ID: 1094051593

View in Genome Browser
Species Human (GRCh38)
Location 12:26226631-26226653
Sequence CTTGGCTGGGCATCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094051588_1094051593 -7 Left 1094051588 12:26226615-26226637 CCTCTCTGCCTCTGGGCTTGGCT 0: 1
1: 0
2: 7
3: 64
4: 595
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141
1094051584_1094051593 4 Left 1094051584 12:26226604-26226626 CCTGGGCTTTGCCTCTCTGCCTC 0: 1
1: 0
2: 1
3: 60
4: 532
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141
1094051581_1094051593 15 Left 1094051581 12:26226593-26226615 CCTTTTTCCTCCCTGGGCTTTGC 0: 1
1: 2
2: 4
3: 37
4: 490
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141
1094051577_1094051593 28 Left 1094051577 12:26226580-26226602 CCACCAGCGCGTTCCTTTTTCCT 0: 1
1: 0
2: 0
3: 16
4: 233
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141
1094051578_1094051593 25 Left 1094051578 12:26226583-26226605 CCAGCGCGTTCCTTTTTCCTCCC 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141
1094051582_1094051593 8 Left 1094051582 12:26226600-26226622 CCTCCCTGGGCTTTGCCTCTCTG 0: 1
1: 0
2: 6
3: 49
4: 523
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141
1094051583_1094051593 5 Left 1094051583 12:26226603-26226625 CCCTGGGCTTTGCCTCTCTGCCT 0: 1
1: 0
2: 3
3: 57
4: 472
Right 1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG 0: 1
1: 1
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094051593 Original CRISPR CTTGGCTGGGCATCGGCTGC AGG Intronic
900395086 1:2450168-2450190 CTTGGCTGGGCCTCGACGGGGGG + Intronic
900551317 1:3257365-3257387 CTAGGCCGGGCACCAGCTGCTGG + Intronic
900622042 1:3591976-3591998 CTTGGACGGGCATCGGCATCCGG + Intronic
900794709 1:4700928-4700950 CTTAGCTGAGCCTCTGCTGCTGG - Intronic
901067654 1:6502067-6502089 CATGCCTGGGCAGCTGCTGCAGG + Intronic
903545292 1:24120209-24120231 CCTGGCTGGGAATGAGCTGCAGG + Exonic
903815983 1:26064862-26064884 CTGGGCTGGGCACTGCCTGCAGG + Intronic
904117556 1:28173929-28173951 CTTTGCTGGCCATCTGCTCCTGG + Intronic
904411320 1:30326639-30326661 CTGGGCTAGGTATCGGATGCAGG - Intergenic
905572137 1:39014440-39014462 CTTGGGTGGGCAGCCTCTGCAGG - Intergenic
906695864 1:47823152-47823174 CTTGCCTGGAGATCTGCTGCAGG + Intronic
912514594 1:110210162-110210184 CTTGGTTGGGGCTCGGCTCCGGG + Intergenic
922024491 1:221738072-221738094 CTAGGCTGGGCACAGGATGCAGG + Intronic
922032090 1:221811316-221811338 CTTGTCTTGGCATCAGGTGCTGG + Intergenic
1064194580 10:13234561-13234583 CGTGTCTGGGGATCTGCTGCTGG + Intergenic
1065186479 10:23174429-23174451 GTGGGCTGGGCGTCGGCCGCGGG + Intergenic
1067375839 10:45727235-45727257 CTTGGCTGGGGCTAGGCTTCCGG + Exonic
1067883550 10:50067923-50067945 CTTGGCTGGGGCTAGGCTTCCGG + Intronic
1071526242 10:86361186-86361208 CTTGCCTGGGGCTCTGCTGCAGG - Intronic
1076316564 10:129546210-129546232 CTGAGCTGGGCTTGGGCTGCAGG - Intronic
1076602655 10:131668834-131668856 CTTTGCTGGCCATCGGCTCATGG + Intergenic
1076647419 10:131962773-131962795 CTTGGCTGGGCTGCGGTTGGGGG - Intergenic
1076674402 10:132140687-132140709 CTTGGCTGGGCATGGGCTGCCGG + Intronic
1077361076 11:2140384-2140406 CTTGGCTAGGCTTAGGCGGCGGG - Intronic
1080779604 11:35418803-35418825 CTTGGCTGGGGATGGGATGGTGG - Intronic
1081868313 11:46371783-46371805 CCAGGCTGGGCAGAGGCTGCAGG + Intronic
1083187451 11:61026043-61026065 CTTGGCAGGGCATCACCTGCGGG + Intergenic
1083901513 11:65645706-65645728 GCTGGCTGGGCATTGGCTGGTGG + Intronic
1084652837 11:70499241-70499263 CCAGGCTGGGCCACGGCTGCTGG + Intronic
1084773386 11:71358559-71358581 CTGGGCAGGGCAGCAGCTGCAGG + Intergenic
1085415630 11:76317487-76317509 CTTGGCTGGCCTCCAGCTGCTGG + Intergenic
1085743141 11:79093849-79093871 CTTGGCTTGGCATTGGCTCAAGG - Intronic
1086397444 11:86431537-86431559 CGTGGCGGGGCAGCGGCGGCAGG - Intergenic
1089781742 11:120878007-120878029 CTAGCCTGAGCAGCGGCTGCTGG - Intronic
1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG + Intronic
1096967018 12:55636860-55636882 CTTGGCTGTGCCTCAGCTTCTGG + Exonic
1101986232 12:109449574-109449596 ATTAGCTGGGCATGGGCTGATGG + Exonic
1103459291 12:121090923-121090945 ACTGGCTGGGCAGTGGCTGCAGG + Intergenic
1103978746 12:124721989-124722011 CTTAGCTGGTCATTGGCTGGCGG - Intergenic
1104337538 12:127913657-127913679 CAGGGCTGGGGCTCGGCTGCTGG - Intergenic
1105448078 13:20474754-20474776 CTGGGCTGGTCATTGGCTGAGGG - Intronic
1107094896 13:36525733-36525755 CTTGGCTGGGCATCTACTAATGG + Intergenic
1113640071 13:111951100-111951122 CTTGGCTGGGCATGGTCACCTGG + Intergenic
1114139694 14:19895553-19895575 CTTGGCAGGGCAGTGGCAGCTGG + Intergenic
1115739782 14:36376121-36376143 CTTGACTGGTCATTGGATGCAGG + Intergenic
1119658878 14:76436658-76436680 CCTGGCAGGCCATCAGCTGCAGG - Intronic
1121244218 14:92450782-92450804 CTTGGATGGGCATCTGCCACTGG - Intronic
1122055583 14:99096110-99096132 CTGGGCTGGGCTTGGCCTGCTGG - Intergenic
1123004187 14:105313798-105313820 CTCGGCTTGGCATCTGGTGCTGG + Exonic
1125677589 15:41511220-41511242 CTTGGCTGGGCCGCGGCCGGCGG - Exonic
1125727925 15:41877551-41877573 CTAGGCCGGGCATCGGCTGTTGG - Intronic
1126165843 15:45653252-45653274 CCAGGCAGGGCATCTGCTGCTGG + Intronic
1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG + Intronic
1128160646 15:65421429-65421451 CGAGGCTGGGTCTCGGCTGCTGG - Intronic
1129525711 15:76212778-76212800 TTTGGCTGGGGATGGGCTCCTGG - Intronic
1131529300 15:93178575-93178597 CTGGGCTGGGCAGCCTCTGCTGG + Intergenic
1132295806 15:100733440-100733462 CTTGGTGGGGAATCTGCTGCAGG - Intergenic
1132732869 16:1371466-1371488 CTTGGCTGTTCAGCGGCTGGAGG + Intronic
1135721157 16:24819660-24819682 CTGTGCTGAGCATTGGCTGCTGG - Intronic
1138497479 16:57416992-57417014 CTTAGCTGGGCATGGGCAGAGGG - Intergenic
1141367606 16:83457730-83457752 CTTGGCTCGGCCTGGCCTGCTGG - Intronic
1141595331 16:85093683-85093705 CTTGGCTTGGCTTTGGCTGTTGG + Exonic
1142687726 17:1587406-1587428 CTTGGCTGGGCATCAGGGGCAGG - Intronic
1150069474 17:62139183-62139205 CTTGGGCGGGCAGCGCCTGCAGG + Intergenic
1150583838 17:66499665-66499687 CATGGCTGGGCATCAGCTCACGG - Intronic
1150628289 17:66858000-66858022 CCTGTCTGGGCATGGGCTCCTGG + Intronic
1151088486 17:71408164-71408186 CTTGTCTGGGAATCAGTTGCTGG - Intergenic
1151700903 17:75742147-75742169 CATGGCTGGGCTGAGGCTGCAGG + Intronic
1151763801 17:76121998-76122020 CTGCGCTGGGCAGCGGGTGCGGG + Intergenic
1152425262 17:80215048-80215070 CTTGGCTGAGCAGCAGCGGCAGG + Exonic
1152582472 17:81172462-81172484 CTTGACTGGCCGTCTGCTGCTGG - Intergenic
1152594051 17:81229594-81229616 CTGGGCAGGACACCGGCTGCTGG + Intronic
1152599577 17:81255229-81255251 CTTGGCTGGTCAGCTGCTGCAGG - Intronic
1160727232 19:622728-622750 CTTGGGCGGGCAGCGCCTGCAGG + Exonic
1160909233 19:1467243-1467265 CTTTGCAGGGCACCGGCGGCGGG + Exonic
1161073151 19:2272308-2272330 ATTAGCTGGGCATCGGTGGCGGG - Intronic
1165162839 19:33828087-33828109 CTTGTCTCGGCATCAGCTTCTGG + Intergenic
1165299512 19:34959843-34959865 TTTGGCAGGGCCTGGGCTGCTGG + Intronic
1165695006 19:37894365-37894387 CTTGGCTGGGCAAGGGCAGCGGG + Exonic
1167569912 19:50280531-50280553 CAGGGCTGGGCATGGGCTGTGGG - Intronic
925348049 2:3184043-3184065 GTTGGCAGGGCTTCGCCTGCTGG + Intergenic
926242897 2:11101678-11101700 CTTGGGTGGGCCCTGGCTGCTGG - Intergenic
927459690 2:23287316-23287338 CTTGGCTGTGCCTTGACTGCAGG - Intergenic
927463656 2:23321179-23321201 CTTGACTGGGCTTCTGCTCCCGG + Intergenic
929118889 2:38467498-38467520 CTGGCCAGGGCATCGGCAGCTGG - Intergenic
929996554 2:46829641-46829663 CTTGGGTGGGCATGGGATGTGGG - Intronic
933418158 2:82013794-82013816 CTTGTCTGGGCTACAGCTGCTGG - Intergenic
933901849 2:86855835-86855857 CTTGGCTGGGCACCGCCGCCTGG + Intronic
935778697 2:106493428-106493450 CTTGGCTGGGCACCGCCGCCTGG - Intergenic
937941696 2:127291182-127291204 CTTGGCTGCGAATTGCCTGCAGG - Intronic
938238051 2:129722501-129722523 CCTGGCTGGGCGAAGGCTGCAGG - Intergenic
941752113 2:169144425-169144447 CTTCCCTGAGCATCAGCTGCCGG + Intronic
944975659 2:205047625-205047647 CTTGGCTGGGTATCAGCAGGTGG - Exonic
1173436595 20:43037962-43037984 CTTGTCTGGGGGTCTGCTGCTGG + Intronic
1173563161 20:44020711-44020733 CGTGGTTAGGCATGGGCTGCTGG - Intronic
1174392584 20:50226950-50226972 CTTGTCTGGGTATAGGCTGGTGG + Intergenic
1176243295 20:64084871-64084893 GGGGGCTGGGCCTCGGCTGCAGG - Intronic
1176304305 21:5115249-5115271 CTTGGCTGGGACTCAGCTCCGGG - Intergenic
1176425638 21:6546741-6546763 CTTGGCTGGGCCACGGCGCCCGG + Intergenic
1179048273 21:37866444-37866466 CTTGGGTGGGCACAGGCTGCTGG + Intronic
1179141723 21:38731883-38731905 ATTGGCTGGGCATCAGATGCCGG - Intergenic
1179701129 21:43155058-43155080 CTTGGCTGGGCCACGGCGCCCGG + Intergenic
1179852752 21:44146781-44146803 CTTGGCTGGGACTCAGCTCCGGG + Intergenic
1180103399 21:45600741-45600763 CATGGCTGGGCAGCAGATGCTGG + Intergenic
1180159563 21:45992965-45992987 CATGGCTGGGCGCCGGCTTCAGG - Intronic
1181305981 22:21917507-21917529 CGTGGCTGGGCAGTGTCTGCGGG + Intergenic
1182519563 22:30877740-30877762 CTTGCCTGGGCCCCGCCTGCAGG - Intronic
1183587663 22:38762435-38762457 CTTGGGTGGGCATGGGGTGGGGG - Intronic
1185081993 22:48714571-48714593 CTTGGCTGTGTTTCCGCTGCAGG - Intronic
1185164879 22:49255400-49255422 CTTCGCTGGGGGTCTGCTGCCGG - Intergenic
950765438 3:15269775-15269797 CCTGGCCGAGCAGCGGCTGCTGG - Exonic
952904514 3:38130954-38130976 CTTGGGTGGGCATCTGGTGCTGG - Intronic
954417395 3:50399974-50399996 CTGGGCTAGGCAGGGGCTGCTGG - Intronic
959521772 3:107329338-107329360 CCTGGCTGGGCACCTGCTGCGGG - Intergenic
961666517 3:128496428-128496450 ATGGGCTGGGCATGAGCTGCGGG + Intergenic
963366569 3:144343139-144343161 CTTGGCTGGATTTCTGCTGCAGG + Intergenic
967336072 3:188346051-188346073 CTTGGCTGCACATTCGCTGCAGG - Intronic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
987927715 5:24364187-24364209 CTTGGCTGGGCAGCAGCAGCTGG - Intergenic
990165546 5:52989544-52989566 TTTCGCTCTGCATCGGCTGCAGG + Intronic
992995165 5:82325269-82325291 CGTAGCTGGGCATCGGCAGGAGG + Intronic
1002054278 5:176589784-176589806 CTTGGCTGGGTATGGGCTTCTGG - Intronic
1002133104 5:177093217-177093239 CTTGGCTGTGCTCCTGCTGCTGG + Exonic
1003305436 6:4922833-4922855 CGAGGCTGGGCACCCGCTGCAGG - Intronic
1003869598 6:10391174-10391196 CTTGCCTGGGCTTGGGCGGCAGG - Intergenic
1005371464 6:25138069-25138091 CTTGCCTGCCCATCGTCTGCCGG + Intergenic
1006330425 6:33386358-33386380 TTTAGCTGGGCATGGGGTGCAGG + Intergenic
1006449579 6:34098491-34098513 CCTGGCTGGGCCTAGGCTGGTGG - Intronic
1007398942 6:41592850-41592872 CTGGGCTGGGCAAGGGCGGCAGG - Intronic
1014714285 6:124846486-124846508 CTTGGCTAGGCATCTTCTGGTGG - Intergenic
1019510976 7:1417159-1417181 CTTGGGTGGGGGTGGGCTGCTGG - Intergenic
1019521054 7:1460616-1460638 CTTGTCTGGGCAGGGCCTGCAGG + Intergenic
1022629273 7:32070463-32070485 CCTGGCTGGGCATCGCGAGCTGG - Intronic
1024673292 7:51616036-51616058 CTTTGCTGGGCACCATCTGCAGG + Intergenic
1029460149 7:100689623-100689645 CTCGGCTTGTCATGGGCTGCTGG - Intergenic
1029561275 7:101304149-101304171 TTTGGATGGGGATCTGCTGCTGG - Intergenic
1030950921 7:115789998-115790020 CGTGGCTGGCCAGCAGCTGCTGG - Intergenic
1031336544 7:120540104-120540126 CTAGGCTGGTCTTCAGCTGCTGG + Intronic
1034491311 7:151394460-151394482 CTTCGCTGAGCATCAGGTGCTGG + Intronic
1034867157 7:154651614-154651636 CATGGCTGAGGATCGGCTGCTGG + Intronic
1037686186 8:21141516-21141538 CTTGGCTGGGCAGAGTCTGCAGG + Intergenic
1037916296 8:22775374-22775396 CTTGCCTGGGCCTCGACAGCTGG - Intronic
1038394383 8:27236435-27236457 CTGGGTGGGGCAGCGGCTGCAGG - Exonic
1039563212 8:38529530-38529552 CTTGTCTGGGCCTCTGGTGCCGG - Intergenic
1046140325 8:110083075-110083097 CTTGGTTGGGCAGCTGCAGCGGG - Intergenic
1049262672 8:141648103-141648125 CTCAGGTGGGCATGGGCTGCAGG - Intergenic
1049782910 8:144436943-144436965 CCTGGCGGGGCATCGGGAGCTGG - Intronic
1051626349 9:19103002-19103024 CTTGGCTGGGCATGGCCGGAAGG - Exonic
1053133614 9:35635031-35635053 CTTGGCTGGGTATAGGTTGCAGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060547188 9:124468438-124468460 CCGGGCTGGGCATGGGCCGCGGG + Intronic
1061971847 9:134049403-134049425 CTTGGCTGGGCAGTGACTGTGGG - Intronic
1062044846 9:134420214-134420236 CTCGCCTGCCCATCGGCTGCAGG - Intronic
1062536600 9:137023789-137023811 CTGGCCTGGGCAGCAGCTGCGGG - Intronic
1188672631 X:32898514-32898536 GTTGGCAGGGTATGGGCTGCTGG + Intronic
1190356561 X:49611213-49611235 CTTGTCTGAGAATCAGCTGCTGG + Intergenic
1199772355 X:150983227-150983249 CTCGCCTGGCCATTGGCTGCGGG - Intronic
1200059842 X:153479349-153479371 GTGGGCTGGGCAGCAGCTGCAGG - Intronic