ID: 1094051670

View in Genome Browser
Species Human (GRCh38)
Location 12:26226984-26227006
Sequence GGGCGGAGGCGCGGTGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 586}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094051670_1094051675 -7 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051675 12:26227000-26227022 TCCGCCCGCTGCGCAGCGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 155
1094051670_1094051680 1 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051680 12:26227008-26227030 CTGCGCAGCGCCGGGCTGATGGG 0: 1
1: 0
2: 1
3: 31
4: 407
1094051670_1094051674 -8 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 122
1094051670_1094051679 0 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051679 12:26227007-26227029 GCTGCGCAGCGCCGGGCTGATGG 0: 1
1: 0
2: 2
3: 50
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094051670 Original CRISPR GGGCGGAGGCGCGGTGGCCC CGG (reversed) Intronic