 2:111835234-111835256 CTGTGTTTTGGTAAGAAGGAAGG + Intronic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
936925279 2:117730654-117730676 CGCTGCTTGGGGTTGGAGGAGGG - Intergenic
936972976 2:118192432-118192454 ATGTGCTTGGGGGTGGGGGATGG + Intergenic
937015541 2:118602098-118602120 CTGTCTGTGAGGGTGGAGGAAGG + Intergenic
937078938 2:119126681-119126703 CTGGGATTGGGGGTGGAGGCAGG - Intergenic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937389055 2:121466962-121466984 CAGGGTTTGGGGTGGGAGGAGGG - Intronic
937391183 2:121488075-121488097 CTGAGTTTAGGGCTGGAGCAAGG - Intronic
937426928 2:121807680-121807702 ATGTGTGTGGGGCTGGAGCAAGG - Intergenic
937470610 2:122171028-122171050 CTGGCTTTGAGGATGGAGGGAGG + Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938341197 2:130537746-130537768 CTGTAGCTGGGAATGGAGGATGG - Intergenic
938348634 2:130582963-130582985 CTGTAGCTGGGAATGGAGGATGG + Intronic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939712614 2:145541765-145541787 GGGTGGTTGGGGATGGGGGATGG + Intergenic
939949688 2:148455282-148455304 CAGGGTTTGGGGATGGAGTATGG - Intronic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941270094 2:163414652-163414674 CAGTGTTTGGGGCTTGGGGAAGG + Intergenic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
942212196 2:173682347-173682369 ATGTGTTTGTGGGTGGGGGAAGG - Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943409115 2:187523471-187523493 AGGAGTTTGGGGGTGGAGGAGGG - Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
944619460 2:201499039-201499061 GGGTGTGTGGGGATGGAAGATGG - Intronic
944732323 2:202529340-202529362 CTTTATTTGGGTATGGAGGGAGG - Intronic
944822046 2:203441026-203441048 CTGGGGTTGGGGGTGGAGGAGGG + Exonic
944908766 2:204288639-204288661 CTGCCTTTGGGGATGAAGAAAGG + Intergenic
944977250 2:205068160-205068182 CTCTGTTTGGGGATGGGGCAGGG + Intronic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945358805 2:208870751-208870773 CTGTTTTTGGGGGTGGGGGTGGG + Intergenic
946100190 2:217313932-217313954 GTGTGTTTGGGAGGGGAGGAGGG + Intronic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946239190 2:218343610-218343632 CTGAGCGTGGGGCTGGAGGATGG - Intronic
946569625 2:221009472-221009494 GTGTGTATGGGGATGGATGCGGG - Intergenic
946714000 2:222534142-222534164 TTGTGTTTGTGGAGGAAGGAGGG + Intronic
946869561 2:224073696-224073718 CTGAGTTTTGGGTTGGATGAAGG - Intergenic
946961845 2:224993699-224993721 GTGGGCTTGGGGATGGAGGGAGG - Intronic
947497627 2:230649752-230649774 CTGTGGTTGGAGTTGGAGGTGGG + Intergenic
947743708 2:232496934-232496956 CTGTACTTGGGGATGGGGCAGGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948344948 2:237287678-237287700 ATGTGCTTGGGTCTGGAGGAAGG - Intergenic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948939962 2:241190694-241190716 CTGTGCTTGGGGCGGCAGGAAGG - Intronic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1169004755 20:2197197-2197219 ATGAGGTTGGGGATGGAAGAGGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169466375 20:5844452-5844474 ATGTGTTTGGGGATGGCTGGAGG + Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169756754 20:9051147-9051169 CTGGCTTTGGTGGTGGAGGAAGG + Intergenic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1170611638 20:17918531-17918553 GTGTGTTGTGGGTTGGAGGAAGG + Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170867525 20:20172694-20172716 CTGTGTATGGTGGTGGAGAAGGG - Intronic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1172841723 20:37906039-37906061 CTGTGTCTGGGGGTGGGGGGTGG + Intronic
1172875077 20:38159113-38159135 CTGAGTTTGGGGTTGGGTGAAGG - Intronic
1172886630 20:38235552-38235574 CTGGCTTTGAGGATGGAGGAAGG + Intronic
1172947065 20:38697707-38697729 TTCTCTTTGGGGATGGAGGTTGG + Intergenic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173082303 20:39879919-39879941 CTGTATTGGAGGATGGAGGGTGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173338823 20:42136067-42136089 CTATCTTTGGTGATGGAGGGAGG - Intronic
1173471427 20:43326313-43326335 CTGTGTTTGGTGATAGGGGGTGG - Intergenic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1173847012 20:46194490-46194512 TTGGGTATGGGGCTGGAGGATGG + Intronic
1174062642 20:47843543-47843565 ATGTGCTTGAGGATGGAGGAAGG + Intergenic
1174065393 20:47860924-47860946 ATGTGTTTGGTGAGTGAGGAGGG - Intergenic
1174072993 20:47911952-47911974 ATGTGCTTGAGGATGGAGGAAGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174439233 20:50535868-50535890 CTCTATTTGGGGGTGGGGGACGG - Intronic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175294484 20:57899014-57899036 CTGGATTTGGAGATAGAGGAGGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175586030 20:60140651-60140673 CTGAGTTTGGGATTGGATGAAGG + Intergenic
1175632286 20:60551268-60551290 CACTGCTGGGGGATGGAGGAGGG + Intergenic
1175640003 20:60620978-60621000 CTGTGAGGGGGAATGGAGGAAGG + Intergenic
1175643505 20:60651330-60651352 CTGTGCCTTGGGTTGGAGGAGGG - Intergenic
1175691491 20:61068731-61068753 CTGGCTTTGAGGATGGAAGAAGG - Intergenic
1175779452 20:61673049-61673071 CTGTGCTTGAGGATGAAGGCAGG + Intronic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1176076542 20:63250929-63250951 CTGGGATGGGGGATGGGGGATGG - Intronic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1178751512 21:35308610-35308632 CCGGCTTTGAGGATGGAGGAAGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179140070 21:38717577-38717599 CTGGCTTTGAGGATGGAAGACGG + Intergenic
1179587755 21:42384495-42384517 CTGTGTGTGGGGGTGGGGGTAGG - Intronic
1179605967 21:42515093-42515115 CTTTGTTGGGGGTTGGAGGCAGG + Intronic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180172380 21:46066337-46066359 CTGTGTTGGGGGCCGGGGGAAGG + Intergenic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1180551914 22:16547562-16547584 CTGGCTTTGAGGATAGAGGAAGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181352112 22:22266482-22266504 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181474265 22:23158842-23158864 CCCTGTTTGGGGTGGGAGGATGG + Intronic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1182883414 22:33753348-33753370 CTGGCCTTGGGGATGGAGGAAGG + Intronic
1182972766 22:34593332-34593354 CTGTTTTTGTGGCTGGGGGATGG - Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183481311 22:38067029-38067051 GGGTGTTTTGGGGTGGAGGAGGG + Intronic
1183732339 22:39625691-39625713 AGGTGGTTGGGGAGGGAGGAAGG + Intronic
1184157661 22:42678942-42678964 CTGTTTTGGGGTCTGGAGGATGG - Intergenic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
1185224313 22:49644200-49644222 GTGGGTGTGGGGACGGAGGATGG + Intronic
949226619 3:1702700-1702722 CTGGCTTTGGGGATAGGGGAAGG - Intergenic
949410206 3:3755242-3755264 CTCTGACTGGGTATGGAGGATGG + Intronic
949498823 3:4658551-4658573 CAAGGTTTGGGGAAGGAGGAAGG - Intronic
950221916 3:11202553-11202575 CTTGGCTAGGGGATGGAGGAGGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950550513 3:13663371-13663393 CTGGCTTTGAGGATGGAGGGAGG - Intergenic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951138275 3:19130039-19130061 AGGTGGTTGGGGATGCAGGATGG - Intergenic
951359775 3:21711613-21711635 GTGTTTTTGGGGATGGGAGATGG - Intronic
951697097 3:25456336-25456358 CTTTCTTGGGGGGTGGAGGAAGG + Intronic
952184958 3:30958549-30958571 CTGTGTGTGGAGATGAAGGGAGG - Intergenic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952743790 3:36759752-36759774 CTGTGTCTGGGATTGGAGGAGGG - Intergenic
953046874 3:39301357-39301379 GTGTGTTGGGGGGTGGAGGAAGG + Intergenic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953830894 3:46296938-46296960 CTGTATGTGGGGATGGCGGGTGG - Intergenic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
953876792 3:46671236-46671258 CTGTGCTTGGGAATGCAGCATGG + Intronic
954248052 3:49347222-49347244 GTGTGGTTAGGGATGAAGGATGG + Intergenic
954358549 3:50103911-50103933 TTGTGTTTGTGTATGTAGGATGG + Intronic
954463127 3:50638913-50638935 CTGTGTTTCCTAATGGAGGAGGG - Intronic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955234112 3:57124507-57124529 CTGGTTTTGTGGATGGAGGAAGG + Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955977972 3:64496606-64496628 ATGTATTTGGGGGTGGAGCAGGG - Intergenic
956121352 3:65969341-65969363 CTGTGTTAGGGGCTGGGGGGTGG + Intronic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
956791826 3:72685960-72685982 CTGTGCTTGGGGCTGGAGAATGG - Intergenic
956874380 3:73447533-73447555 GTGTGTTCGGCTATGGAGGAAGG - Intronic
956911831 3:73826168-73826190 TGGGGTTAGGGGATGGAGGATGG + Intergenic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957037154 3:75304357-75304379 TTTGGTTTGGAGATGGAGGAAGG + Intergenic
957943670 3:87036701-87036723 CTGAGTTTTGGGTTGGATGAAGG - Intergenic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
959087688 3:101868748-101868770 CTGGCTTTGAGGATGGAGCAAGG + Intergenic
959273788 3:104249941-104249963 TTGTGTTTGGTGATGTAAGAAGG - Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959521320 3:107326025-107326047 CTGTGTGTGGGGGTGGAGTGGGG - Intergenic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
959976460 3:112466262-112466284 CTTTGTTTCAGGATGCAGGAAGG - Exonic
961080923 3:124027145-124027167 GTTGGTTTGGAGATGGAGGAAGG + Intergenic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961475052 3:127141005-127141027 CTGAGTTTGGGGAGAGATGATGG + Intergenic
962274901 3:134004712-134004734 CTAGTTTTGAGGATGGAGGAAGG + Intronic
962616500 3:137131719-137131741 CTTTGCTTGGGGCTAGAGGAGGG + Intergenic
962642881 3:137406717-137406739 GTGTGTTTTGGGTTGGGGGAGGG + Intergenic
963076580 3:141353011-141353033 CAAGGTTTGGGGATGGGGGAAGG - Intronic
963115043 3:141720835-141720857 TTGGGTTTGGGGTTGGGGGAGGG + Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963447589 3:145434319-145434341 ATGTGTGTGGGGGTGGGGGAGGG + Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
963990275 3:151645051-151645073 CAGTCTCTGGGGATGGAGGGAGG - Intergenic
964005508 3:151822718-151822740 CTATGATTGGGTTTGGAGGATGG + Intronic
964294607 3:155219719-155219741 CTGTTGTGGGGGATGGGGGAGGG - Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
965635905 3:170780242-170780264 CTGTGTTTCTGGATGCAGGAGGG - Intronic
965766139 3:172132169-172132191 CGTTGGTTGAGGATGGAGGAAGG + Intronic
966018567 3:175176723-175176745 CTGGCTTTGAGGATGGAGTAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966666127 3:182472929-182472951 CTGGTTTTGAGGATGGAGGAAGG - Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967735580 3:192948367-192948389 CTGGCTTTGGTGATGGAGAAAGG - Intergenic
968690219 4:1986391-1986413 CTTTGAGTGGGGCTGGAGGACGG + Exonic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969437085 4:7194380-7194402 CTGTGATTTGTGCTGGAGGAGGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969490443 4:7496470-7496492 CTGAGATGGGGGATGGGGGACGG - Intronic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
969726581 4:8921724-8921746 CTGACTTTGAGGATGGATGAAGG - Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970254382 4:14152254-14152276 GTGTGTTTGGTGATGGTTGAGGG + Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970895035 4:21092581-21092603 ATGTGGTTGGGGATGCAGGTGGG - Intronic
971056901 4:22923282-22923304 TTTTGTGTGGGGTTGGAGGAGGG - Intergenic
971248948 4:24955957-24955979 CTCTATTTGGGGTTGTAGGAAGG - Intronic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972181019 4:36465942-36465964 CTATGTTGGAGGGTGGAGGAAGG - Intergenic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
972725737 4:41745591-41745613 TTTTGTTTGGGGGTTGAGGAAGG + Exonic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972893948 4:43595674-43595696 ATGTGTTTGGGGGTGGGGGGTGG - Intergenic
973259715 4:48150448-48150470 GCGGGTTTGGGGATGGGGGATGG - Intronic
973554302 4:52066653-52066675 CTCTGTTGGGGGTTGGGGGAAGG - Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973779407 4:54274072-54274094 CTGTGTATGTGGATGGAGTGTGG + Intronic
973960588 4:56105971-56105993 CAGAGCTTGGGGATGGAAGAAGG - Intergenic
973966222 4:56164642-56164664 CAGAGGTTGGGGACGGAGGATGG + Intergenic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
974950107 4:68577009-68577031 CTGTTTTTTGGAATGGAGGATGG - Intronic
974984884 4:69010903-69010925 ATGTGTTGGAGGGTGGAGGATGG + Intronic
975280649 4:72558373-72558395 CTGGTTCTGAGGATGGAGGAAGG - Intronic
975615772 4:76245516-76245538 AGGAGATTGGGGATGGAGGAAGG - Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975757282 4:77583339-77583361 CTGTGTTGGGAGATGAAGGATGG - Intronic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976551554 4:86402306-86402328 CTGTATTTGGGGATTGCAGATGG - Intronic
978306835 4:107338148-107338170 CTGACTTTGAGGATGGAAGATGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978842314 4:113229332-113229354 CTGGCTTTGGAGATGGAGAACGG - Intronic
979165573 4:117525743-117525765 TTGTATTTGAGGATTGAGGAGGG - Intergenic
979335958 4:119463140-119463162 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
979666886 4:123321560-123321582 CTGGATTTGAGGATGGAGAAAGG + Intergenic
979920134 4:126486542-126486564 ATGTGTATGGGGATAGAGGTTGG + Intergenic
979931927 4:126642050-126642072 CTGAGTTTTGGGTTGGATGAAGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980170508 4:129283916-129283938 TAGTGTTTTGGGATGGAGGCTGG + Intergenic
980482544 4:133405555-133405577 CTCTATTTGGGGCTGGGGGAGGG - Intergenic
981183391 4:141772352-141772374 CTGTGTGTGGGGGTGGGGGGAGG - Intergenic
981733500 4:147924487-147924509 GTGTATTTGGGGTTGGAGGTTGG + Intronic
983474397 4:168196328-168196350 TTCTGCTTGGGGATGGAGGGTGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985970398 5:3373603-3373625 ATGTGTTGTGGGATGGAGGCTGG + Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986205417 5:5620527-5620549 CTGTGTCTTGGGATGTAGGAGGG - Intergenic
986290079 5:6392789-6392811 CTAGCTTTGTGGATGGAGGAGGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986614309 5:9601078-9601100 GTCTCTTTGGAGATGGAGGACGG - Intergenic
986788494 5:11138167-11138189 CTGGCTTTGAGGATGGAGAAAGG - Intronic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987220442 5:15785569-15785591 CTTTAATTGGGGATGGAGGAGGG - Intronic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
987521264 5:18986832-18986854 GTTTGTTTGGGGGTGGGGGAGGG - Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988097158 5:26630687-26630709 GTGTGTATGTGTATGGAGGAAGG + Intergenic
988404974 5:30812471-30812493 CTGTGTCTTGGGAGTGAGGATGG + Intergenic
989143671 5:38227178-38227200 CTGTGTTTGGCGCTGGGTGAGGG - Intergenic
989396607 5:40963718-40963740 CTGAGCCTGGGGATGGATGAAGG - Intronic
990215844 5:53530913-53530935 CTCCATTTGGGGATGAAGGATGG + Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991937344 5:71815261-71815283 GTGAGGTGGGGGATGGAGGAAGG + Intergenic
992191149 5:74293334-74293356 CTGTGTTTGGGAACTGAGAATGG - Intergenic
992467158 5:77018161-77018183 CTGTACTTGGGGGTGGAGTAGGG - Intergenic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
994028457 5:95113414-95113436 CACTGCTTGGGGATGGGGGAGGG - Intronic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
994275916 5:97837109-97837131 CTGGCTTTGGAGATAGAGGAAGG - Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995244721 5:109922611-109922633 CTTTGTTTGGGGGTGGGGCAGGG + Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995652964 5:114391931-114391953 CTCTATTTAGGGCTGGAGGAAGG + Intronic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
995841329 5:116446278-116446300 GTGTGTGTGGGGGTGGGGGATGG + Exonic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996811440 5:127519972-127519994 CAGTGACTGGGTATGGAGGAAGG - Intronic
996846442 5:127904138-127904160 CTGTCTTTGAGGATAGAGAAAGG + Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996904531 5:128583157-128583179 ATGGGTTTGGGGAAGCAGGAAGG - Intronic
997474965 5:134137547-134137569 CTGATTTAGGGGATTGAGGAGGG + Intronic
997500136 5:134367273-134367295 CTGTGCTTGGGAATGGGGGAGGG + Intronic
997709648 5:135993178-135993200 GTGTGTGTGGGGCTTGAGGAAGG - Intergenic
997884867 5:137621020-137621042 CTATCTTTGGGTCTGGAGGAGGG + Exonic
998037924 5:138932392-138932414 CTCTGCTTGGGGATGGAGGCGGG - Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
999977996 5:156931100-156931122 CTGACTTTGAGGATGAAGGAAGG + Intronic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1000755064 5:165147915-165147937 CTGGCTTTGGAGATGGAGAAAGG + Intergenic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001552168 5:172610988-172611010 CTGTGCTTGGGGAGAAAGGATGG + Intergenic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1001712083 5:173787049-173787071 TTGTGCTTGGGGATGGGGAAGGG - Intergenic
1001866591 5:175111418-175111440 TTGAGGTTGGGGATGGAGGGTGG - Intergenic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002359930 5:178662386-178662408 CTGCGTCTGGGGAGAGAGGAGGG - Intergenic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003273161 6:4624761-4624783 CTGTGTTTTGGGGTGGGGGGCGG + Intergenic
1003501591 6:6707721-6707743 TTTTCTTTGGTGATGGAGGATGG - Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004051078 6:12080081-12080103 CTGTTTTAGGGGATGTAGAAAGG + Intronic
1004505635 6:16244589-16244611 GTGTGTTTGTGGGTGGGGGAGGG + Intronic
1004920945 6:20375108-20375130 CTTTTTTTGGGGGTGGGGGATGG + Intergenic
1005055728 6:21727185-21727207 CTATATTTGCTGATGGAGGAGGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006020216 6:31113336-31113358 TTGGCTTTGGAGATGGAGGAAGG - Intergenic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008946317 6:57100958-57100980 TTGTGTCTGGAGATAGAGGATGG - Intronic
1009337863 6:62515927-62515949 AAGTATTTGGGGTTGGAGGAGGG + Intergenic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010561257 6:77353456-77353478 CTGTTGCTGGGGATGAAGGAGGG + Intergenic
1010959010 6:82124102-82124124 ATGTTTTGGAGGATGGAGGAAGG + Intergenic
1011540938 6:88427891-88427913 CTGGGTCTGGGGAGGGAGCAGGG - Intergenic
1012334755 6:98041414-98041436 CTGTGTTAGGGGTTGGAGCTGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014296259 6:119621217-119621239 GTGTGTTTGGGGCTGGGGTAGGG - Intergenic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014813152 6:125907393-125907415 CTGTGTTTGGGGAGTGTGAAGGG - Intronic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015380471 6:132561511-132561533 GTGTGTATGTGGGTGGAGGAGGG + Intergenic
1015515056 6:134074751-134074773 GAGTGTTTGGGGGTGGAAGATGG + Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017255211 6:152325303-152325325 CTAGGGTTGGGGGTGGAGGACGG + Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1017739848 6:157397471-157397493 CTGGCTTTGAGGATGGAGGGAGG - Intronic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018242663 6:161793683-161793705 CTATCTCTGGGGTTGGAGGAAGG + Intronic
1018426819 6:163690723-163690745 CAGAGTTTGGTGGTGGAGGAGGG + Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019102297 6:169641237-169641259 ATGTGTTTGGGGCTGGAGCTCGG - Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019341419 7:510645-510667 CTGTGGTGGTGGATGCAGGAGGG + Intronic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019886694 7:3911727-3911749 CTGTATTAGGTGTTGGAGGAGGG + Intronic
1020129292 7:5550501-5550523 CTGTGTCTTGGGATGGATCAGGG - Intronic
1020132933 7:5569842-5569864 CTGGGGTGGGGGATGGGGGATGG - Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020646036 7:10815445-10815467 CTGGGTTTTGGAATGGAGTATGG - Intergenic
1021113785 7:16725592-16725614 CTGGCTTTGAGGCTGGAGGAAGG - Intergenic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1021984554 7:26086075-26086097 CTGAGTTTGGGGTTAGATGAAGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024959399 7:54958539-54958561 ATGTGGTGGGGGCTGGAGGAGGG + Intergenic
1025231806 7:57207599-57207621 ATGTGCTTGAGGATGGAGGAAGG - Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026525499 7:71149976-71149998 GTGTGTCGGGGGCTGGAGGAGGG + Intronic
1026654451 7:72245047-72245069 CGATGTTTTGGGATGGAGCAAGG - Intronic
1026765516 7:73157158-73157180 CTGAGTTGGGGGCTGGAAGAAGG - Intergenic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1026999580 7:74643193-74643215 CTGTGGTTGCGCATGGAGGCAGG + Intergenic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027041989 7:74966851-74966873 CTGAGTTGGGGGCTGGAAGAAGG - Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027081652 7:75235503-75235525 CTGAGTTGGGGGCTGGAAGAAGG + Intergenic
1027221181 7:76214919-76214941 CAGCCCTTGGGGATGGAGGAAGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027426883 7:78070014-78070036 AAGTGTTTGGGAATTGAGGAAGG + Intronic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027464463 7:78498328-78498350 CAGTGATTGGGGAGGGAGCATGG - Intronic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1027696767 7:81421670-81421692 CTGTTTTTGGGGTGGGGGGAGGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029390238 7:100270084-100270106 CTGAGTTGGGGGCTGGAAGAAGG + Intronic
1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG + Intergenic
1029803454 7:102974051-102974073 CTGTTTTTTGGAATTGAGGATGG - Intronic
1029906823 7:104101046-104101068 CTGGGTTTGTAGATGAAGGAAGG + Intergenic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030547562 7:110916607-110916629 ATCTGTGTGGGGATGGAGGAAGG - Intronic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1030670148 7:112326363-112326385 GTGTGTTTTGGGGTGGGGGAAGG - Intronic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1031206961 7:118772229-118772251 TTGTGCTTAGGGATGCAGGAAGG - Intergenic
1031511118 7:122650980-122651002 TTGTGTTTGGGGATGCAGCAAGG - Intronic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1032023184 7:128421448-128421470 CTATGCCTGGGGATGGAGGGAGG - Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1032638427 7:133736825-133736847 CTGGGTTTGGGGAAAGAGTAGGG - Intronic
1033032760 7:137843931-137843953 CTGAGTTAGGGTATGGAGCATGG - Intronic
1033590968 7:142808098-142808120 CTCTGTTTGGTGGGGGAGGAGGG + Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1033794661 7:144833473-144833495 TTTTGTTTTGAGATGGAGGATGG + Intronic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034499303 7:151439821-151439843 CTGTGCTAGGGGATGCAGGAGGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035205126 7:157289979-157290001 GTGTGTTTGGGGGTGGGGGGGGG + Intergenic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1035987703 8:4453168-4453190 CTGTGTGTTGGGATGGAGGGGGG - Intronic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037128821 8:15383552-15383574 GAGTGTTTGGGGAAGAAGGAAGG - Intergenic
1037226902 8:16603223-16603245 CTGGGTTTGATGATGGAGAAAGG + Intergenic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1037579676 8:20236965-20236987 CTGGGTGTGGGGTTGGAGTAAGG + Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038553185 8:28487301-28487323 CTGTCTTCTGGAATGGAGGAAGG - Intronic
1038761859 8:30391714-30391736 CTATGTTTGGCGGTGGAGGTGGG + Intronic
1039100413 8:33935429-33935451 CTGTGTATGTGTATGGAGTAAGG + Intergenic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1041108434 8:54463674-54463696 CAGTGTTTGTATATGGAGGATGG - Intergenic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042525913 8:69764529-69764551 CTGTGTTTGGAAATGGAGAATGG + Intronic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1042976127 8:74471671-74471693 CTGGGGATGGGGATGGAGAAAGG - Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044720466 8:95140633-95140655 TGGGGTTTGGGGATGGATGATGG - Intronic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1044866499 8:96576068-96576090 TTGTGTGTGGGGATCGGGGAGGG - Intronic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1045000319 8:97872646-97872668 CTGGCTTTGAGGATGGAAGAAGG - Intronic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045429258 8:102098060-102098082 CTGTGTTTGGGTATGAAAGGTGG + Intronic
1046018401 8:108634238-108634260 CATTTTTTGGGGATGGAGGTGGG - Intronic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1047546814 8:125826122-125826144 GTGGATTTGGGGATGCAGGAGGG + Intergenic
1047748910 8:127865553-127865575 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1048323576 8:133421467-133421489 TTGACTTTGAGGATGGAGGAAGG + Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048984091 8:139722290-139722312 TTGGCTTTGAGGATGGAGGAAGG - Intergenic
1049283213 8:141761093-141761115 CTGTGTTTGGGGACAGAGGTGGG - Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1051410695 9:16786854-16786876 GTGAGTTTTGGGATGGGGGAAGG - Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1051684793 9:19646820-19646842 ATGTGTTTTGGGATGAGGGAAGG - Intronic
1052249545 9:26381271-26381293 CTATGTATGGGGGTGGAGGTAGG - Intergenic
1052312725 9:27085623-27085645 CTGTGGTAGGGAGTGGAGGAAGG + Intergenic
1052590627 9:30489387-30489409 ATGTTCTTGGGGATGGATGAAGG - Intergenic
1052619251 9:30884014-30884036 CAGTGTCTGGTGATGGAGCATGG - Intergenic
1053008843 9:34622176-34622198 CTGTCTACGGGGATGGAGGGGGG - Intronic
1053293590 9:36898090-36898112 CTGGGTTTGGAAATGGAGGATGG + Intronic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053700605 9:40686073-40686095 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054311897 9:63485471-63485493 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054410671 9:64809528-64809550 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054877200 9:70109240-70109262 CAGTGGTTGAGGATGGAGCATGG + Intronic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055139872 9:72864389-72864411 CTGCTATTGGGGGTGGAGGAGGG - Intergenic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055562158 9:77531778-77531800 GTGTGTTTGGGGCTGGTGGTGGG - Intronic
1055824897 9:80311966-80311988 CTGTGTTTGCACATGGCGGAAGG - Intergenic
1056194330 9:84214772-84214794 CTGACTTTGAGGGTGGAGGAAGG - Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056741357 9:89258064-89258086 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1057828665 9:98390669-98390691 AGGTGTTTGGGGAAGGATGATGG - Intronic
1057926389 9:99154649-99154671 CTGGTTTTGATGATGGAGGAGGG - Intergenic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058116564 9:101091477-101091499 CTGGGTTTGAAGATGAAGGAAGG - Intronic
1058149112 9:101444584-101444606 ATGCCTTTGGGGTTGGAGGAGGG - Intergenic
1058421731 9:104839060-104839082 CTGTGGTTGGAAATGGAGAAAGG + Intronic
1058617815 9:106852534-106852556 CTGTGTTTGTGTTTGGAGGCTGG - Intergenic
1058820758 9:108727618-108727640 CCCTGATGGGGGATGGAGGAGGG - Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059874910 9:118623670-118623692 CTAGGGTTGGGGATGGGGGAAGG + Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061415974 9:130447002-130447024 TTGTCTTTGGTGATGGACGAAGG - Intronic
1061702283 9:132424857-132424879 CCGTGTTTGGGAGAGGAGGAGGG - Intronic
1061909397 9:133714807-133714829 CTGGGTTTGGGGATGGCCCAGGG + Intronic
1061946255 9:133909809-133909831 ATGTGTTTTGGGATGTAAGAGGG - Intronic
1062014880 9:134286435-134286457 CACTGTTTGGGGGTGGGGGATGG - Intergenic
1062132719 9:134908626-134908648 CTGGCTTTGGGGTTGGGGGAAGG + Intronic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062445270 9:136591052-136591074 CTGAGTGTGTGGTTGGAGGAAGG + Intergenic
1062565917 9:137163958-137163980 CGGCCTTCGGGGATGGAGGAGGG - Intronic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186364036 X:8873111-8873133 CTCTGTTTGGGTAGGGATGATGG - Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186489345 X:9959436-9959458 CTGGCTTTGCGGATGGAGGAAGG - Intergenic
1186501597 X:10055258-10055280 CTGCCTTTGAGAATGGAGGAAGG + Intronic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187203309 X:17157025-17157047 GTGTGTATGTGTATGGAGGATGG + Intergenic
1187485753 X:19701550-19701572 TTGTGTTAGGTGCTGGAGGAAGG - Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187951649 X:24476589-24476611 CTGTGTTTGGGGGTGGGGAGGGG - Intronic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189311788 X:40024199-40024221 CTTTGTTTGGGGTTGGATGGAGG + Intergenic
1189377244 X:40475446-40475468 CTTTGTTTGGGGTTGGATGGAGG + Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1189862397 X:45286914-45286936 CTGTGTTTGGGAAGGAGGGAAGG + Intergenic
1189914498 X:45843492-45843514 CTGTCCTTGGGGATAGAAGAGGG + Intergenic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190328988 X:49224262-49224284 TTCTCTTTGGGGATTGAGGATGG + Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191164048 X:57368225-57368247 CTGGGTTTGGGGGTGGGGGTGGG - Intronic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192221235 X:69198703-69198725 CTGAGGTTGGGAATGGTGGAGGG - Intergenic
1192236334 X:69298499-69298521 CTCTATTTGGTGCTGGAGGATGG - Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1192261902 X:69510617-69510639 CCCTGTTTGGGGGTAGAGGAAGG + Intronic
1193046551 X:77060565-77060587 CTGTGGTTGGGGTCGGAGGTAGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194877670 X:99209060-99209082 CACTGTTGGGGGATGGAGGAGGG + Intergenic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195780305 X:108455101-108455123 GGTTATTTGGGGATGGAGGATGG - Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1196708367 X:118737244-118737266 ATGGGGTTGGGGATGAAGGATGG + Intronic
1196843982 X:119883892-119883914 GAGTCTTTGGGGTTGGAGGAAGG - Intergenic
1196852048 X:119947047-119947069 CTGTGATTTGGGATGGAGATTGG + Intergenic
1196881543 X:120202844-120202866 CTCTCTCTGGGGATGGCGGAGGG - Intergenic
1197013836 X:121599945-121599967 GTGTGCTTGAGGATGGGGGATGG - Intergenic
1197015940 X:121626524-121626546 CTCTGTTTGTGGTTGGGGGAGGG - Intergenic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1197411086 X:126117211-126117233 CTGGGTTTGGGGAGAGAGGTGGG - Intergenic
1197498013 X:127209610-127209632 CTGTCTTTGAAGATGAAGGAAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198183993 X:134236749-134236771 GTGTGCGTGGGGATGGAGGGTGG + Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1198651748 X:138870771-138870793 CTGGCTTTGGAGATGTAGGAAGG + Intronic
1198654206 X:138895982-138896004 CAGAGGTTGGGGATGGAAGAAGG + Intronic
1198822102 X:140659453-140659475 CTCTGTTTGGGAAGTGAGGAGGG - Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199534422 X:148886003-148886025 CTTTGTTTTGGGATGAAGGGGGG + Intronic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199802421 X:151264915-151264937 CTGGCTTTGGAGATAGAGGAAGG - Intergenic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1201158702 Y:11153280-11153302 CTGTCATTGGGGATGGAGAGGGG + Intergenic
1201279848 Y:12332255-12332277 CTTTGATTGGGGATTCAGGAGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202104660 Y:21350611-21350633 TAGTGTGTGGGGATGGGGGAGGG - Intergenic