ID: 1094047244

View in Genome Browser
Species Human (GRCh38)
Location 12:26180554-26180576
Sequence AAGCACAGGGGACAGTTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 469}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094047244 Original CRISPR AAGCACAGGGGACAGTTAAG GGG (reversed) Intronic
900520334 1:3102291-3102313 AACCAGAGGGGACAGCTAGGAGG - Intronic
902903142 1:19534060-19534082 AAGCAGAGAGGCCAGTGAAGAGG + Intergenic
903291752 1:22318535-22318557 ATGCACAGGGGAGAGCTGAGAGG - Intergenic
904204768 1:28847021-28847043 AAGGAAAGGGGACAGGAAAGGGG - Intronic
904204776 1:28847045-28847067 AAGGAAAGGGGACAGGAAAGGGG - Intronic
904633823 1:31864199-31864221 AAGCACCAGGGTCAGTCAAGAGG + Intergenic
905213662 1:36391609-36391631 AGGCAAAGGGCAGAGTTAAGGGG + Intronic
905541090 1:38761002-38761024 AAGCACAGTTTACAGTTGAGAGG - Intergenic
905789092 1:40780927-40780949 AAGCACAGGTCACAGTTCTGGGG + Intergenic
905790239 1:40785578-40785600 AAGGACTGCGGACAGTTAGGTGG - Intronic
906545842 1:46618813-46618835 AAGGACAGGGGGCAAGTAAGAGG + Intergenic
907261592 1:53222329-53222351 AAGGAGAGGGGAAAGTAAAGAGG + Intergenic
910170211 1:84369072-84369094 AACCACAGGAGCCAGTCAAGAGG - Intronic
911343996 1:96674376-96674398 AAGCAGAGGGAAGAGTAAAGGGG - Intergenic
911412320 1:97525156-97525178 AAGCAAAGGGATGAGTTAAGAGG - Intronic
911593165 1:99770840-99770862 ATGCACAGGGGAGAATTCAGTGG + Intergenic
912036642 1:105324781-105324803 AAGCAGAGGGGAAAGTTAAGGGG - Intergenic
912549182 1:110473604-110473626 AAGCACTGGGGTCAGTCAGGAGG + Intergenic
913706910 1:121434480-121434502 AAGCAGAGGGAAAAGTAAAGAGG + Intergenic
914374264 1:147059731-147059753 AAGCACAGGGATCAGTTAATAGG + Intergenic
915030650 1:152877948-152877970 AAGCACAGGGGTCAGGTTTGGGG - Intergenic
915147512 1:153803751-153803773 GAGCACAGGAGACAGTTTTGGGG - Intergenic
915856833 1:159397362-159397384 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
918384394 1:183990839-183990861 AGGCACAGGACACAGTGAAGAGG + Intronic
918590386 1:186234547-186234569 AAGCAGATAGCACAGTTAAGCGG + Intergenic
921238757 1:213154785-213154807 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
921348355 1:214209838-214209860 AAGAACACAGAACAGTTAAGTGG - Intergenic
921458996 1:215406781-215406803 ATGCACAGAAGCCAGTTAAGGGG + Intergenic
921634580 1:217477335-217477357 AAGCAGAGGGAAAAGTAAAGAGG + Intronic
922358109 1:224795706-224795728 AAGCAGAGGGAACAGTAAAGGGG - Intergenic
922377144 1:224980102-224980124 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
923040394 1:230315557-230315579 AAACACATGGGCCAGTTTAGGGG - Intergenic
923143330 1:231179974-231179996 AGGCACAGGAGAAAGTTGAGAGG - Intronic
924592989 1:245421185-245421207 AAAGACAGGGAACAGTTATGAGG + Intronic
924793274 1:247272615-247272637 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1063428288 10:5966353-5966375 GAGGACAGGGGACGGTGAAGAGG + Intronic
1063713628 10:8505688-8505710 CAGCAGAGGGGACTGTTCAGGGG + Intergenic
1063953701 10:11247088-11247110 AGGCAGGGAGGACAGTTAAGAGG - Intronic
1064698099 10:17988421-17988443 AATCACAGTAGACAGTGAAGGGG - Intronic
1064970666 10:21063215-21063237 AAGCACAGCTGACAGGTATGGGG - Intronic
1065076736 10:22087550-22087572 CAGCACTGGGTACGGTTAAGGGG + Intergenic
1065401874 10:25313230-25313252 AAGCACTGGGGACTGTTGTGGGG + Intronic
1065467761 10:26043848-26043870 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
1065637146 10:27744121-27744143 AAGGACAGGAAAAAGTTAAGTGG + Intronic
1066084509 10:31963222-31963244 AAGCAGAGGGGAAAGTAAAGAGG + Intergenic
1066362971 10:34748712-34748734 AACCACAAGGAACAGTGAAGTGG + Intronic
1066649718 10:37642892-37642914 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1066708237 10:38203963-38203985 AAGCCGAGGGAAGAGTTAAGAGG + Intergenic
1066735230 10:38470484-38470506 AAGCAGAGGGAACATTTAGGAGG + Intergenic
1066981268 10:42418620-42418642 AAGCTGAGGGAAGAGTTAAGAGG - Intergenic
1067032604 10:42888439-42888461 AAGCAGAGGGGAAAGTAAAGGGG - Intergenic
1067046998 10:42990564-42990586 AAGCAGAGGGGTCAGGAAAGGGG - Intergenic
1067321116 10:45222195-45222217 AAACACAGGGAACAATTAACTGG - Intergenic
1068430487 10:56925365-56925387 AAGCACAGGGGCCAGATAGATGG - Intergenic
1070459058 10:76646463-76646485 AAGCACAGCAGACAGATAAGTGG + Intergenic
1070736179 10:78865316-78865338 CAGCAGAGGGGACAGTGAGGGGG - Intergenic
1070902119 10:80038858-80038880 AAGCACAGGGGACCAGAAAGAGG + Intergenic
1071046700 10:81387603-81387625 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1071209166 10:83317786-83317808 AAGCAAAGGGAAAAGTAAAGAGG + Intergenic
1071869747 10:89781012-89781034 AAGCACAGGGGAAAGTAAAGGGG - Intergenic
1072607045 10:96993111-96993133 AAGGACAGGGCACAGAGAAGAGG - Intergenic
1073484230 10:103806485-103806507 AAGAACAGGTGACAGGGAAGGGG + Intronic
1073692820 10:105829968-105829990 AATCACAGTGGAAAGTGAAGGGG + Intergenic
1074245222 10:111683629-111683651 AAGAACAGAGGACAGTTGAAAGG - Intergenic
1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG + Exonic
1074803520 10:117026029-117026051 AAGCAGAGGGAAAACTTAAGGGG + Intronic
1074951329 10:118339990-118340012 AAAAACAGGGTACAGTTCAGTGG + Intronic
1075495475 10:122915516-122915538 TAGCACAGGTGACAGGGAAGAGG + Intergenic
1075594209 10:123716182-123716204 ATACACAAAGGACAGTTAAGTGG + Intronic
1076094610 10:127720971-127720993 AAGCAAAGGGAAAAGTAAAGGGG + Intergenic
1077858868 11:6157585-6157607 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1079037923 11:17036904-17036926 AAGCAGAGGGAAAAGTAAAGAGG + Intergenic
1079712853 11:23708263-23708285 AAGCAGAGGGGAATGTAAAGAGG + Intergenic
1079784374 11:24653144-24653166 GAGCACAGAGGCCAGTTAGGAGG + Intronic
1079823383 11:25160129-25160151 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1080128531 11:28766339-28766361 GAGGAGAGGGGACAGTAAAGAGG + Intergenic
1080264661 11:30388357-30388379 AGGGAAGGGGGACAGTTAAGGGG + Intronic
1081678232 11:44983522-44983544 AAGCAGAGGTGGCAGTTATGTGG + Intergenic
1081884588 11:46483989-46484011 AAGTAGATGGGACAGTAAAGAGG + Intronic
1082790490 11:57343374-57343396 AAGCACAGGGTCCGGTTCAGGGG + Intronic
1083803877 11:65062228-65062250 AATCAGAGAGGCCAGTTAAGAGG - Intergenic
1087417139 11:97871598-97871620 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1087887582 11:103497920-103497942 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1087950820 11:104218766-104218788 AAGCACAGGGAAAAGTAAAGGGG - Intergenic
1088154852 11:106790523-106790545 AAGCAGAGGGGAAAGTAAAAGGG - Intronic
1090056961 11:123431600-123431622 AAGGCCAGAGAACAGTTAAGTGG + Intronic
1090447941 11:126780133-126780155 AAGCACAGGGGAGAGACAAGCGG + Intronic
1091037690 11:132248265-132248287 AAGCAGATGGGAAAGTTCAGGGG - Intronic
1091184371 11:133634564-133634586 CAGCAAACGGGACAGGTAAGAGG - Intergenic
1091362413 11:134987944-134987966 AAGGACAGGGGAAGGTTCAGTGG + Intergenic
1092835433 12:12483654-12483676 GAGCCCAGGAGACAGTGAAGAGG + Intronic
1093965701 12:25322706-25322728 AAGCAGAGGGGACATTAAAATGG + Intergenic
1094047244 12:26180554-26180576 AAGCACAGGGGACAGTTAAGGGG - Intronic
1094658196 12:32441179-32441201 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
1094670998 12:32569217-32569239 AAGCAGGGTGGACAATTAAGAGG - Intronic
1095099520 12:38165960-38165982 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1095181765 12:39154403-39154425 AAGCAAAGGGAAAAGTAAAGAGG - Intergenic
1095238809 12:39832692-39832714 AAGTAGAGGGGTCAGTTAACTGG - Intronic
1096005224 12:48164744-48164766 AAGCCCTGGGGAAAGTTAAAAGG - Intronic
1096226335 12:49869008-49869030 CAGCACAGGGGAGAGAGAAGAGG + Exonic
1097466237 12:59928345-59928367 AAGCAGAGGGAACAGTAAAGGGG + Intergenic
1097473235 12:60021651-60021673 AAGCAGAGGGAATAGTAAAGGGG - Intergenic
1097919948 12:65061058-65061080 AAGTACAGGGGAAAATTGAGGGG + Intronic
1098395309 12:70010950-70010972 AAGCAGAGGGGAAAGTAAAGGGG + Intergenic
1098405693 12:70123688-70123710 AAGCACAGGGAAAAGTAAAGGGG + Intergenic
1098720528 12:73891988-73892010 AAGCAGAGAGGCCAGTTAGGTGG - Intergenic
1099122350 12:78706947-78706969 AAGCACAGAGACCAGTTAGGAGG + Intergenic
1099495310 12:83339637-83339659 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1099523323 12:83690192-83690214 AAGAACAGGGAAGAGTAAAGGGG + Intergenic
1099524778 12:83705820-83705842 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1099941581 12:89195377-89195399 AAGCAAATGGGACACTTGAGGGG - Intergenic
1102898947 12:116621170-116621192 AAGAAAAGGAGCCAGTTAAGGGG + Intergenic
1103468020 12:121157457-121157479 GAGCAGCAGGGACAGTTAAGGGG - Intronic
1104073207 12:125365313-125365335 AAGGACATGGGATGGTTAAGTGG - Intronic
1104145377 12:126029046-126029068 AATCACAGTGGAAAGTGAAGGGG + Intergenic
1107210865 13:37852577-37852599 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1107807875 13:44171946-44171968 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1108171618 13:47747933-47747955 AATCACAGGGGAGAGTACAGAGG - Intergenic
1110015708 13:70398904-70398926 AAGTACAGAGGACACTTGAGAGG - Intergenic
1110144294 13:72170495-72170517 CAGTCCTGGGGACAGTTAAGGGG + Intergenic
1110870233 13:80443777-80443799 AAGCACAGAGAAATGTTAAGAGG - Intergenic
1112113017 13:96323466-96323488 AAGCAAAGGTGAAAGTCAAGAGG - Intronic
1112167644 13:96936627-96936649 AGACAAAGTGGACAGTTAAGTGG + Intergenic
1112616813 13:101014867-101014889 ATGCTCTGGGGACAGATAAGAGG - Intergenic
1114248068 14:20933444-20933466 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1114250899 14:20959523-20959545 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1114653670 14:24303066-24303088 AAACACAGGGGACAGCTGATGGG - Exonic
1114703993 14:24707140-24707162 AAGAACAGGGGACAGATACAAGG + Intergenic
1114829638 14:26124975-26124997 AAGCACAGGGGCCAGCTAGCTGG - Intergenic
1114851970 14:26392656-26392678 AAGCACCGGGGTCAGTCAGGAGG + Intergenic
1116004309 14:39276096-39276118 AAGAAAAGGGGAAAGGTAAGGGG - Intronic
1116141087 14:40995167-40995189 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1116453886 14:45095284-45095306 CAGCACAGGCAACAGTTCAGAGG + Exonic
1117159374 14:52973704-52973726 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1117208462 14:53470056-53470078 AAGCAGAGGGAAGAGTAAAGGGG - Intergenic
1117917845 14:60696748-60696770 CAGAACAGGGGACAGTGAAAGGG - Intergenic
1117998478 14:61500540-61500562 AAGCACGGTGGAAAGTTAATTGG + Intronic
1118894025 14:69930981-69931003 ATGCAAAATGGACAGTTAAGAGG - Intronic
1118956654 14:70489016-70489038 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1119851218 14:77867946-77867968 AAGCACAGCTGACAGTGAACTGG - Intronic
1119883853 14:78123777-78123799 AAGCAGAGAGGCCAGTCAAGAGG - Intergenic
1121759768 14:96435134-96435156 AAGCAGAGGGAACAGTAAAGGGG - Intronic
1122706927 14:103627802-103627824 GAGCAGAGGGGACAGTTACTGGG + Intronic
1124119380 15:26875960-26875982 ATGCAGTGGGGACAGTGAAGAGG + Intronic
1124159150 15:27253364-27253386 AAGGAGAGGGGACAGGAAAGGGG - Intronic
1124844269 15:33275357-33275379 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1126183780 15:45811105-45811127 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1126288824 15:47047773-47047795 AGGCACTGGGGACAGGGAAGTGG + Intergenic
1127173439 15:56328096-56328118 AAGGAGAGGGGAAAGTAAAGAGG + Intronic
1127178017 15:56382392-56382414 AAGCAAAGGGAAAAGTAAAGGGG - Intronic
1127493227 15:59484734-59484756 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1127755288 15:62086112-62086134 AAACAAAGAGGCCAGTTAAGAGG + Intergenic
1128748299 15:70130393-70130415 AGGCACAGAGGTCAGGTAAGAGG + Intergenic
1128901055 15:71423221-71423243 AAGCAGAGGGAAGAGTAAAGGGG - Intronic
1130183392 15:81653289-81653311 AAGCACAGGGGAGACTTCAGGGG - Intergenic
1131670943 15:94619022-94619044 AAGAACAGGAGAGAGATAAGAGG + Intergenic
1133287946 16:4699182-4699204 AGGCACAGGGGACAGGTTGGGGG + Intronic
1133450415 16:5899424-5899446 ATGAACAGGGCACAGTTAAAAGG + Intergenic
1133979139 16:10620553-10620575 AAGCACAGAGCACCCTTAAGAGG + Intergenic
1134363386 16:13553768-13553790 AAGCACAGTGAACAGTTTGGTGG - Intergenic
1134657716 16:15959717-15959739 AAACTAAGGGGACACTTAAGTGG - Intronic
1135422998 16:22317085-22317107 AAGCAGAGGGGACGGGTTAGAGG - Intronic
1137555163 16:49465593-49465615 AACCTCAGGGGATAGTTCAGGGG + Intergenic
1138472497 16:57249290-57249312 AATCCCAGGGGGCTGTTAAGAGG - Intronic
1139064567 16:63296832-63296854 AAGCACAGTGGATATTAAAGTGG + Intergenic
1140098654 16:71895858-71895880 AAGACTAGGGGAAAGTTAAGGGG - Intronic
1143041655 17:4042633-4042655 CAGCACAGGGGACAGTGCAGTGG - Intronic
1143764620 17:9129330-9129352 AAGCAGAGGGAACAGCTGAGGGG + Intronic
1143859306 17:9876429-9876451 ATGCACAGTGGACAGTCATGGGG + Intronic
1144414201 17:15031069-15031091 AAGCATGGGGGACAATGAAGAGG - Intergenic
1144853378 17:18255148-18255170 TAGCACAGGGGCCAGGTGAGTGG + Intronic
1144939419 17:18927341-18927363 AAAGACAGGGGACAGATCAGTGG - Intronic
1145117452 17:20224829-20224851 AAGCAGAGGGAAGAGTAAAGGGG - Intronic
1146268749 17:31470705-31470727 TACCACACAGGACAGTTAAGAGG - Intronic
1146428031 17:32762499-32762521 AAGCAAAGAGGTCAATTAAGGGG - Intronic
1146749924 17:35369104-35369126 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1147046742 17:37758042-37758064 AAGGGCAGGGGACAGTGAAAAGG + Intergenic
1147991261 17:44334969-44334991 AAGCTCAGCAGACAGTGAAGAGG + Intergenic
1149234896 17:54578279-54578301 AAGCAGAGGGAAGAGTAAAGGGG + Intergenic
1149740210 17:59038196-59038218 AAGCACAGCCTACATTTAAGGGG + Intronic
1152014816 17:77743652-77743674 AAGAACTGGGGACAGACAAGAGG + Intergenic
1153099624 18:1451733-1451755 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1153418898 18:4882244-4882266 ATACACAGGGGCCAGTCAAGGGG - Intergenic
1156163234 18:34385418-34385440 AACCACAGGGAACAGAAAAGAGG - Intergenic
1156851063 18:41726617-41726639 AAGCACAGAAGGAAGTTAAGGGG + Intergenic
1158024990 18:52885691-52885713 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
1159080631 18:63731541-63731563 AAGCAGAGGGGAAAGTAAAGGGG + Intergenic
1159564963 18:70037724-70037746 AAGCAGAGGGGAAAGTAAAGGGG + Intronic
1159595809 18:70381762-70381784 AAGAGCTGGGGACAGTGAAGAGG - Intergenic
1160108836 18:76005946-76005968 AAGAAGAGGGGACAGCTAGGGGG - Intergenic
1160333809 18:78018818-78018840 AAGCACAGGAGAAAGTCCAGGGG - Intergenic
1160525270 18:79532151-79532173 AGGCACAGGGGACAGCCACGGGG - Intergenic
1163796393 19:19340730-19340752 CACCTCAGGGGACAGTTCAGTGG - Intronic
1164491077 19:28714783-28714805 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1165246851 19:34502894-34502916 AAGCAGAGAGGACAGTTCAGAGG - Exonic
925735116 2:6957187-6957209 AAGCACGTGGGACAGAGAAGGGG - Intronic
926600910 2:14844514-14844536 AAGCAAAGGGAAAAGTAAAGGGG + Intergenic
927011365 2:18907982-18908004 CAGGAAAGGGGACAGTTCAGTGG + Intergenic
927865052 2:26582923-26582945 GAGCACAGAAGACAGTTGAGTGG + Intronic
928864038 2:35895923-35895945 AAGGAGAGGGGAGAGTAAAGAGG - Intergenic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
930710849 2:54549867-54549889 TAGCAGAGGGGACAGTTAGGAGG + Intronic
931161939 2:59702384-59702406 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
932216052 2:69966476-69966498 AAGCAGAGGGGACCCTGAAGAGG - Intergenic
932876403 2:75456769-75456791 AAGCACAGCTGACTGTTGAGTGG + Intergenic
932993923 2:76825271-76825293 AAGCAGAGAGGACAGTTAAGAGG + Intronic
934843487 2:97646295-97646317 AGGCACTGGGGACCGTAAAGCGG - Intronic
935371504 2:102351764-102351786 AAGTACAGGGGACCATCAAGTGG + Exonic
935437864 2:103056131-103056153 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
935525140 2:104156508-104156530 AAGAACAGTGGACAGTGAGGAGG + Intergenic
935662846 2:105484867-105484889 AAACACAGGGGAGAGTCCAGTGG - Intergenic
936825439 2:116576450-116576472 AAGCAGAGGGGAAAGTAAAAAGG - Intergenic
937105834 2:119311890-119311912 AAGCAGTGGGGACAGTTCTGTGG + Intronic
937512505 2:122611871-122611893 AAGCAGAGGGAAAAGTAAAGAGG + Intergenic
937617598 2:123944390-123944412 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
939273596 2:139971085-139971107 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
939274172 2:139978487-139978509 AAGCACAGGGGAAAGAAGAGGGG + Intergenic
939800423 2:146700544-146700566 AAGCAAAGGGAAAAGTAAAGGGG + Intergenic
942672257 2:178388579-178388601 AAGCACAGATGGCAGATAAGAGG - Intronic
942734712 2:179096834-179096856 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
942957546 2:181791106-181791128 AAGCACAGGTCATAGTTCAGGGG - Intergenic
943120425 2:183727953-183727975 AAGTACAGGAGACAGAGAAGTGG - Intergenic
944078599 2:195759507-195759529 AAGCACAGGGAAGAGTAAAGGGG + Intronic
944096702 2:195976030-195976052 AAGCAGAGGGAAGAGTAAAGAGG + Intronic
944557274 2:200900026-200900048 AAGCAAAGGGTACAGGAAAGGGG - Intronic
944616403 2:201465127-201465149 GAGGAGAGGGGACAGTAAAGGGG - Intronic
944661009 2:201921549-201921571 AGGCAGAGGGGACAGTGATGGGG - Intergenic
945078510 2:206065131-206065153 AAACACAGGGGACACTGATGTGG + Intronic
945754457 2:213829530-213829552 AAGCAGAGGGAAGAGTAAAGGGG - Intronic
948396176 2:237647061-237647083 AAGCAGAGGATACTGTTAAGTGG - Intronic
948475494 2:238216357-238216379 AAGCAGAGGGAAGAGTAAAGGGG - Intergenic
1169755159 20:9035685-9035707 AAGCAAAGGGGACAGGGAAAGGG + Intergenic
1169942297 20:10950389-10950411 GAGCACAGGGTACAGTGCAGAGG - Intergenic
1170568612 20:17620649-17620671 AAGCCCAGGGGAGAGTTGACAGG - Intronic
1170668388 20:18406659-18406681 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1170980869 20:21211640-21211662 AAGCTCAGAGAACAGTTAACAGG - Intronic
1171135413 20:22690767-22690789 AAGGTCAGGGGACAGTGAAGTGG - Intergenic
1171334197 20:24368657-24368679 CAGCCCATTGGACAGTTAAGTGG + Intergenic
1171540844 20:25954363-25954385 AGGCACTGGGGACAGGGAAGTGG - Intergenic
1171800219 20:29605947-29605969 AGGCACTGGGGACAGGGAAGTGG + Intergenic
1171843876 20:30250756-30250778 AGGCACTGGGGACAGGGAAGTGG - Intergenic
1171942853 20:31348328-31348350 AAGAAGAGGGGAGAGTAAAGGGG + Intergenic
1172443005 20:34978942-34978964 GAGCACAGGTTACAGTTAGGAGG + Intronic
1172445326 20:34990371-34990393 AGGCACAGGGGACAGGGCAGGGG - Intronic
1172785728 20:37467273-37467295 AGGGACAGGGGACAGATCAGTGG + Intergenic
1173147675 20:40538890-40538912 AAGCACAGGGCACAGTTCTTGGG + Intergenic
1173405870 20:42764216-42764238 AAGCACTGGGGACATTTACAAGG + Intronic
1175943719 20:62549374-62549396 AGGCACTGGGGACATTTATGAGG + Intergenic
1177577951 21:22982867-22982889 AAGCAGAGGGAAGAGTGAAGGGG + Intergenic
1178565258 21:33678070-33678092 AAGCACAGAGGCCAGACAAGTGG - Intronic
1179820359 21:43933697-43933719 CAGCACAGGGGAAAGGTGAGGGG + Intronic
1181014456 22:20061209-20061231 AGGCAAAGGGGACAGCCAAGAGG - Intronic
1181052778 22:20245613-20245635 GAGCCCAGGGGACAGGTCAGGGG - Intronic
1181492597 22:23269817-23269839 AAGAACAGGTTACAGTTAAGCGG + Intronic
1181825643 22:25513282-25513304 AAGCAATGGAGACAGTAAAGAGG - Intergenic
1182880383 22:33727940-33727962 AAGGACTGGGGACAGGTAAGGGG + Intronic
1184474154 22:44711638-44711660 AGGCAGAGGGGACAGTGCAGCGG - Intronic
1184668209 22:45999518-45999540 AATGACAGGGGACAGCTCAGAGG + Intergenic
949155883 3:826965-826987 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
949448531 3:4161834-4161856 AAGCATAGGGAAGAGTAAAGGGG - Intronic
950695639 3:14699283-14699305 AAGCAGAGGGAAAAGTAAAGAGG - Intronic
951102316 3:18703363-18703385 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
951279543 3:20731581-20731603 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
951448918 3:22814472-22814494 AAGCACAGAGGCCACTTAAGTGG + Intergenic
951904300 3:27688767-27688789 AAGCAGAGGGAAAAGTAAAGAGG + Intergenic
952341705 3:32452605-32452627 GAGCACAGGGGCCAGCAAAGGGG + Intronic
953309525 3:41863477-41863499 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
953362402 3:42309519-42309541 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
953722581 3:45369218-45369240 AAGCAGAGGGAAAAGTAAAGAGG + Intergenic
956664882 3:71632724-71632746 AAGCAGAGAGGACAATGAAGAGG + Intergenic
957073910 3:75586376-75586398 AAACACAGGGGACAGAGAAAGGG + Intergenic
958054898 3:88396822-88396844 AATTAGAGAGGACAGTTAAGCGG + Intergenic
958757838 3:98271666-98271688 AAGCATAGGGAAAAGTAAAGGGG - Intergenic
958876683 3:99624813-99624835 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
958913549 3:100022634-100022656 AAGCACAGGGGAAAAGAAAGAGG + Intronic
959279253 3:104317023-104317045 AAGCAGAAGGAAAAGTTAAGAGG + Intergenic
959448288 3:106467284-106467306 AAGCAGAGGGAAGAGTAAAGTGG - Intergenic
959688155 3:109170106-109170128 AAGCACCAGGGTCAGTTAGGAGG + Intergenic
959945975 3:112125666-112125688 TAGCACAGGAGACAGACAAGGGG + Intronic
960490755 3:118314151-118314173 AAGCAAAGGGAAGAGTAAAGTGG + Intergenic
960564919 3:119122959-119122981 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
961868392 3:129971270-129971292 AAGCACCGGGGTCAGTCAGGAGG + Intergenic
961964428 3:130887861-130887883 AAGCAGAGGGGAAAGTAAAGAGG - Intronic
962078726 3:132114556-132114578 AAGCAGAGGGAAGAGTAAAGGGG - Intronic
962351605 3:134660362-134660384 AGCCACAGGGGATAGTTGAGTGG + Intronic
962714204 3:138113380-138113402 AAGCAGAAGAGACAGTAAAGTGG - Intronic
962759125 3:138492715-138492737 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
962789069 3:138794355-138794377 AAGCACAAAAGTCAGTTAAGAGG + Intronic
963448050 3:145440113-145440135 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
964059594 3:152505386-152505408 AAGCACAGGGCAAAGTAAAGGGG - Intergenic
965091420 3:164167826-164167848 AAGCACACAGGACAATTTAGGGG + Intergenic
965322270 3:167265110-167265132 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
965342467 3:167507140-167507162 AAGCACAATGCACATTTAAGAGG + Intronic
965350915 3:167610150-167610172 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
966582491 3:181583869-181583891 TATCTCAGGGGACAGTTATGAGG - Intergenic
967514696 3:190353261-190353283 AAGCAAAGAGATCAGTTAAGGGG - Intronic
967544687 3:190711058-190711080 TAACACAGGGGACAAGTAAGGGG - Intergenic
968133301 3:196205440-196205462 AAGGACAGAGGACAGATCAGTGG + Intronic
968136024 3:196220107-196220129 AAGAGCAGGGGACAATTGAGAGG + Intronic
969274322 4:6124779-6124801 AAGTACTGGGGACAGTTAGAAGG - Intronic
969402170 4:6962827-6962849 AGGCACAGGGGTCAGGTAACGGG - Intronic
969719607 4:8886088-8886110 AGGCACAGGGGAGTTTTAAGAGG - Intergenic
971126194 4:23757879-23757901 AAAAACAGGGGACAGAAAAGGGG + Intronic
971255346 4:25009002-25009024 AAGCACAGTGGCTAGCTAAGAGG - Intronic
972278435 4:37581271-37581293 AAGCAGAGGGAAAAGTAAAGTGG - Intronic
972468771 4:39384107-39384129 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
972902370 4:43700608-43700630 AAGCAGAGGGAAGAGTAAAGAGG - Intergenic
973053916 4:45630464-45630486 AAGCAAAGGGAAAAGTAAAGGGG + Intergenic
975369496 4:73568271-73568293 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
975962764 4:79933112-79933134 TAACACAGAGGACTGTTAAGTGG + Intronic
976016423 4:80560425-80560447 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
976030016 4:80741074-80741096 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
976593131 4:86869294-86869316 AAGCAAGGAGGTCAGTTAAGAGG + Intergenic
976976457 4:91170746-91170768 AAAATCAGGGGACAATTAAGTGG - Intronic
976982069 4:91243876-91243898 AAGCAGAGGGAAAAGTAAAGAGG + Intronic
977347520 4:95836078-95836100 AATAACATGGTACAGTTAAGAGG + Intergenic
978102334 4:104857546-104857568 AGGGACAGGGGAAAGATAAGGGG + Intergenic
978315596 4:107433066-107433088 AAGCAGAGAGGCCTGTTAAGAGG - Intergenic
978922430 4:114200737-114200759 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
979213285 4:118132597-118132619 AAGCATAGGGAAAAGTAAAGGGG - Intronic
979261583 4:118653424-118653446 AAGCAGAGGGAACATTTAGGAGG + Intergenic
979373402 4:119915807-119915829 AAGCAGAGAGAACAGTTAAAAGG + Intergenic
980141010 4:128917166-128917188 AAGCACTGGGGTCAGTCACGAGG - Intronic
980291450 4:130851237-130851259 AAGCACAGAGGGCAGTGAACAGG - Intergenic
980686835 4:136240319-136240341 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
981518357 4:145634594-145634616 AAGCAAAGGGAAAAGTAAAGAGG - Intronic
982190584 4:152850861-152850883 AAGCAGAGAGGCCACTTAAGGGG + Intronic
983150250 4:164269909-164269931 AAGCAGAGGGAACATTTAGGAGG - Intronic
984529762 4:180901981-180902003 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
986657576 5:10030617-10030639 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
987007501 5:13725306-13725328 AGGCAAAGAGGACAGCTAAGTGG + Intronic
987073859 5:14362146-14362168 AAGCACAGAGGACAGTACAGTGG + Intronic
987130400 5:14854862-14854884 AGGCACAGAGACCAGTTAAGAGG - Intronic
988878820 5:35477534-35477556 AAGCTCAGTGGACATATAAGTGG + Intergenic
988956321 5:36323894-36323916 AAGCAGAGGGAAAAGTAAAGAGG - Intergenic
989681247 5:44032162-44032184 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
989970754 5:50521415-50521437 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
990907816 5:60822553-60822575 AAGCCCAGGGGACATTCAGGTGG + Intronic
991107464 5:62860970-62860992 AAGCACAGGGAAAAGTGAAGGGG - Intergenic
991663623 5:68974545-68974567 AAGCAGAGGGGAAAGTAAAGGGG + Intergenic
991740416 5:69666823-69666845 AAGCACAGGGGCCAGGTGAAAGG + Intergenic
991791991 5:70246564-70246586 AAGCACAGGGGCCAGGTGAAAGG + Intergenic
992454238 5:76901740-76901762 AAGCAGAGGGTAAAGTAAAGGGG - Intronic
993059211 5:83018608-83018630 AAGCACAGAGTACAGTTAAGAGG + Intergenic
993267439 5:85744254-85744276 AAGCATAGTGAACAGTAAAGGGG - Intergenic
993682920 5:90901952-90901974 AAGCAGAGAGGACAGTTTAGAGG + Intronic
994627769 5:102242817-102242839 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
994633936 5:102320742-102320764 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
994813863 5:104557987-104558009 AATCACAGTGGAAAGTGAAGGGG + Intergenic
994919791 5:106029406-106029428 AAGCACAAAGACCAGTTAAGAGG - Intergenic
995383169 5:111558698-111558720 ATGCACATGGGACATTTTAGAGG - Intergenic
995514832 5:112944043-112944065 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
995557546 5:113344904-113344926 AAGCAGAGAGGAAAGTAAAGAGG + Intronic
995777970 5:115745918-115745940 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
996292288 5:121866379-121866401 AAACACATGGCACAGTCAAGTGG - Intergenic
996369850 5:122741629-122741651 AAGCTGAGGGAACAGTTGAGAGG - Intergenic
998286730 5:140870056-140870078 AAGTACAGGCTACAGATAAGGGG + Exonic
998493500 5:142566937-142566959 AAGCCAAGGGGACAGGTAGGTGG + Intergenic
999215935 5:149935044-149935066 AAACCCAGGGTACAGCTAAGAGG + Intronic
999660504 5:153857631-153857653 AAGCACAGGATCCAGTTAAGTGG + Intergenic
999667420 5:153927517-153927539 AAGCAAAGGGAAAAGTAAAGAGG + Intergenic
999701243 5:154230454-154230476 CAGCACAGGGCACAGATAAGGGG + Intronic
999940524 5:156537688-156537710 AATCACAGGGCACATTTAGGAGG - Intronic
1000304679 5:159984523-159984545 AAGCACAGAGGTTAGTTAGGAGG - Intergenic
1001549909 5:172595300-172595322 AAGCACCAGGGCCAGTTGAGAGG + Intergenic
1002172578 5:177383759-177383781 AAGCGGAGGGGCCAGTTAAGAGG - Intronic
1002425347 5:179171641-179171663 AAGCACAGGAGGCAGTGATGGGG - Intronic
1006018630 6:31103398-31103420 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1006217848 6:32460347-32460369 AAGCGCAGGAGACAGTGATGAGG - Intergenic
1008017858 6:46541624-46541646 AAGCAAAGGGGAAAGTAAAGGGG + Intergenic
1008227290 6:48936355-48936377 AAGCAGAGGGGAAAGTAAAGGGG - Intergenic
1009371167 6:62905337-62905359 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1010483578 6:76382612-76382634 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1010528891 6:76942152-76942174 AAGCAGAGGGAAGAGTAAAGGGG + Intergenic
1011003361 6:82616472-82616494 AAGCTCTGGGGACAACTAAGTGG + Intergenic
1011535225 6:88369601-88369623 AAGCAGAGGAGACAGTCAGGAGG + Intergenic
1012003626 6:93685089-93685111 AAGCAGAGGGAAAAGTCAAGGGG + Intergenic
1012028619 6:94029731-94029753 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1012049941 6:94328664-94328686 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1012157648 6:95840151-95840173 AAGCACAGGGAGCAGTTAGTGGG - Intergenic
1012547515 6:100436301-100436323 AAGCACTGTGCACAGTTCAGAGG - Intronic
1012827343 6:104162945-104162967 AAGGAGAGGGGAGAGTAAAGGGG + Intergenic
1014582981 6:123161575-123161597 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1014585482 6:123193013-123193035 AAGAAGTGGGGACATTTAAGGGG - Intergenic
1015023394 6:128504243-128504265 AAGGGCAGGGGACAGAGAAGGGG - Intronic
1015907236 6:138129691-138129713 GAGGAGAGGGGACAGTAAAGAGG + Intergenic
1015959440 6:138631832-138631854 AAGCAGAGGGAAAAGTAAAGAGG + Intronic
1016136877 6:140554949-140554971 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1016151206 6:140745233-140745255 AAGCAGAGGGGAAAGTAAAGGGG + Intergenic
1016153990 6:140780915-140780937 AAGCAAAGGGAAAAGTAAAGGGG + Intergenic
1017387387 6:153901648-153901670 AAGCAAAGGGGAAAGTAAAGGGG + Intergenic
1017866828 6:158451209-158451231 AAGCAGGGGGGGCAGTTTAGAGG + Intronic
1019122184 6:169812184-169812206 GGGCACAGGGGAAAGTTGAGGGG - Intergenic
1020515001 7:9106973-9106995 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1021131015 7:16913181-16913203 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1021228980 7:18062598-18062620 AAGCAGAGAGACCAGTTAAGAGG + Intergenic
1021362636 7:19734509-19734531 AATCACAAGGGTCATTTAAGAGG + Intronic
1021382397 7:19983827-19983849 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1023282135 7:38581654-38581676 AAGGACAAGGGACGGTTAAGAGG + Intronic
1023646278 7:42319029-42319051 AAGCAAAGGGAATAGTAAAGGGG + Intergenic
1025292274 7:57740619-57740641 AGGCACTGGGGACAGGGAAGTGG - Intergenic
1026249607 7:68658006-68658028 AATCACAGTGGAAAGTGAAGGGG + Intergenic
1026405194 7:70057884-70057906 AAACACTGGGGAAACTTAAGAGG - Intronic
1027687434 7:81295056-81295078 GAGCACAGGGGAGAGTCAAGGGG - Intergenic
1028207552 7:88034077-88034099 AAGCAGAGGGAAGAGTAAAGGGG - Intronic
1029981760 7:104885677-104885699 AAGCAGAGAGGACAGTTAGAAGG - Intronic
1030222452 7:107110883-107110905 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1030340438 7:108373551-108373573 AAGCACAGGGGACAATAAGGTGG + Intronic
1030435916 7:109520491-109520513 AAACACAAGGGCCAATTAAGGGG - Intergenic
1030488644 7:110204041-110204063 AAGCAGAGGGGAAAGTAAAGGGG - Intergenic
1030740421 7:113102706-113102728 AAGCACTGAAGAGAGTTAAGTGG + Intergenic
1031442564 7:121812114-121812136 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1031990070 7:128191760-128191782 AATCACAGGGGAAGGTGAAGGGG - Intergenic
1032342935 7:131092824-131092846 AAGCACAGTGGACAGGGAGGTGG + Intergenic
1033172070 7:139093159-139093181 AATCAAAGGTGACAGATAAGAGG + Intronic
1033875402 7:145811073-145811095 AAGCAGAGGAAACAGTAAAGGGG + Intergenic
1035084518 7:156246944-156246966 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1036627204 8:10482110-10482132 AAGCACAGGGGAATGTTTTGGGG + Intergenic
1036998364 8:13687236-13687258 AAGGACAGCTGACAGTTAACAGG + Intergenic
1037040733 8:14228959-14228981 CAGCACAGAGCACTGTTAAGCGG + Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037340886 8:17843626-17843648 AAGGACAGGGAACAGTAACGGGG + Intergenic
1037404737 8:18529562-18529584 AAGCTTAGGGGACAGTAAAGTGG - Exonic
1038050991 8:23811471-23811493 AAGCACCGGTGTCAGTTAAGAGG + Intergenic
1039078887 8:33716740-33716762 AAGCATAAGGGCCAGTTGAGGGG + Intergenic
1039399677 8:37258910-37258932 AAGCACAGGCAACAGTTGAGGGG + Intergenic
1039892414 8:41694435-41694457 AAGCTCAAAGGAGAGTTAAGTGG - Intronic
1040666138 8:49635843-49635865 GAGCACAGGGGTAAGTAAAGTGG - Intergenic
1041097293 8:54362248-54362270 AAGCACAGGAGAGGGATAAGAGG + Intergenic
1041615983 8:59907271-59907293 GAGGAGAGGGGAGAGTTAAGAGG + Intergenic
1041847094 8:62341901-62341923 AAGCACAGAGAAAAGTTAAATGG - Intronic
1041869258 8:62615031-62615053 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
1043024975 8:75055211-75055233 ATGGACAGGGGACAGTTGAGGGG - Intergenic
1043784881 8:84386385-84386407 AAGCAGAGGGGAAATTTAATTGG + Intronic
1045682493 8:104677688-104677710 AAGCACAGTGGAGTTTTAAGTGG + Intronic
1046169416 8:110485678-110485700 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1046481358 8:114822513-114822535 AATCACAATGGACAGTGAAGGGG + Intergenic
1046810431 8:118527179-118527201 AAGCACAGAGGCCAATTATGAGG - Intronic
1047827008 8:128587698-128587720 AAGCAGAGAGGCCAGTTAGGAGG - Intergenic
1047933633 8:129753608-129753630 AAGCAGAGGGAAAAGTAAAGAGG + Intronic
1048136125 8:131748062-131748084 AAACACAGAGGCTAGTTAAGAGG - Intergenic
1048646669 8:136428402-136428424 AAACACAGGGAAAAGTTAAGGGG + Intergenic
1048757796 8:137757052-137757074 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1050315955 9:4401026-4401048 AAGCAGAGGGAAAAGTAAAGAGG + Intergenic
1050510808 9:6393261-6393283 GAGAAGAGGGGACAGTTAATGGG + Intergenic
1050761415 9:9076419-9076441 GAGCAAAGGGGACGGTTAATGGG - Intronic
1051509110 9:17857886-17857908 AAGCTCAGAGGACAGGTAAGTGG - Intergenic
1051943308 9:22535079-22535101 ACGCACTGGGGCCTGTTAAGTGG + Intergenic
1051991076 9:23153497-23153519 AAGCAGAGGGAAAAGTGAAGGGG - Intergenic
1052272558 9:26641682-26641704 AAGCAGTGGGGGCAGTTATGGGG - Intergenic
1052585666 9:30424925-30424947 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1054164220 9:61705093-61705115 AGGCACTGGGGACAGGGAAGTGG + Intergenic
1055181211 9:73388916-73388938 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1055302054 9:74892150-74892172 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1056949614 9:91031698-91031720 AAGCACTGAGGCAAGTTAAGAGG - Intergenic
1057288335 9:93779187-93779209 AAGCACAGGAGATATTTTAGGGG + Intergenic
1057738379 9:97688870-97688892 AAGCACAGGGAACAGGTAAGAGG + Intronic
1058226524 9:102371341-102371363 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1058249069 9:102668922-102668944 AAGCAGAGGGAAGAGTAAAGGGG - Intergenic
1059515389 9:114889622-114889644 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1059897474 9:118883136-118883158 AAGCGGAGGGGGCAGTTAATGGG - Intergenic
1059988232 9:119840399-119840421 AAGCACAGAGGAGAGGTGAGAGG + Intergenic
1060222074 9:121769766-121769788 CAGCACAGGGGAAAGGTAAGTGG - Intronic
1060238008 9:121879677-121879699 AAGAAGAAGGGAGAGTTAAGTGG + Intronic
1060532906 9:124358770-124358792 AAGCAGAGGAGACAGTTAAATGG - Intronic
1060582975 9:124769571-124769593 AAACACCCGGGACAGTTAGGAGG - Intronic
1060607739 9:124932397-124932419 CAGGACAGTGGACAGTTAAGAGG + Intronic
1060796056 9:126513923-126513945 AAGGCCAGGGGACAGGTAGGGGG - Intergenic
1061385526 9:130287221-130287243 AGGCAGAGGGGTCAGATAAGGGG - Intronic
1186301515 X:8204742-8204764 AAGCACTGGGGCCAGTCAGGAGG + Intergenic
1187522173 X:20023391-20023413 AAGCCCAGGCAACATTTAAGGGG + Intronic
1187844918 X:23525158-23525180 AAGCAAAGGGAAAAGTAAAGTGG + Intergenic
1188553933 X:31390735-31390757 AAGCAAAGAGGCCAGGTAAGAGG - Intronic
1189013452 X:37070936-37070958 AAGCAGAGGGGAAAGTAAAGGGG - Intergenic
1189411937 X:40780178-40780200 AAGGACAGGGAAGAGTAAAGAGG - Intergenic
1189620248 X:42829269-42829291 AAGCACAGTGCACAGTTTTGTGG - Intergenic
1189657994 X:43267260-43267282 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1189858446 X:45247781-45247803 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1190332570 X:49244933-49244955 AGGAAGAGGGGACAGATAAGTGG - Intronic
1190374348 X:49774673-49774695 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1190498599 X:51053294-51053316 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1191770807 X:64756290-64756312 AAGCAGAGGGAAAAGTAAAGAGG - Intergenic
1191946928 X:66544599-66544621 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1191974116 X:66851453-66851475 AAGCAGAGGGAAGAGTAAAGGGG - Intergenic
1192193010 X:69005712-69005734 AAACACAGGGGACTTTTAGGTGG - Intergenic
1192374874 X:70549380-70549402 AAGCAGAGGGAAGAGTAAAGAGG + Intronic
1192380806 X:70614156-70614178 AAGCAGAGGGAAAAGTAAAGAGG + Intronic
1192836121 X:74801673-74801695 AAGCAAAGGGAAAAGTGAAGGGG + Intronic
1192995460 X:76507654-76507676 AAGCAGAGGGAAAAGTAAAGAGG - Intergenic
1193880140 X:86911363-86911385 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1193956762 X:87873348-87873370 ATGGACAGGGGAAAGTTTAGAGG + Intergenic
1193984854 X:88228176-88228198 AAGCAGAGGGAAAAGTGAAGGGG + Intergenic
1194189374 X:90816111-90816133 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1194340655 X:92700977-92700999 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1194358511 X:92918373-92918395 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1194561565 X:95428060-95428082 AAGCACAGGGAAAAGTAAAGAGG + Intergenic
1194780778 X:98023170-98023192 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1194940165 X:99999508-99999530 AAGAAGAGAGGACAGTAAAGAGG + Intergenic
1195136205 X:101909383-101909405 AAGCAGAGGGAAAAGTAAAGAGG + Intronic
1195172276 X:102281225-102281247 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1195186584 X:102405868-102405890 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1195290044 X:103423722-103423744 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1195428011 X:104757125-104757147 AAGCAGAGAGAACAGTTAGGAGG + Intronic
1196270064 X:113699670-113699692 AAGCATAGGGAAAAGTAAAGGGG - Intergenic
1196357345 X:114809805-114809827 AAGGAGAGGGAACAGTAAAGGGG - Intronic
1196467812 X:115991193-115991215 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1196498033 X:116346010-116346032 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1196523831 X:116707683-116707705 AAGCAGAGGGAAGAGTAAAGGGG - Intergenic
1196922127 X:120595179-120595201 AAGCAGAGGGAAAAGTAAAGGGG + Intronic
1197104211 X:122694417-122694439 ACACACAGGGGACTGTTATGGGG - Intergenic
1197756890 X:130001924-130001946 AGGCAGAGGGAGCAGTTAAGAGG + Intronic
1197810838 X:130441713-130441735 AAGCACAGGTAAAAGTAAAGGGG - Intergenic
1198145240 X:133849669-133849691 AGGATCAGGTGACAGTTAAGTGG - Intronic
1198393093 X:136196156-136196178 GGGCACAGGGGACAGTGAGGAGG + Intronic
1198512189 X:137363528-137363550 AAGCACAGGGAACATAGAAGTGG - Intergenic
1198724669 X:139664706-139664728 AAGCAGAGGGAAAAGTAAAGGGG - Intronic
1198818071 X:140614374-140614396 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1199041084 X:143116182-143116204 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1199277630 X:145964685-145964707 AAGCAGAGGGAAAAGTAAAGGGG + Intergenic
1199393297 X:147306502-147306524 AAGCACAGGAAAAAGTAAAGAGG + Intergenic
1199440973 X:147867259-147867281 AAGCAGAGGGAAGAGTAAAGGGG + Intergenic
1199711024 X:150469737-150469759 ATTCACAGGGAACTGTTAAGAGG + Exonic
1200649010 Y:5817715-5817737 AAGCAGAGGGAAAAGTAAAGGGG - Intergenic
1202383668 Y:24301883-24301905 AAGCAGAGGGAACATTTAGGAGG + Intergenic
1202487115 Y:25368237-25368259 AAGCAGAGGGAACATTTAGGAGG - Intergenic