ID: 1094051670

View in Genome Browser
Species Human (GRCh38)
Location 12:26226984-26227006
Sequence GGGCGGAGGCGCGGTGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 586}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094051670_1094051675 -7 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051675 12:26227000-26227022 TCCGCCCGCTGCGCAGCGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 155
1094051670_1094051679 0 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051679 12:26227007-26227029 GCTGCGCAGCGCCGGGCTGATGG 0: 1
1: 0
2: 2
3: 50
4: 513
1094051670_1094051680 1 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051680 12:26227008-26227030 CTGCGCAGCGCCGGGCTGATGGG 0: 1
1: 0
2: 1
3: 31
4: 407
1094051670_1094051674 -8 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094051670 Original CRISPR GGGCGGAGGCGCGGTGGCCC CGG (reversed) Intronic
900121861 1:1051667-1051689 GGGCGGAGGCCGGATGGGCCCGG + Intronic
900295492 1:1947092-1947114 GGGTGGAGGCAGTGTGGCCCAGG + Intronic
900313259 1:2044856-2044878 GGCGGGAGGCCCGGAGGCCCCGG + Intergenic
900349818 1:2228960-2228982 GGGCGGCGGCTCGGTGGCTGCGG - Exonic
900350469 1:2232078-2232100 GGGCGGAGGCGGGGCCTCCCAGG - Intronic
900471143 1:2855566-2855588 AGGCGGAGGAGGGCTGGCCCGGG - Intergenic
900512665 1:3067987-3068009 GAGCGCAGGCAGGGTGGCCCGGG - Intergenic
900601903 1:3506304-3506326 GGTAGGATGCGCGGGGGCCCAGG + Intronic
900719692 1:4167303-4167325 GGGCAGAGCCGGGGTGGCCGGGG - Intergenic
901007490 1:6179167-6179189 AGGGGCAGGGGCGGTGGCCCTGG + Intronic
901443468 1:9293123-9293145 AGGGGGAGGCGCGGGGGGCCGGG + Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902930959 1:19731170-19731192 GGTAGGAGGCGCTGTGGCCATGG + Intronic
903149657 1:21397846-21397868 GGGTGGAGAAGCGGAGGCCCAGG + Intergenic
903184767 1:21622673-21622695 ACGCGCAGGCGCGGTGTCCCGGG - Intronic
903233967 1:21937560-21937582 GGGCGGGGGACCGGGGGCCCGGG + Intergenic
903287461 1:22285899-22285921 GGGCAGCGGTGCGGTGACCCAGG - Intergenic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903822358 1:26112081-26112103 GGGCCGGGGGGAGGTGGCCCCGG - Intronic
904753408 1:32754896-32754918 GGGAGAAGTCGCGGTGGCGCGGG - Intronic
905408394 1:37752829-37752851 GGCGGCAGGCGCGGTGGCCTCGG + Intronic
905862720 1:41361775-41361797 GGGCCGAGGCGCGGAGGCAGGGG - Intergenic
906615832 1:47232239-47232261 GGGCGGGGGAGCGGGGGCCGCGG - Intergenic
906680965 1:47725283-47725305 GGGCGGGGGCGCCCTGACCCGGG - Intergenic
907040121 1:51251427-51251449 GGGGGGGGGCCCGGAGGCCCTGG - Intronic
907051030 1:51330227-51330249 AGGCGGAGGCGCGGGGACCCCGG - Intronic
907883983 1:58576664-58576686 CGGCGGTGGGGCGGTGGCGCAGG + Exonic
907934959 1:59033769-59033791 GAGTGGAGGCGCGGTGGCAGGGG - Intergenic
908114204 1:60925074-60925096 GGGTGGGGGGGCGGTGGCTCAGG - Intronic
908796261 1:67833473-67833495 GGGCGGGGCGGCGGCGGCCCCGG + Intergenic
909170014 1:72282877-72282899 GGGAGGAGGCGCGGCGGCGGGGG + Intergenic
910288810 1:85580872-85580894 GGGTGGCGGCGCGGTGGGCCCGG - Exonic
910963355 1:92784736-92784758 GGGCCGAGGCGCGGCGGGCGGGG - Intronic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
912871382 1:113310410-113310432 GGGATGAGGCGGGGTGGCACTGG - Intergenic
914491192 1:148151668-148151690 GGGCTGAGGCGCGGCGGGCTGGG - Intronic
914941304 1:152025179-152025201 GAGCGGAGGCCACGTGGCCCAGG - Intergenic
915229651 1:154435942-154435964 GGGCGGGGGCACGGTGACTCTGG - Intronic
916091921 1:161314333-161314355 GGGCGGAGGCGCGCCGGCTGGGG - Exonic
916102616 1:161406100-161406122 GGGGGGGGGCCCGGAGGCCCTGG + Intergenic
916107305 1:161441294-161441316 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916108892 1:161448712-161448734 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916110480 1:161456093-161456115 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916112065 1:161463503-161463525 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916113652 1:161470884-161470906 GAGCGGAGGCGCGGGGGCTGGGG + Intergenic
916522943 1:165581618-165581640 GGGGGGAGTCCCGGAGGCCCCGG + Intergenic
916666994 1:166975589-166975611 GGGCGGCGGGGCGGAGGCGCGGG - Intronic
916694351 1:167221205-167221227 GAGCGGCGGCGGGGTGGGCCGGG - Intronic
916779415 1:168008850-168008872 GGGTGGAGGCGGGGTGGGGCGGG - Intronic
918151095 1:181798745-181798767 CGGCGGAGGCGCGGGGGGCCTGG + Exonic
919464748 1:197914415-197914437 GGGCTGAGGCCCGGTGGCTGGGG - Intronic
920379787 1:205528861-205528883 TGGCGGCGGAGGGGTGGCCCAGG - Intronic
920496208 1:206456727-206456749 GGGTGGGTGAGCGGTGGCCCCGG + Intronic
920803190 1:209208225-209208247 TTGCGGAGGAGCTGTGGCCCGGG + Intergenic
920912907 1:210233874-210233896 GGGCTGGAGCGCGGGGGCCCGGG + Intronic
922536266 1:226383082-226383104 GGGCGGAGGCGTGGCCGCCACGG + Exonic
922539404 1:226407763-226407785 GGGCGGGGACGCGGCGCCCCGGG - Intronic
922766386 1:228158661-228158683 GGGCGGAGGCCGGGGGGCCGCGG - Exonic
922851263 1:228735679-228735701 GGGCGGAGGGGCGGTCGGGCCGG + Exonic
923086285 1:230705802-230705824 GGGCAGGGCCGCGGTGGCACGGG - Intronic
923126690 1:231040003-231040025 GAGCTGAGCCGCGGGGGCCCGGG - Exonic
923684145 1:236142405-236142427 GGGCGGGGGCGCGCGGGCCGGGG + Intergenic
924706569 1:246507281-246507303 GGGCGCAGGCGCGCGGGTCCCGG - Intronic
1062934841 10:1377987-1378009 GGGAGGAGGCGAGGTGACCCTGG - Intronic
1063363031 10:5472477-5472499 GGGCGGAGGAGCGGAGGCTGAGG - Intergenic
1063459025 10:6203693-6203715 GGGCGGAGGCGCGAGCGGCCGGG - Intronic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1064663892 10:17630824-17630846 GGGGGGAGGCGCGGAGGCTGAGG + Intergenic
1066464238 10:35639521-35639543 GGGCGGGGGCGCGGGCGCCACGG - Exonic
1067103714 10:43351276-43351298 GGGCGGGGGAACGGGGGCCCGGG - Intergenic
1067980021 10:51074265-51074287 AGTCGGAGGCGCGGTGGCGGGGG - Exonic
1069024013 10:63521258-63521280 TGGCGGCGGCGCGTTGGCCCGGG - Intergenic
1070109415 10:73469259-73469281 GGGCAGGGGCGCAGTGGCTCAGG + Intronic
1070329717 10:75408623-75408645 GGGAGGAGGCGCGGTTCCCGGGG + Intergenic
1070333096 10:75431761-75431783 GGGCGGAGGCGGGGCTGGCCGGG - Intronic
1070610207 10:77927171-77927193 GGGCGGAGGGGAGGGGTCCCCGG + Intergenic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070835559 10:79445154-79445176 GGGCGGTGGGGCGGTGGGCGGGG + Intronic
1071526654 10:86363325-86363347 GGGCGGAGGCGCCGCCGCCTGGG - Intronic
1071618086 10:87094649-87094671 GGGCGGCGGCGGGCTGTCCCCGG + Exonic
1071679395 10:87689387-87689409 GGGGACAGGCGCAGTGGCCCAGG + Intronic
1072700941 10:97640934-97640956 GGCCCGGGGCGCGGCGGCCCAGG + Exonic
1073207427 10:101776288-101776310 GGGCGGGGGCGGGGCGGCCGGGG + Intronic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073521826 10:104138392-104138414 GGCCGGTGGCACGGTGGCTCAGG + Intronic
1074165696 10:110872112-110872134 GGGCGGAGGCGTGGGGGTCGCGG + Intronic
1075031887 10:119029601-119029623 GGGCGCGGGCGAGGTGGCCGGGG + Intergenic
1075492133 10:122880164-122880186 GGGCGGAGGCGGGGTAGGTCTGG + Intergenic
1075693751 10:124418774-124418796 GGGCGGGCGCGGGGTGGCCGCGG - Intronic
1075811292 10:125226924-125226946 GGGGTGAGGTGCGGTAGCCCTGG + Intergenic
1076796115 10:132799260-132799282 GGGCTCAGGTGCGGTGTCCCGGG - Intergenic
1076796121 10:132799280-132799302 TGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796127 10:132799300-132799322 GGGCTCAGGCGCGGTGTCCCTGG - Intergenic
1076796132 10:132799320-132799342 GGGCTCAGGCGAGGTGTCCCGGG - Intergenic
1076796138 10:132799340-132799362 GGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796144 10:132799360-132799382 GGGCACAGGCGCGGTGTCCCGGG - Intergenic
1076796150 10:132799380-132799402 GGGCTCAGGCGAGGTGTCCCGGG - Intergenic
1076796156 10:132799400-132799422 GGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796162 10:132799420-132799442 GGGCACAGGCGCGGTGTCCCGGG - Intergenic
1076796168 10:132799440-132799462 GGGCTCAGGCGAGGTGTCCCGGG - Intergenic
1076796174 10:132799460-132799482 GGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796180 10:132799480-132799502 GGGCACAGGCGCGGTGTCCCGGG - Intergenic
1076796186 10:132799500-132799522 GGGCTCAGGCGAGGTGTCCCGGG - Intergenic
1076796192 10:132799520-132799542 GGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796198 10:132799540-132799562 TGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796209 10:132799580-132799602 GGGCACAGGCGCGGTGTCCCGGG - Intergenic
1076796215 10:132799600-132799622 GGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076796221 10:132799620-132799642 TGGCTCAGGCGCGGTGTCCCGGG - Intergenic
1076877171 10:133221571-133221593 GGGTGGAGCCGCCGTGGCCTGGG - Intronic
1076999837 11:317037-317059 GGGGGGCGGCGCAGTGCCCCAGG + Intergenic
1077048642 11:556880-556902 CGGAGGAAGCGCGGTGGTCCCGG + Exonic
1077137522 11:1008423-1008445 GGCAGGTGGCGCGGGGGCCCTGG - Intronic
1077337182 11:2010670-2010692 GGGCCCAGGAGCGGGGGCCCAGG - Intergenic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077404695 11:2377769-2377791 GTCGGGGGGCGCGGTGGCCCCGG - Intronic
1077431596 11:2518418-2518440 GGGTGCAGGCCTGGTGGCCCCGG + Intronic
1077923092 11:6655862-6655884 GGGCGGAGGGGCGGGGGCTCGGG - Intergenic
1078210317 11:9265124-9265146 GGGCGGACGGGCGGGCGCCCGGG - Exonic
1078758717 11:14234652-14234674 GGGCGGAGGGGCAGTGGGGCAGG + Intronic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1081425874 11:42926061-42926083 TGGAGGAGGAGCGGGGGCCCAGG + Intergenic
1081567884 11:44270873-44270895 GGGCCAGGGCGGGGTGGCCCAGG + Intronic
1081831878 11:46121442-46121464 CGGCGGAGGTGCTGCGGCCCGGG - Intergenic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081845600 11:46238353-46238375 GGGCGGAGGCGGCGCGGCGCGGG + Intergenic
1081851500 11:46277953-46277975 GGACGGAGGCGGCGCGGCCCCGG - Exonic
1081938151 11:46918619-46918641 GGGCCCAGGCGCGGTGGCGGTGG - Exonic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1083635458 11:64118303-64118325 GGGCTGAGGCGGGGCAGCCCGGG - Exonic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083666636 11:64278858-64278880 GGGCAGAGGCCCCGTGGCTCTGG + Intronic
1083711119 11:64549194-64549216 AGGCCGAGGCGGGGTGGCCGAGG - Intergenic
1083766714 11:64844817-64844839 GGGCGGAGGCGCGCGGGGGCGGG + Intergenic
1083932927 11:65855712-65855734 GGGCGCAGACTCGGGGGCCCTGG + Exonic
1083936505 11:65872546-65872568 GGGCGGGGGCGGGGTGGCCGGGG - Intronic
1084070080 11:66728185-66728207 GGGCGGGGGCGCGGCGGGCGGGG + Intronic
1084296254 11:68214570-68214592 GGGAGGATGCGCGGAGACCCTGG - Intergenic
1084606837 11:70177226-70177248 GTGCTGAGGTGCGGTGGGCCTGG - Intronic
1085037336 11:73308357-73308379 AGGCGGTGCCGCGGTGCCCCTGG + Exonic
1085073691 11:73571885-73571907 GGGCGGTGGGGCGGTGGGGCAGG - Intronic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1085517596 11:77120640-77120662 AGGGGGAGGCGGGGTGGGCCAGG + Intronic
1087761815 11:102110665-102110687 GGGCGGAGGCGCCGGGGCGGGGG + Exonic
1089198294 11:116708042-116708064 GGGAGGAGGCTGGGTGGCACAGG - Intergenic
1089517336 11:119041630-119041652 GGGGGCAGGCACGGTGGCTCGGG - Intergenic
1089974883 11:122723821-122723843 GGAAGGAGGCAGGGTGGCCCTGG + Intronic
1090187017 11:124745670-124745692 TGGCGGAGCTGGGGTGGCCCGGG + Exonic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1090710028 11:129375728-129375750 GGGCGGGGGCGGGGTGGGCGCGG + Intergenic
1202820166 11_KI270721v1_random:65852-65874 GGGCCCAGGAGCGGGGGCCCAGG - Intergenic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1092365385 12:7872862-7872884 CGGCGGGGGCGCAGCGGCCCGGG - Intronic
1092861515 12:12724045-12724067 CGGCGGAGGCGCGGCCGCCCGGG - Intergenic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096475723 12:51907628-51907650 CGGTGGAGGGGAGGTGGCCCCGG + Exonic
1096491422 12:52015034-52015056 GGGCGGAGGCGGGGGCGCGCCGG + Exonic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1097699060 12:62801914-62801936 GCGCGGAGGGGTGGGGGCCCCGG - Exonic
1097794117 12:63844249-63844271 GGGCAGAGGAGCGGCGGCCGTGG + Intergenic
1099987757 12:89687525-89687547 GGGTGGAGGTGGGGTGGTCCTGG + Intronic
1100985657 12:100199839-100199861 GCGCGAAGGCGCGGGGGCCGGGG - Intronic
1101365097 12:104064061-104064083 GGGAGCAGCCGCCGTGGCCCGGG + Intronic
1102003566 12:109573833-109573855 GCGCGGAGGGGCGGCGGCCGGGG + Exonic
1102027881 12:109723751-109723773 AGGAGGAGGGGCGGAGGCCCAGG - Intronic
1102101507 12:110281732-110281754 AGGCGGAGGCGAGGAGGCCGCGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1103055327 12:117815693-117815715 GGGCGCAGACGCAGTGGCTCAGG + Intronic
1103581491 12:121918718-121918740 GGGCGGAGGCCACGCGGCCCTGG + Intronic
1103796430 12:123506281-123506303 GGGCTGAGGCGCAGAGGCCATGG + Intronic
1103932398 12:124457690-124457712 GGGAGGAGGCGGGGAGGCCCCGG - Intronic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1104709148 12:130973125-130973147 GAGCTAAGTCGCGGTGGCCCTGG + Intronic
1104972438 12:132538094-132538116 GGGCTGAGGCCCTGTGACCCAGG + Intronic
1104983448 12:132583762-132583784 AGGTGGAGGCGCGGTAGCCCCGG + Exonic
1104992319 12:132632738-132632760 GGGCTGAGGCGCAGTGCTCCAGG - Exonic
1105000480 12:132687275-132687297 GGGCGGCGGCGCGCGGACCCAGG - Exonic
1105411859 13:20177528-20177550 GGGAGGCGGCGCGGTGGCCGCGG - Intergenic
1105514308 13:21076436-21076458 GGGCGGAGGGGCGGTGGCTGAGG + Intergenic
1105801081 13:23903719-23903741 GGGCGGAGGCGCGGGAGGCGGGG - Intergenic
1106087735 13:26558087-26558109 GGCCGGAGGCCCGGAGGCGCGGG - Intronic
1107740169 13:43442068-43442090 GTGCGGAGGCTCTGGGGCCCTGG - Intronic
1110572977 13:77026710-77026732 GGGGGGGGGCGCGGGGGCCGGGG - Intronic
1112580565 13:100674149-100674171 AAGCGGCGGCTCGGTGGCCCCGG + Intronic
1113527531 13:110992304-110992326 GGGAGGAGGCTCGCAGGCCCGGG - Intergenic
1113656011 13:112068135-112068157 GGGCGTGGGCGCGGCGGCCGTGG + Exonic
1113664393 13:112131330-112131352 GAGCGGAGGCGAGGAGGCCACGG - Intergenic
1113701232 13:112390139-112390161 GGGGGGAGGAGTGGAGGCCCAGG + Intronic
1113737632 13:112689882-112689904 GGGCGGAGGCGCGAGGGGGCAGG + Intergenic
1113775632 13:112943465-112943487 GGGCCGGGGCGCGGCGGCCCGGG + Intronic
1113897916 13:113777495-113777517 GAGGGGAGGCGCGGTGGCCCCGG + Intronic
1114633087 14:24172100-24172122 GGGCGGCCGCGGTGTGGCCCCGG - Exonic
1114649040 14:24271494-24271516 GGGAGGAGGCGCGGGGGACGCGG + Exonic
1117365871 14:55027027-55027049 TGGCGGAGGCTCGGTCACCCGGG - Exonic
1117680647 14:58199954-58199976 GTGCGGGGGCGCGGAGGCCGCGG - Intronic
1118817702 14:69324541-69324563 GGGTGGAGGCGCGGGGCCTCTGG + Intronic
1119403250 14:74378560-74378582 GCGCGGGGGCCCGGAGGCCCTGG - Intergenic
1121017750 14:90558687-90558709 GGGCAGAGGAGCGCTGGCCGGGG - Intronic
1121368016 14:93332625-93332647 GGGCTGAGGCGCGGCGGCGCCGG - Intronic
1121437133 14:93927459-93927481 GTGTGGAGGCCCGGTGGCTCTGG + Intronic
1121919690 14:97869045-97869067 GGGGCCAGGCGCGGTGGCTCAGG - Intergenic
1122162384 14:99793626-99793648 GGGCCGAGGCCCGGCGGCCGCGG + Intronic
1122177741 14:99933574-99933596 GGTCGGAGGGGCAGTGCCCCTGG + Intronic
1122691302 14:103533231-103533253 GTGCGGAGGCGGGGCAGCCCTGG + Intronic
1122703780 14:103607742-103607764 GGGCGGGGGCGAGCTGACCCTGG - Intronic
1122886639 14:104713268-104713290 AGGAGGAGGCGCGGCGGCCTCGG + Exonic
1122984983 14:105207915-105207937 GTGCGGAGGTGCTGCGGCCCGGG - Intergenic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1123783264 15:23646469-23646491 GGGCGGATGGGTGGTGGGCCAGG + Exonic
1124957181 15:34367182-34367204 CGGCGGCGGCGCTCTGGCCCGGG + Exonic
1126827788 15:52568944-52568966 GGGCGGCGGCCGGGTGGCCTCGG - Intronic
1129016640 15:72474571-72474593 GGGCGGGGACGCCGAGGCCCCGG - Exonic
1130370882 15:83284583-83284605 GGGCGGACGCGGGGCGGCCCGGG - Exonic
1132560201 16:590061-590083 GTGGGGCGGCGCGGCGGCCCTGG + Intronic
1132683570 16:1153329-1153351 GGGCGGAGGCGCTGGGGGCCGGG + Exonic
1132683589 16:1153363-1153385 GGGCGGAGGCGCTGGGGGCCGGG + Exonic
1132841191 16:1979196-1979218 GGGGGGAGGGGCGGTGGCCTGGG + Exonic
1132868010 16:2103383-2103405 TGGCGGAGCTGCGGTGGCCCCGG + Exonic
1132915453 16:2341294-2341316 AGGAGAAGGCGCGGTGTCCCGGG + Intergenic
1132983757 16:2752877-2752899 TGGGGGAGGGGCGGCGGCCCCGG + Intronic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134346694 16:13398157-13398179 GGATGGGGGCGTGGTGGCCCAGG + Intergenic
1134523763 16:14929740-14929762 TGGCGGAGCTGCGGTGGCCCCGG - Intronic
1134549138 16:15131195-15131217 TGGCAGAGCTGCGGTGGCCCCGG + Intronic
1134626855 16:15728616-15728638 GGGGCCAGGCGCGGTGGCTCAGG + Intronic
1134711354 16:16328225-16328247 TGGCGGAGCTGCGGTGGCCCCGG - Intergenic
1134719205 16:16371528-16371550 TGGCGGAGCTGCAGTGGCCCCGG - Intergenic
1134948222 16:18340357-18340379 TGGCGGAGCTGCGGTGGCCCCGG + Intergenic
1134955475 16:18380468-18380490 TGGCGGAGCTGCGGTGGCCCCGG + Intergenic
1135400329 16:22162485-22162507 AGGAGGTGGCCCGGTGGCCCTGG + Intergenic
1136453962 16:30370109-30370131 GGGCGGCGGCGAGGGGGCCGCGG + Exonic
1136791223 16:32969341-32969363 AGGAGGAGGAGCGGTGTCCCCGG - Intergenic
1136878591 16:33884591-33884613 AGGAGGAGGAGCGGTGTCCCCGG + Intergenic
1137926671 16:52547201-52547223 GGGCGGAGCGGCGGCGGCGCGGG - Intronic
1138105624 16:54285951-54285973 CGGCGGCAGCGCGGGGGCCCGGG - Exonic
1138179247 16:54931079-54931101 GGCCAGAGGAGCGGCGGCCCAGG + Exonic
1138428361 16:56951418-56951440 GGGAGGGTGAGCGGTGGCCCTGG + Intergenic
1138553587 16:57759851-57759873 GGGCGGATGGGCGGGGGCCACGG + Intronic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139509086 16:67416254-67416276 GGTCTGAGGCGCGGCTGCCCCGG - Exonic
1139652926 16:68371587-68371609 GGGCGGCGATGGGGTGGCCCGGG - Exonic
1140404010 16:74695646-74695668 GGCCGAGGACGCGGTGGCCCAGG + Exonic
1141108702 16:81254542-81254564 GAGGGGAGGCGTGGTGGCTCAGG - Intronic
1142007504 16:87696508-87696530 GGTGGGAGGCGTGGTGGCCCAGG + Intronic
1142197126 16:88744132-88744154 AGGCGGGGGCGCGGGGCCCCTGG - Intronic
1142349714 16:89574596-89574618 GGGAGGAGGCGCAGAGGCCGGGG + Intergenic
1142433098 16:90040974-90040996 GGCCAGAGGCACTGTGGCCCCGG + Intronic
1203093432 16_KI270728v1_random:1230803-1230825 AGGAGGAGGAGCGGTGTCCCCGG - Intergenic
1142567582 17:850630-850652 GGGGGGCGGCGTGGGGGCCCCGG + Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1142855101 17:2724692-2724714 CGGCGGTGGCGCCGGGGCCCGGG + Intergenic
1143212262 17:5197097-5197119 GGGCCCTGGCGCGGTGGCTCAGG - Intergenic
1143223744 17:5282642-5282664 GGGCGGAGGCGGGGGCGCGCGGG + Intronic
1143446370 17:7012582-7012604 GGGCAGAGGGGGCGTGGCCCCGG - Exonic
1143486454 17:7257786-7257808 GGGCCCAGGCGAGGTGGCTCAGG + Intronic
1144026011 17:11276304-11276326 TGGCGGAGGGGAGGTGGCCTAGG + Intronic
1145828219 17:27893265-27893287 GGGCGGGGGCGCGGGGGCAGCGG - Intronic
1147040910 17:37718290-37718312 AGGATGAGGCGTGGTGGCCCAGG - Intronic
1147168602 17:38605707-38605729 GGGCGGGGGCGCGGGGGGCGGGG + Exonic
1147644747 17:42027015-42027037 GGGCGGAGGGCCAGGGGCCCTGG + Exonic
1147668525 17:42163697-42163719 GAGGGGAGGCACTGTGGCCCTGG + Exonic
1147907479 17:43832706-43832728 GGGCGGAGGCTGGAGGGCCCGGG - Intronic
1147927027 17:43952649-43952671 GGGTGGAGGCGTGGGGGCCAGGG - Intergenic
1148048831 17:44759439-44759461 GGGCAGGGACGCGGTGGGCCCGG - Intronic
1148081245 17:44968513-44968535 GGGCGGGGCCGCGGAGACCCCGG + Intergenic
1148455778 17:47810737-47810759 GGGCAGGGCCGGGGTGGCCCTGG - Intronic
1149659344 17:58326251-58326273 GGGCGGAGGCTGGGTGACCAAGG - Intronic
1149955434 17:61044164-61044186 AGGTGGGGGCGCGGTGGCTCAGG + Intronic
1150423254 17:65056814-65056836 CCCCGGAGGGGCGGTGGCCCCGG + Exonic
1151938886 17:77280991-77281013 GGGCGGAGGTGCGGGCGCTCCGG - Intronic
1152069803 17:78128839-78128861 GGGCGGGGGCGCCGCGGGCCGGG - Intronic
1152174946 17:78781714-78781736 GGGCGGACGCGCGGATGGCCGGG - Intronic
1152356499 17:79810123-79810145 GGGCTGCGGCGCGCGGGCCCCGG - Intergenic
1152362436 17:79838973-79838995 GGGCGGGGGCCCGGGGGCCGAGG - Intronic
1152382780 17:79950796-79950818 GGGCGGCGGCACAGTGGGCCGGG - Intronic
1152538798 17:80964583-80964605 GGACAGAGGCGCCGTGGCCGCGG - Exonic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152633389 17:81420640-81420662 GGGCAGAGCTGAGGTGGCCCTGG + Intronic
1152681136 17:81668622-81668644 GGGAGGAGGCGCACTGGCCTGGG + Intronic
1152711177 17:81871128-81871150 GGGCGGGGGCGCGGTGACAGCGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1152870732 17:82751823-82751845 GGCCTGAGACGCGGTGGGCCGGG - Intergenic
1152970681 18:158583-158605 AGGCGGAGGCGCGGTGGTGGCGG - Intronic
1153285189 18:3450082-3450104 GGGCGGAGGAGCGGCGGGGCGGG + Intronic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1154156489 18:11947988-11948010 GGGCGGAGGGGCAGGGCCCCGGG - Intergenic
1155007466 18:21741415-21741437 GGGCGGCGGCGCGGTCCCCGCGG - Exonic
1155073812 18:22338290-22338312 GGGAGGATGGGAGGTGGCCCAGG + Intergenic
1155175636 18:23298919-23298941 GTGCGAAGGCGCCGTGGCCTGGG - Intronic
1155928667 18:31684630-31684652 GAGGGGAGGCGCGGAGGCCGAGG + Exonic
1156352883 18:36316016-36316038 GGGAGAAGGAGGGGTGGCCCCGG + Intronic
1156411146 18:36829086-36829108 AGGCCGAGGCGTGGCGGCCCAGG + Intronic
1157833678 18:50879390-50879412 GGCCGGAGGCGCGGCAGCGCTGG - Intronic
1158980160 18:62752240-62752262 GGGTGGGGGCGCGGGGGGCCTGG - Intronic
1160295476 18:77633235-77633257 GGGCAGAGGCAGGGGGGCCCAGG - Intergenic
1160500495 18:79399418-79399440 GGGCGGAGGGGAGCCGGCCCGGG - Intronic
1160537605 18:79603485-79603507 GCGGGGAGGGGCTGTGGCCCTGG - Intergenic
1160747684 19:719630-719652 GGGCGGAGGAGCTGAGTCCCGGG - Intronic
1160765559 19:806068-806090 GCGCGCATGCGCGGTGGTCCCGG + Intronic
1160767282 19:814171-814193 GGGGGGAGGCACGGGTGCCCAGG - Intronic
1160837465 19:1131625-1131647 GAGCGGAGGCTGGGTGGGCCTGG - Intronic
1160868596 19:1266906-1266928 GGGCCGAGGCGCGGGGGCGGCGG + Intronic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160930058 19:1566351-1566373 GGGCGGAGGGGAGGGCGCCCTGG + Intronic
1161169083 19:2804155-2804177 AGCCTGAGGCACGGTGGCCCTGG + Intronic
1161215783 19:3094524-3094546 GGGCCGAGGGCCGGTGGCCGAGG + Exonic
1161237154 19:3203890-3203912 GTGGGGAGGCACGGAGGCCCAGG + Intronic
1161284688 19:3463267-3463289 CGGCAGAGGCGCGGGGGCCCGGG - Intronic
1161450638 19:4343618-4343640 GGGCGGAGGCGCGGGGCGCGGGG + Intronic
1161487578 19:4544059-4544081 GGTCCCAGGCGCGGGGGCCCAGG + Exonic
1162069887 19:8147326-8147348 GTGCGGAGGCGGGGCAGCCCAGG - Exonic
1162145508 19:8610655-8610677 CGGCGACGGCGCGGAGGCCCCGG - Intronic
1162298250 19:9828110-9828132 GGGCGGAGGCGCGGCTCCCCGGG + Intronic
1162421041 19:10566187-10566209 GGGCGGGTGGGCGGTGGCCGCGG - Intergenic
1162861172 19:13506504-13506526 GGGGCGGGGCGCGGGGGCCCGGG + Intronic
1162931963 19:13961978-13962000 GGGCGGGGGCGCGGGGGCTGGGG + Exonic
1163287030 19:16355372-16355394 GGGAGGAGGCGGGGAAGCCCTGG + Exonic
1163534974 19:17871888-17871910 AGGCGGAGTCGCGGTGACCCGGG + Intergenic
1163607240 19:18281932-18281954 GGGCGGGCGCCTGGTGGCCCGGG - Intergenic
1163845057 19:19633965-19633987 GGGCGGGGGCTCAGTGGCCTGGG + Exonic
1164643633 19:29843514-29843536 GGGAGGAGACAGGGTGGCCCCGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164693205 19:30226036-30226058 GGGCGGGGAGGCGGCGGCCCAGG - Intergenic
1164995716 19:32719667-32719689 GGACTGACGCGCGGAGGCCCTGG - Intergenic
1165774039 19:38394762-38394784 GAGCGGAGGAGCGGCGGCGCTGG - Exonic
1165775674 19:38403180-38403202 GGAGGGGGCCGCGGTGGCCCAGG + Exonic
1165917631 19:39270301-39270323 GGTCAGAGGCTCGCTGGCCCTGG + Intergenic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1166064327 19:40348323-40348345 GGGCGCGGGCCCGGTGGGCCAGG - Intronic
1166100853 19:40570612-40570634 GGGCGGAGCCGCCCTGGGCCGGG - Exonic
1166306439 19:41939022-41939044 GGGAGGAGACGCGGGGGGCCTGG - Intergenic
1166306859 19:41940254-41940276 GGGCGGAGGGGCGGGGGTTCCGG + Intergenic
1166387740 19:42391483-42391505 GGGAGGAGGGGCTGGGGCCCTGG + Intergenic
1166504290 19:43361678-43361700 GGGAGGAGGCGCTGGGGGCCTGG + Intronic
1166504317 19:43361750-43361772 GGGAGGAGGCGCTGGGGGCCTGG + Intronic
1166630354 19:44401204-44401226 GGGCAGAGGGGCGCTGGCTCAGG - Intronic
1166830979 19:45639451-45639473 GGGCAGGGGCGCGGCGGCCCGGG - Intronic
1167040286 19:47019757-47019779 GGGCGGAGACGCGGCGGGCGGGG + Intergenic
1167245514 19:48370879-48370901 GAGAGGAGGCGGGGAGGCCCAGG - Intronic
1167249402 19:48392352-48392374 GGGAGGAGGGGCTGGGGCCCTGG - Intergenic
1167249419 19:48392389-48392411 GGGAGGAGGGGCTGGGGCCCTGG - Intergenic
1167249436 19:48392426-48392448 GGGAGGAGGGGCTGGGGCCCTGG - Intergenic
1167258262 19:48443564-48443586 GGGCAGGGGCCCGGCGGCCCAGG - Exonic
1167266532 19:48485586-48485608 GGGCTGGGGGGCGGGGGCCCGGG + Exonic
1167314991 19:48757735-48757757 GGGAGGAGGCGCTGGGGGCCTGG + Intronic
1167315015 19:48757808-48757830 GGGAGGAGGCGCTGGGGGCCTGG + Intronic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167369495 19:49072207-49072229 GGGCGAAGGCGCGGCGGGGCAGG + Exonic
1167560838 19:50225923-50225945 GGGAGGAGGGGCTGGGGCCCTGG + Intronic
1167560950 19:50226220-50226242 GGGAGGAGGGGCTGGGGCCCTGG + Intronic
1167960778 19:53102972-53102994 AGGCGGAGGCGCGGCCTCCCCGG + Intronic
1168048372 19:53810298-53810320 GGCTGGAGGCGCGGGGCCCCCGG + Exonic
1168251737 19:55145971-55145993 GGGCGGTGGGGCGGTGGGCAGGG - Intronic
1168266249 19:55225286-55225308 GGGAGGAGGGGCTGGGGCCCTGG - Intergenic
1168295368 19:55375184-55375206 GGGAGGAGGGGCTGGGGCCCTGG - Intergenic
1168320076 19:55503845-55503867 ATGCGCAGGCGCGGTGGGCCCGG + Intronic
1168325675 19:55537348-55537370 GGGAGGAGGCGCTGGGGGCCTGG - Intergenic
1202707291 1_KI270713v1_random:32947-32969 GGGCAGGTGCGCGGTGCCCCTGG + Intergenic
925395157 2:3528414-3528436 GGGCTGAGGAGCGCTGGGCCAGG - Intergenic
925926839 2:8676963-8676985 GGGCAGAGGGGGGGTGGCCTGGG + Intergenic
926594690 2:14777354-14777376 GGGGCCAGGCGCGGTGGCTCAGG - Intergenic
926695840 2:15769877-15769899 GCACCGAGGCGAGGTGGCCCAGG + Intergenic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927215746 2:20667094-20667116 GGGCGGGGGTGGGGTGGGCCAGG + Exonic
927713959 2:25341214-25341236 GGGGGGAGGGGCGGGGGGCCGGG + Intronic
928143540 2:28751677-28751699 GTGCGGTTGCGCGGCGGCCCAGG + Intronic
928972902 2:37050757-37050779 GAGGCGAGGCGCGGTGGCCTAGG + Intronic
930096398 2:47570116-47570138 AGGCGGAGGCGCGGGCGCGCTGG - Exonic
930104910 2:47632075-47632097 GGGCTGAGGCGAGGTGGCTGAGG + Intergenic
930700798 2:54456598-54456620 GGGAGGAGGGGCGCGGGCCCAGG + Intronic
932699899 2:73985203-73985225 GGCGGGAGGCGCGGGGGGCCCGG + Intergenic
932835145 2:75029179-75029201 GGGCAGAGGCCAGGTGGTCCTGG + Intergenic
933190057 2:79324392-79324414 GGGCTGAGGCATAGTGGCCCTGG + Intronic
934993175 2:98935842-98935864 GGGCGGAGGTGGGGCGGGCCGGG - Intronic
935149066 2:100417510-100417532 GGGCCGCGGCGCGGAGGCCTCGG - Exonic
935820155 2:106886430-106886452 GCGCGGAGCAGCGCTGGCCCCGG - Exonic
936285257 2:111176567-111176589 GGGTGGAGGTGAGGTGGCCCCGG + Intergenic
936388945 2:112055026-112055048 GTGCGGAGGCAGGGTGCCCCAGG - Intergenic
937126252 2:119476698-119476720 AGGCGGAGGTGCTGTGGCTCTGG + Intronic
937221734 2:120346046-120346068 GGGCGGGCGGGCGGAGGCCCGGG + Intergenic
937932680 2:127219088-127219110 GGACGGAGGCTCGGAGGCTCGGG - Intronic
938397857 2:130963974-130963996 GGGCGGCGGTGCGGCGGCCGCGG - Intronic
938543384 2:132305153-132305175 GGGCAGAGGGGCGCTGGCTCAGG + Intergenic
938608257 2:132919344-132919366 AGGTGGAGGCGCAGAGGCCCTGG + Intronic
941666279 2:168246922-168246944 GGGCGGTGGAGCGGAGGACCAGG - Intronic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942459092 2:176157386-176157408 GGGGGGCCGCGCGGTGCCCCCGG + Intronic
943060497 2:183037946-183037968 CGGCGGAGGCGGGCGGGCCCGGG - Intronic
944495920 2:200307035-200307057 CGGCGGAGGCTGGGCGGCCCGGG - Intronic
947800992 2:232928367-232928389 GGGCAGAGCTGCGGAGGCCCTGG + Intronic
948046850 2:234951931-234951953 GGGCGGGGGCGCGGGGGGCGGGG - Intergenic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948625461 2:239265533-239265555 GGGGGGAGGTGCGGTGGGGCGGG + Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949000529 2:241610415-241610437 GGGCGGAGGCTGGGCGGCGCTGG + Intronic
949004332 2:241636908-241636930 GGGCGGGGGCGTGGCGGCCCGGG + Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168769769 20:407975-407997 GGGCGGGGCCGGGGTGGGCCGGG - Intronic
1169065572 20:2692821-2692843 CGGCGGCGGCGGGATGGCCCGGG + Intergenic
1171191324 20:23161664-23161686 GGGCGCAGCGGCTGTGGCCCCGG + Intergenic
1171488683 20:25501457-25501479 GGGCAGAAGTGCGCTGGCCCAGG + Intronic
1173101832 20:40095058-40095080 GGGTGGAGGAGCGGAGGCCGAGG - Intergenic
1173221706 20:41137330-41137352 GGACGGAGGCGCGATGGCGGCGG - Intronic
1173548099 20:43914683-43914705 GGCCGGGGGCCCGGGGGCCCGGG - Intergenic
1173769047 20:45641327-45641349 GCGGGGAGGCCCGGAGGCCCTGG - Intergenic
1175108229 20:56629224-56629246 GGGGGCCGGCGCGGAGGCCCAGG - Intergenic
1175215259 20:57389231-57389253 GGCTGGAGACGCGGTTGCCCAGG - Intergenic
1175428714 20:58888621-58888643 GAGCCGAGGAGCGGTGGCCGTGG - Intronic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1176034303 20:63028911-63028933 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034314 20:63028942-63028964 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034334 20:63029004-63029026 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034345 20:63029035-63029057 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034356 20:63029066-63029088 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034367 20:63029097-63029119 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034378 20:63029128-63029150 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034389 20:63029159-63029181 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034400 20:63029190-63029212 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034420 20:63029252-63029274 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176034431 20:63029283-63029305 ACACGGAGGCGCGGAGGCCCGGG - Intergenic
1176110069 20:63407066-63407088 CGGGGGAGGTGCCGTGGCCCTGG + Exonic
1176148042 20:63574135-63574157 GGGCGGGGGCGCGGGGGTCCAGG - Intronic
1176148045 20:63574143-63574165 GGGCGGAGGGGCGGGGGCGCGGG - Intronic
1176306137 21:5124068-5124090 GGGGCCAGGCGCGGTGGCTCAGG + Intronic
1176386623 21:6141226-6141248 GGGAGGAGGCGCAGTGGCCAGGG + Intergenic
1176510554 21:7744870-7744892 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1177414976 21:20781224-20781246 GGGCTGAGGCCCGGTGGCTGAGG + Intergenic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1178644667 21:34375399-34375421 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1179736850 21:43397026-43397048 GGGAGGAGGCGCAGTGGCCAGGG - Intergenic
1179850921 21:44137963-44137985 GGGGCCAGGCGCGGTGGCTCAGG - Intronic
1180109906 21:45642986-45643008 GGGCGGATCCGCGGTGGGCGGGG - Intergenic
1180957882 22:19749351-19749373 GGGCAGAGGCACGGCAGCCCTGG - Intergenic
1181023843 22:20116819-20116841 GGGAGGAGGCGGGGTGGGTCAGG - Intronic
1181032275 22:20154396-20154418 GCCCTGAGGCGAGGTGGCCCTGG + Intergenic
1181051542 22:20240445-20240467 GGGCGGAGGAGCTGGGGCCTTGG + Intergenic
1181082802 22:20425611-20425633 GGGCCGCGCCGAGGTGGCCCTGG - Exonic
1181116512 22:20635338-20635360 GGCCGGAGCCTGGGTGGCCCTGG - Intergenic
1182335495 22:29580922-29580944 GGGTGCAGGCGCGGGGGCCAGGG - Intronic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1182998524 22:34836020-34836042 GGGTGGAGGAGCGGTGGCTGAGG - Intergenic
1183365737 22:37405834-37405856 GGGTGGAGGGGGGGTGGTCCTGG + Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183489522 22:38109099-38109121 GGGCTGGGGCTCGGTGGCCCGGG + Intronic
1184236818 22:43187259-43187281 GGGCGGAGGCGGGGGGGGCTGGG - Intergenic
1184250369 22:43256779-43256801 GGAGGGAGGCTGGGTGGCCCGGG + Intronic
1184294049 22:43512698-43512720 GGGCTGGGGGGAGGTGGCCCAGG - Intergenic
1184481796 22:44752520-44752542 GGGCGGAGGGGCGGGGGGGCGGG + Intronic
1184593749 22:45502537-45502559 GCGCGGAGGAGCGGGGACCCGGG - Intronic
1185020525 22:48372114-48372136 AGGCGGAGGCGCCGGGGACCTGG - Intergenic
1185373836 22:50473139-50473161 GGTGGGAGGCGTGGTGGCCGTGG - Intronic
1185409647 22:50674906-50674928 TCGCGGAGGCGCGGGGTCCCGGG + Intergenic
949292823 3:2485289-2485311 GGGCGGGCACGCGGTGGCACGGG + Intronic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
950487816 3:13283133-13283155 AGCAGGAGGCGCGGGGGCCCCGG - Intergenic
951456854 3:22902520-22902542 GGGGGTATGCGTGGTGGCCCTGG - Intergenic
952481660 3:33768317-33768339 GGGGCCAGGCGCGGTGGCTCAGG + Intergenic
952929293 3:38347052-38347074 GGGCAGGGGCGCGGGGGCCCCGG - Intronic
952970901 3:38649611-38649633 GGGCGCAGGCTCAGCGGCCCCGG + Exonic
953157360 3:40387129-40387151 GGGCGGGGGCGGGGCGGCCTCGG - Intergenic
953460307 3:43076554-43076576 GGGCTGAGGAGCTCTGGCCCAGG + Intergenic
953724765 3:45388446-45388468 GGGCGTCTGCGCGGCGGCCCGGG - Intergenic
953858430 3:46520705-46520727 GGGAGGAAGCGCACTGGCCCTGG - Intronic
953863741 3:46566085-46566107 GGGCGGATGGCCGGTGCCCCGGG - Intronic
954152096 3:48662732-48662754 AGGCGGAGGGGCGGGGGCCCGGG - Exonic
954215762 3:49123672-49123694 GGGCAGAGGCCCAGTGGACCAGG - Intronic
954780910 3:53059277-53059299 GGGGCCAGGCGCGGTGGCTCAGG - Intronic
955997027 3:64688045-64688067 GGGCGGAGGCGGGGGGGCCGCGG + Intergenic
961386098 3:126524264-126524286 GGGCGGAGTTGCACTGGCCCAGG - Exonic
961636550 3:128336523-128336545 TGGCTGAGGTGCGGTGGTCCAGG - Intronic
963827312 3:149970287-149970309 GGGCTGGGGCGCGCGGGCCCCGG - Intronic
963870301 3:150408720-150408742 GGGCGGTGGGGCTGTGGCGCGGG - Exonic
966840462 3:184083388-184083410 GGGGGCAGGCGCGGTGGCTTAGG - Intergenic
968213333 3:196867781-196867803 GGGCGGGGGCGGGGCGGCCCCGG + Intergenic
968457136 4:705664-705686 GGGCGCAGGCGCGTCGGGCCTGG - Intergenic
968479606 4:827333-827355 GGGCAGAGGCGCTGGGGCCAAGG - Intergenic
968512927 4:1003248-1003270 GGGAGGTGGAGCGGTGGGCCGGG + Intronic
968571641 4:1345347-1345369 AGGCCCAGGCACGGTGGCCCAGG + Intergenic
968817118 4:2827917-2827939 AGGTGGAGCCGGGGTGGCCCTGG + Intronic
969113814 4:4859529-4859551 GCCCGGAGGCGCGCTGGGCCTGG - Intergenic
969295772 4:6270033-6270055 GGGCAGTGGCGCGGTGGCTGTGG + Intronic
969460565 4:7326741-7326763 GGCTGGAGGCGCTGTGACCCAGG + Intronic
969611909 4:8232204-8232226 GGGCGGCGGGGCGGGGGCACAGG + Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
973613654 4:52659237-52659259 GGGCGGCAGCGCGGCGGCCTGGG + Exonic
973979819 4:56298649-56298671 GGGGCCAGGCGCGGTGGCTCAGG + Intronic
975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG + Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975973873 4:80073140-80073162 GGGAGGAGGCTAGCTGGCCCTGG + Intronic
976297248 4:83484868-83484890 GGGAGGAGGCGCGGCGGCGTCGG + Intronic
976825550 4:89256543-89256565 GGGGAGAGGTGTGGTGGCCCTGG + Intronic
978503462 4:109433541-109433563 GGCCGGAGCCGAGCTGGCCCAGG - Intergenic
979087482 4:116430912-116430934 GGATGGAGGCCAGGTGGCCCAGG - Intergenic
979122924 4:116926276-116926298 GGGCGGCGGCGCGGGTGGCCTGG - Intergenic
979349264 4:119627300-119627322 GGGCGGCGGCGCGGAGGCCGGGG - Intronic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
980075153 4:128287243-128287265 CGGCCGAGGCGCGGGGGTCCCGG + Intronic
980595851 4:134953024-134953046 GGGCGGGGGCGCGTAGGCTCTGG - Intergenic
980969536 4:139556051-139556073 GGGAGGAGGCGCAGAGGGCCTGG - Intronic
981504275 4:145482352-145482374 GAGCCGAGGCTCGGGGGCCCGGG - Intronic
982198158 4:152936387-152936409 GAGCGGGGGCGCGCTGGCCGCGG + Exonic
982288821 4:153760033-153760055 GGGCGGAGGCGGGGCGTGCCGGG - Exonic
983610016 4:169632446-169632468 GGGGCCAGGCGCGGTGGCTCAGG + Intronic
984271842 4:177557457-177557479 GGATGGAGGCGTGGTGGGCCAGG - Intergenic
984667836 4:182448246-182448268 TGGCGGAGAGGCGGTGGCCGAGG + Intronic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
985574301 5:666428-666450 GGGCGGGGCTGTGGTGGCCCCGG - Intronic
985577115 5:678626-678648 GGGAGGGTGCGTGGTGGCCCTGG + Intronic
985632485 5:1021351-1021373 GGGTGGAGGGGCGGGGGGCCGGG - Intronic
985689487 5:1299223-1299245 GGACGGGGGCGTGGTGGGCCAGG - Intergenic
985713864 5:1445265-1445287 GGGCGCAGGGGCGGGGGCCGGGG - Intronic
985749753 5:1667388-1667410 GAGCGGTGGCGCCGTTGCCCTGG + Intergenic
985896301 5:2751573-2751595 GGGCGGCGGCGGGGTGGCGGTGG + Exonic
987373719 5:17216738-17216760 CGGGGGAGGCGCGGTCGCCGAGG - Intronic
988361905 5:30247345-30247367 GGGGCCAGGCGCGGTGGCTCAGG + Intergenic
989103437 5:37840086-37840108 GAGGGGAGGCGCGGGGCCCCGGG + Intergenic
989196705 5:38723445-38723467 GGGTGGAGGCTGGGTGGGCCGGG + Intergenic
989368578 5:40681707-40681729 GGGAGGCAGCGGGGTGGCCCCGG - Exonic
990557599 5:56951736-56951758 GGGAAGAGGCGCGGAGGCGCCGG + Intronic
990648983 5:57877256-57877278 GGGGCCAGGCGCGGTGGCTCAGG - Intergenic
991474369 5:67004147-67004169 GGGAGGGGGAGCGGCGGCCCAGG + Intronic
992152337 5:73917569-73917591 GTGCTGAGGCGGGATGGCCCTGG - Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
994736451 5:103562543-103562565 GGGCGCAGGCGCGGGAGCCACGG - Intronic
995388312 5:111612254-111612276 GGGCGGGGGCGGGGTGGGCGCGG + Intergenic
996804679 5:127441254-127441276 GGGAGGAGGGCTGGTGGCCCAGG + Intronic
996900551 5:128538169-128538191 GGGCGGAGGTGCGCGGGGCCGGG + Intronic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
999197587 5:149793043-149793065 AGGCGGAGGAGAGGTGGGCCTGG + Intronic
999727015 5:154446016-154446038 GGGCGGCGGCCGGGCGGCCCAGG + Exonic
1000209101 5:159095193-159095215 GGGCGGAGGAGGGGTGGCAGAGG - Intronic
1001402942 5:171456801-171456823 GGGCCGCGGCGGGGTGGCCTAGG - Exonic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001633928 5:173196460-173196482 GTGCAGTGGCGAGGTGGCCCTGG - Intergenic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002006424 5:176238378-176238400 GGCCGGCGTGGCGGTGGCCCGGG + Exonic
1002160721 5:177312526-177312548 CGGCGGAGGGGCGGCGGACCCGG + Intronic
1002219954 5:177672259-177672281 GGCCGGCGGGGCGGTGGCCCGGG - Intergenic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1002991740 6:2245288-2245310 GGGCGGGGGCGCGCCGGCCGAGG - Intronic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003552275 6:7109288-7109310 GGGAGGGGGCGCGGGGGGCCCGG - Intronic
1003873590 6:10419320-10419342 GAGAGGAAGCGCCGTGGCCCAGG - Intronic
1004216784 6:13711257-13711279 CGGCGGGGCCGCGGTGGCCGGGG + Exonic
1004627918 6:17393920-17393942 GGGCCGGGGCGCGGCGACCCGGG + Intronic
1004650249 6:17600885-17600907 GGGCGGCGGCGCCGCGGCCTGGG - Exonic
1004767650 6:18748598-18748620 GGGCAGAGGGGCCGTGGCCCTGG + Intergenic
1004836919 6:19540589-19540611 GGGTGGAGGAGCGGTGGCTGAGG - Intergenic
1005881695 6:30067250-30067272 GGGTGGAGAAGCGGAGGCCCAGG + Exonic
1006461813 6:34163721-34163743 GGGAGGAGGCGCGGGAGGCCCGG - Intergenic
1006717568 6:36130361-36130383 GGGCGGAAGCGCGGGAGCGCAGG + Exonic
1007633539 6:43285340-43285362 GGCAGGAGGCGCGGAGGGCCGGG + Exonic
1007751320 6:44073573-44073595 GGGAGGGGCCGCGGCGGCCCTGG + Intergenic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1012399897 6:98834513-98834535 GGGCGGAGGGGGCGGGGCCCAGG + Intergenic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1013619357 6:111873097-111873119 GGGCGGCGCCGGGGTGTCCCCGG + Exonic
1014019521 6:116571463-116571485 GGGCGCAGGCGCAGAGTCCCCGG - Exonic
1014230088 6:118893946-118893968 GGGCGGAGGGGGCGTGGCCGCGG - Intronic
1016272150 6:142301833-142301855 GGGCTCAGGTGCGGCGGCCCCGG - Intronic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016937253 6:149456612-149456634 GGGCGGCGGGGCGGGGGGCCGGG - Intronic
1018017810 6:159727604-159727626 GTCCGGCTGCGCGGTGGCCCGGG + Intronic
1018020918 6:159761885-159761907 GGGCGGAGGCGCGCGGGGCGCGG - Exonic
1018231390 6:161679395-161679417 GGTCAGAGGCGCGCTGTCCCAGG - Intronic
1019319566 7:409471-409493 GGGCCGGGGCGAGGTGGGCCGGG - Intergenic
1019712770 7:2525009-2525031 GGGCGGGGGCGGGGCCGCCCTGG + Intronic
1020034842 7:4958764-4958786 GCGAGGAGGCGCGGGCGCCCCGG + Intronic
1020262133 7:6536502-6536524 GGGGGCAGGCGGGCTGGCCCGGG + Intronic
1020275491 7:6622251-6622273 GGGCGGCGGAGCGGCGGTCCCGG + Exonic
1021958799 7:25852581-25852603 GGGCGGGGGCGCGGAGGACGCGG - Intergenic
1022410731 7:30136439-30136461 GGGCGGAGGTGGGGTGGTGCGGG + Intronic
1022427754 7:30284854-30284876 GGGAGGAGGGAAGGTGGCCCCGG + Exonic
1022497032 7:30859778-30859800 GGGCGGTGGCCAGGAGGCCCTGG + Intronic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023810412 7:43906763-43906785 GGGTGGGGGCGGGGCGGCCCAGG + Exonic
1023913071 7:44569078-44569100 GAGGGGAGGGGCTGTGGCCCAGG - Intronic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1025762262 7:64405623-64405645 GGGAGGGGGCGAGGGGGCCCCGG - Intergenic
1026470943 7:70693991-70694013 CGGAGGAGGGGCGGTGGCACCGG + Intronic
1027220587 7:76211368-76211390 GGGCGGAGGAGCGAAAGCCCGGG + Intronic
1027374891 7:77538528-77538550 TGGCGGAGGCGGGGGGGCGCTGG - Intronic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029479655 7:100804909-100804931 AGGCGGAAGCGCGATGGCCCAGG + Intronic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032443710 7:131962124-131962146 GGACGGATGCTCAGTGGCCCAGG - Intergenic
1033220373 7:139523591-139523613 GGGAGGAGGCGCGGAGGAGCGGG - Intergenic
1033299826 7:140176360-140176382 GGGCGGGGCGGCGGCGGCCCGGG + Intronic
1033653131 7:143356744-143356766 GGGGGTAGGCGCAGTGGACCTGG - Exonic
1033732915 7:144195893-144195915 GGGCGCAGGCGGGGTGACCCGGG + Intergenic
1033743767 7:144294473-144294495 GGGCGCAGGCGGGGTGACCCGGG + Intergenic
1033750134 7:144355124-144355146 GGGCGCAGGCGGGGTGACCCGGG - Intergenic
1034179574 7:149126763-149126785 TGGGGGGCGCGCGGTGGCCCGGG + Intronic
1034182171 7:149147541-149147563 CGGCGGAGGCGCGGTGCAGCAGG - Exonic
1034217985 7:149422485-149422507 GGCCAGAGGCGAGGAGGCCCCGG - Intergenic
1034513269 7:151553408-151553430 GGGCTCAGGCGCGAAGGCCCAGG - Intergenic
1034900874 7:154907180-154907202 GGGTGGAGGCGGGGAGGCTCGGG - Intergenic
1034911705 7:155003078-155003100 GGGCGGGGGCGCGGAGGGCGGGG - Exonic
1035573356 8:688310-688332 GCGCCGAGGTGGGGTGGCCCGGG - Intronic
1036295122 8:7528911-7528933 CGGAGGTGGCGCGGGGGCCCTGG + Intergenic
1036327441 8:7792080-7792102 CGGAGGTGGCGCGGGGGCCCTGG - Intergenic
1036793941 8:11742155-11742177 GGGAGGAGCCGCTGGGGCCCAGG + Intronic
1037832231 8:22196507-22196529 GGGAGGAGGCAGGGTGGCCTGGG - Intronic
1038204927 8:25457805-25457827 GGGAGGAGGCGCGCCGGCTCCGG - Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038554118 8:28494548-28494570 GGGCTGCGGAGCGGGGGCCCGGG + Intronic
1038734403 8:30156268-30156290 GGGCGGAGCCGGGGTGGGGCGGG - Intronic
1038761062 8:30384592-30384614 GGGCGGAGGAGCGCGGGCCGCGG - Exonic
1039212694 8:35235348-35235370 GGGCGGTGACGCGGCGGCGCTGG - Intergenic
1039847832 8:41338290-41338312 GGGCAGGGGCGGGGTGGCCAAGG - Intergenic
1039936597 8:42051641-42051663 GGGCGGCGGCGCGCGGGCCGCGG + Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1041044814 8:53879778-53879800 GCGGGGAGGGGCGGTGTCCCGGG - Intronic
1044999815 8:97869431-97869453 GGTCGAAGGCGCCGGGGCCCCGG - Intronic
1045583405 8:103501483-103501505 GGGCGAAGGCGCGCTGGCAGGGG + Intronic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1048554110 8:135458000-135458022 GGGTGGAAACGCGGGGGCCCAGG + Intronic
1049280115 8:141739950-141739972 GGACGCAGGGGCGGTGACCCGGG + Intergenic
1049299264 8:141861196-141861218 AGGCGCAGGTGGGGTGGCCCTGG + Intergenic
1049460727 8:142726581-142726603 GGGCGGAAGCGGGGGAGCCCGGG - Intergenic
1049572918 8:143378026-143378048 GGTCGGAGCCCCTGTGGCCCTGG - Intronic
1050850506 9:10279053-10279075 GGGGCCAGGCGCGGTGGCTCAGG - Intronic
1052998891 9:34566391-34566413 GGGCGGAAGGGCGGTGGCTGGGG + Intronic
1053072900 9:35111516-35111538 GCGCGGAGCCGGGGCGGCCCCGG - Exonic
1055950323 9:81724220-81724242 GGGGCGAGGCGTGGTGGCTCAGG - Intergenic
1056135037 9:83623082-83623104 GGGCGGAGCCGCTCTCGCCCCGG - Intronic
1056350310 9:85742240-85742262 GTACGGAGGGGCGGTGGCCGGGG - Intergenic
1056386265 9:86099540-86099562 GGCCGGAGACGCGGCGGCGCTGG - Exonic
1057555371 9:96083646-96083668 GGGCAGGGGCCCGATGGCCCTGG - Intergenic
1058023710 9:100117590-100117612 GGGCGGGGGGCCGGAGGCCCTGG - Intronic
1058058463 9:100472974-100472996 GGGCAGGGGCGCGGGGGCCGGGG - Intronic
1058175988 9:101737605-101737627 GGGCGGAGGCCCTGTGGCCACGG - Exonic
1058413845 9:104764399-104764421 CGGCGGCGGCGCGGGGCCCCAGG - Intronic
1058612321 9:106789882-106789904 GGGTGGAGGAGCGGAGGCCAAGG - Intergenic
1058687204 9:107489485-107489507 GGGCGCAGGGGCTGTGGCCGGGG + Exonic
1059176766 9:112175253-112175275 GGGAGGAGGCGCGGGCGCGCCGG - Exonic
1060192074 9:121599663-121599685 CGGCGGAGTCGCGGTGTCGCCGG - Intronic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060549359 9:124477782-124477804 TGGGGGAGGGGCGCTGGCCCCGG - Intronic
1060811740 9:126614285-126614307 GAGCGGCGACGCGCTGGCCCCGG - Intergenic
1061208394 9:129177212-129177234 GGGCGGAGGCGCAGCAGTCCTGG + Exonic
1061348078 9:130042842-130042864 GGGCGGAGGCGAGGGCGCGCTGG - Intronic
1061559778 9:131394612-131394634 GGCCGGAGGGGCGGGGGTCCCGG + Intronic
1062162613 9:135088334-135088356 GGGCGGAGATGGAGTGGCCCAGG - Intronic
1062192969 9:135257162-135257184 CGGTGGAGGCGCCCTGGCCCAGG - Intergenic
1062347001 9:136119446-136119468 GGGCGGCGGGGGGGCGGCCCTGG - Intergenic
1062527594 9:136984584-136984606 GGGCTGTGGCGTGGGGGCCCTGG + Intronic
1062574663 9:137200591-137200613 GGGCGGGGGCGCGGGGCCCGGGG - Exonic
1062582374 9:137234287-137234309 GGGAGGAGGTGCGGTGGCCAGGG + Intronic
1062602421 9:137323909-137323931 TGGCGGAGGCGGGCTGGGCCTGG - Intronic
1187042514 X:15611878-15611900 AGGCCCAGGCGCGGTGGCTCAGG + Intergenic
1189101687 X:38197057-38197079 GGGCGGAGGGGAGATGGCACAGG + Intronic
1196001985 X:110795955-110795977 AGGCGCGGGCGCGGCGGCCCGGG + Intergenic
1196927415 X:120647245-120647267 GGGTGAAGGTGCTGTGGCCCAGG + Intergenic
1198276292 X:135098268-135098290 GGGCGGAGGTGGGGCGGCCCGGG - Intergenic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic