ID: 1094050127

View in Genome Browser
Species Human (GRCh38)
Location 12:26210664-26210686
Sequence CTGTCTCAACAGATGCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094050127_1094050132 10 Left 1094050127 12:26210664-26210686 CCCCCCTGCATCTGTTGAGACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1094050132 12:26210697-26210719 TTGATGACTTCCAGTGCTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 124
1094050127_1094050133 11 Left 1094050127 12:26210664-26210686 CCCCCCTGCATCTGTTGAGACAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1094050133 12:26210698-26210720 TGATGACTTCCAGTGCTAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094050127 Original CRISPR CTGTCTCAACAGATGCAGGG GGG (reversed) Intronic
901139068 1:7016330-7016352 CTATGTCACTAGATGCAGGGAGG + Intronic
901186352 1:7375854-7375876 CTTTGTCAACAGAGACAGGGTGG + Intronic
902082902 1:13833465-13833487 CTGGCTCAGCAGGTGCAGCGTGG - Intergenic
902331784 1:15734460-15734482 CTGCCTCGCCAGATGCAGGGGGG + Exonic
902517613 1:16997834-16997856 CTGTCTCAAAAGAGGAGGGGAGG + Intronic
902674217 1:17997274-17997296 GTGTCTCAACACATGCAGGTTGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903804939 1:25998555-25998577 AGGTGTCAACAGATGCAGGCTGG - Intergenic
903879962 1:26501461-26501483 CTCTCTCCACAACTGCAGGGTGG + Intergenic
907536164 1:55160439-55160461 CTGTCTCAAGAGTTGCAGTAAGG - Intronic
909047154 1:70724351-70724373 CTATCTCAATAGATGCAGAAAGG - Intergenic
915721525 1:157989275-157989297 CTGCCCCAACAGAAGCAGGCAGG - Intergenic
920180533 1:204129503-204129525 CTGTCTCATGAGAGGCAGGATGG + Intergenic
921713555 1:218396429-218396451 CTGTCCCAAAAGATGCAGTGGGG - Intronic
1064178632 10:13096866-13096888 CTTTCACAACAGTTGGAGGGAGG - Intronic
1064944903 10:20776540-20776562 CTGTCCCAAAATATTCAGGGAGG + Intergenic
1065858821 10:29853191-29853213 AACTCTCAACAGATGCAGGCTGG + Intergenic
1071074940 10:81738809-81738831 TTATCTCAACAGATGCAGAAAGG + Intergenic
1072141999 10:92597266-92597288 CTGTCTCAACATCTGTATGGAGG - Intronic
1076390210 10:130094633-130094655 TTGTCTCAATAGATGCAGAAAGG + Intergenic
1076788051 10:132760868-132760890 CTGTGTCCCGAGATGCAGGGCGG - Intronic
1077508597 11:2943589-2943611 CTGTCTCCGCAGCTGAAGGGCGG + Intergenic
1077793238 11:5463789-5463811 CTGTCTAAAGAGATACAGGAGGG + Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1085268520 11:75253574-75253596 TTATCTCAACAGATGCAGAAAGG - Intergenic
1086901724 11:92375161-92375183 CTGTCTCCCAAGATGCAGGCTGG + Intronic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1092280707 12:7096051-7096073 CTGTGTCAACAGATGAAGTAGGG + Exonic
1092944657 12:13441539-13441561 TTCTTACAACAGATGCAGGGAGG - Intergenic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1100855415 12:98753291-98753313 CTGACCCAAAAGAGGCAGGGTGG + Intronic
1101979638 12:109394764-109394786 CTGTCTCAACATATATATGGTGG - Intronic
1110394242 13:75011506-75011528 CTGTTTCACCAGAGGCATGGGGG + Intergenic
1112994486 13:105556395-105556417 CTGTCACAAGAGAAGCAAGGTGG - Intergenic
1113668990 13:112162984-112163006 CAGACTCAAAAGATGCAGGATGG + Intergenic
1120102241 14:80458583-80458605 ATGTCTGAACAGATGAAGAGGGG - Intergenic
1124018899 15:25902372-25902394 CAGTGTCCACATATGCAGGGAGG + Intergenic
1125351243 15:38769630-38769652 CTGTCTCACCAGACCTAGGGTGG - Intergenic
1128249422 15:66153978-66154000 GGGTATCAACAGCTGCAGGGGGG + Intronic
1129044505 15:72721890-72721912 CAGTATCAAGAGATGCAGGTTGG + Intronic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1132350292 15:101135415-101135437 CTATTTCAATAGATGCATGGTGG + Intergenic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1133414695 16:5597296-5597318 CTGTCTCAAAAGAGAGAGGGCGG - Intergenic
1133989602 16:10694467-10694489 CTGACGCACCAGATGCAGGAGGG - Exonic
1138582495 16:57950761-57950783 CTGTCTCAAGAGGAGAAGGGGGG - Intronic
1140148652 16:72338716-72338738 CTGTCTCAAAAGAAACAGGAAGG - Intergenic
1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141626928 16:85266336-85266358 TTGGCTCAACAGAAGCAGGGAGG - Intergenic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1142711442 17:1725938-1725960 GTGTCTCAAGAGGAGCAGGGAGG + Exonic
1146487158 17:33252430-33252452 CTGTGTCAACACATCCAGAGAGG - Intronic
1146917849 17:36689561-36689583 CTGACCCCACAGAGGCAGGGTGG + Intergenic
1149659964 17:58329061-58329083 CAGTCTCACCCGATGTAGGGAGG - Intergenic
1150713067 17:67548049-67548071 TTGTCTCAACAGAGGCGAGGTGG - Intronic
1151682066 17:75627517-75627539 CTTTCACTACAGATTCAGGGTGG + Exonic
1151892716 17:76960161-76960183 CTGGCTCTAAAGATGCAGGAAGG - Intergenic
1152134186 17:78494382-78494404 CTCTCTCAACTGAGGCTGGGGGG - Intronic
1152260177 17:79262579-79262601 CAGTCTCAAGAGGTGGAGGGAGG + Intronic
1157031236 18:43910860-43910882 TTATCTCAATAGATGCAGGAAGG - Intergenic
1157467461 18:47959483-47959505 CGATCTCAAAAGATGCTGGGAGG + Intergenic
1158317453 18:56227376-56227398 CAATCTCAACAAATCCAGGGAGG + Intergenic
1159562620 18:70011496-70011518 TTATCTCAACAGATGCAGAAAGG + Intronic
1161378784 19:3953621-3953643 CTGGCCCAGCAGCTGCAGGGGGG + Intergenic
1162974210 19:14199023-14199045 CTGCCTCATCAGATGCTGGCAGG + Intronic
1163621549 19:18363796-18363818 CTGTGTCCCCAGATGCAGGGAGG - Exonic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
925088946 2:1137611-1137633 CTGTCTGGTCAGCTGCAGGGTGG - Exonic
926314671 2:11700568-11700590 CTGCCTCCAGAGAGGCAGGGAGG - Intronic
927826473 2:26313109-26313131 CTGTCTCAGCTGCTGCAGGCAGG - Exonic
927902270 2:26829096-26829118 CTGTCTCCACAGGAGCAGCGGGG + Intergenic
931865085 2:66400986-66401008 CTGTCTCTCCAGATACTGGGTGG - Intergenic
931929630 2:67116044-67116066 CCATCTCAATAGATGCAGGAAGG + Intergenic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
932771231 2:74501977-74501999 CCTTCTCAAGAGATGCACGGAGG + Intronic
936017872 2:108973310-108973332 CTGTCTCACAACTTGCAGGGAGG - Intronic
937397562 2:121551125-121551147 TTATCTCAACAGATGCAGAAAGG + Intronic
938804596 2:134794495-134794517 CTGTTCCAACAGAGGCTGGGAGG + Intergenic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
945283563 2:208060313-208060335 CTGTCTCAAAAGAAAAAGGGGGG - Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1173094824 20:40015409-40015431 CAGTCTGAACAGATGAAAGGGGG + Intergenic
1173150507 20:40562898-40562920 CTCTCTGAGCAGCTGCAGGGAGG + Intergenic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1174866658 20:54143017-54143039 CTGTCTCACCAGAGCCAGTGAGG + Intergenic
1177910426 21:27024471-27024493 CTTTGCTAACAGATGCAGGGAGG + Intergenic
1179190355 21:39117618-39117640 CTGTCCTAACAGCAGCAGGGTGG - Intergenic
1179990334 21:44944986-44945008 CTCGTTCAACAGATGCAGAGCGG - Intronic
1183595782 22:38809839-38809861 CTGTCTCTAGAGTTCCAGGGTGG + Intergenic
1183646103 22:39127698-39127720 CTGTCTCAAAAAAAACAGGGTGG + Intronic
1183924163 22:41193843-41193865 CTGTCTCAAAAAAGGGAGGGAGG + Intergenic
1185310329 22:50150697-50150719 CCGTCTCAGCTCATGCAGGGAGG - Intronic
949444931 3:4124179-4124201 CTGTCTCCCCAAGTGCAGGGAGG - Intronic
953543924 3:43847446-43847468 TTATCTCAATAGATGCAGAGAGG + Intergenic
954350260 3:50037399-50037421 CTGTCTCAAAAAAAGCAGGGGGG + Intronic
954410265 3:50367551-50367573 TGGTCTCCACAGATGCAAGGAGG + Intronic
955082443 3:55670536-55670558 CTGACTCCAGAGCTGCAGGGCGG - Intronic
955327627 3:58021369-58021391 CCCTCTCAGCAGAGGCAGGGAGG + Intronic
956347550 3:68297481-68297503 CTGACTCCACAGATCTAGGGTGG + Intronic
957174538 3:76789160-76789182 CTGTATCCTTAGATGCAGGGTGG + Intronic
957457108 3:80466166-80466188 TTATCTCAATAGATGCAGAGAGG - Intergenic
961160396 3:124719173-124719195 ATGTATCAACGTATGCAGGGTGG + Intronic
961548598 3:127653212-127653234 CTGTCTCACCTGCTTCAGGGCGG + Intronic
961672864 3:128547638-128547660 CAGTCTCAACAGGAGCAAGGCGG + Intergenic
962075267 3:132074991-132075013 CTGTATCATTAGATGTAGGGAGG + Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
964653772 3:159043551-159043573 CTGTCTCAAAAAAAGCGGGGCGG - Intronic
964701875 3:159576741-159576763 GTGTTTCAACAGATGCATGCAGG - Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
966874833 3:184315751-184315773 CTTTCCCAACAGGTGCTGGGGGG + Exonic
972194873 4:36641447-36641469 CTGGCTCAACATCTGCAGTGTGG - Intergenic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
977764110 4:100777134-100777156 CTATCTCTACAGAGGGAGGGTGG + Intronic
982435817 4:155383037-155383059 CTGCCTGAACAGCTGCAGAGAGG - Intergenic
982972954 4:162014097-162014119 TTGCCTCCACAGATGCAGGGTGG - Intronic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
988785959 5:34565525-34565547 ATGTCTCAACTGAGGCAAGGGGG - Intergenic
989306692 5:39966038-39966060 CTGTTTAAAAAGATGCAGGAAGG - Intergenic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
994674747 5:102806181-102806203 CTGTCTAAACAGAATTAGGGTGG - Intronic
999657777 5:153827595-153827617 CTGTCTCAGCTGTTGCAGGGCGG - Intergenic
1000258027 5:159559363-159559385 CTGACTCAGTAGATGTAGGGTGG - Intergenic
1000597955 5:163237093-163237115 TTATCTCAATAGATGCAGAGAGG - Intergenic
1000976899 5:167774879-167774901 CTGTCTTAACAGATGCACTGGGG - Intronic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1002945214 6:1754785-1754807 TTATCTCAACAGATGCAGAAAGG + Intronic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1005370026 6:25122819-25122841 CTAAGTCAACAGATTCAGGGTGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006249191 6:32766165-32766187 CTGTCCCCACAGAGGCCGGGTGG - Intergenic
1006443043 6:34063827-34063849 CTGTCTCCCCAGATGGGGGGAGG - Intronic
1014134731 6:117875454-117875476 TTATCTCAATAGATGCAGAGCGG - Intergenic
1014243991 6:119048137-119048159 TTGTCTCAATAGATGCAGAAAGG + Intronic
1014550834 6:122788372-122788394 CTGACTCAACAGGTCTAGGGTGG + Intergenic
1016030758 6:139335250-139335272 CTGTCTCAAAAGAAGCATGTCGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1018940962 6:168308648-168308670 CCATCTCCACAGAGGCAGGGTGG - Exonic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1021747420 7:23756724-23756746 CTATCTCAATAGATGCAGAAAGG - Intronic
1022264542 7:28741320-28741342 TTCCCTCAACAGATGGAGGGAGG - Intronic
1022432573 7:30340478-30340500 TTATCTCAACAGATGCAGAAAGG - Intronic
1022507174 7:30914501-30914523 CTGTCCCAACAGTGGAAGGGTGG + Intronic
1023935708 7:44738310-44738332 CTGTATAAACACATGCAGTGGGG + Intergenic
1024590324 7:50876285-50876307 TTATCTCAATAGATGCAGGAAGG + Intergenic
1029032997 7:97488440-97488462 CTGCCCCAGCAGTTGCAGGGAGG + Intergenic
1032822247 7:135534779-135534801 CTGTCTCAAAAGAAGATGGGAGG + Intergenic
1036607364 8:10319322-10319344 CAGTCTCAGCAGCTGAAGGGTGG - Intronic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1045405846 8:101866177-101866199 CTGTGTCAAATGATGCTGGGAGG - Intronic
1045836995 8:106534129-106534151 CTGACTCAACAGATCTGGGGCGG + Intronic
1047701653 8:127455142-127455164 CTGTCTCAAAAAATAAAGGGAGG + Intergenic
1048569621 8:135640712-135640734 CTCTCTCAACAGATCAAGAGGGG - Intronic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1056705870 9:88952443-88952465 CTGACTCAGCAGATCTAGGGTGG + Intergenic
1056905759 9:90646293-90646315 CTGAATCAACAGGTCCAGGGTGG - Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1060448303 9:123712657-123712679 CTGTTATAACAGAAGCAGGGAGG - Intronic
1060962109 9:127688328-127688350 CTGACTCAGAATATGCAGGGCGG - Intronic
1061740934 9:132705514-132705536 CTGGCACAACAGCTGCAGGTGGG - Intergenic
1061921119 9:133783161-133783183 CATTCTCAACAGGTGCATGGAGG - Intronic
1062026829 9:134344414-134344436 CTGACTCAGCAGCTGCAGGGTGG + Intronic
1062147317 9:134996846-134996868 CTGTCTCAGCAGCTGCGAGGTGG + Intergenic
1185445739 X:257170-257192 CTGTCTCAAGCCAGGCAGGGTGG + Intergenic
1187269765 X:17769128-17769150 AAGATTCAACAGATGCAGGGAGG - Intergenic
1190621414 X:52290221-52290243 CTGTCTCAAATGATGAATGGAGG + Intergenic
1191685773 X:63888771-63888793 TTATCTCAACAGATGCAGAAAGG + Intergenic
1193736911 X:85168041-85168063 TTGTCTCAATAGATGCAGAAAGG + Intergenic
1193952224 X:87813778-87813800 CTGTGTCCACAGAAGCTGGGGGG + Intergenic
1199343168 X:146706659-146706681 CTCTCTTAAAAGATGCAGTGTGG - Intergenic
1199400174 X:147389719-147389741 CTGTCTGAACACATGCATGCTGG - Intergenic
1199713221 X:150487031-150487053 CTGACTCCACAGATACAGGTGGG + Intronic
1200068005 X:153514232-153514254 CTGTCCCAACAGTGGCAGGAGGG + Intergenic
1201400874 Y:13602583-13602605 CTGTAGCAACAGTTTCAGGGGGG + Intergenic