ID: 1094051674

View in Genome Browser
Species Human (GRCh38)
Location 12:26226999-26227021
Sequence CTCCGCCCGCTGCGCAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094051664_1094051674 18 Left 1094051664 12:26226958-26226980 CCCGGGCGCTGCTGTTACATAAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 122
1094051665_1094051674 17 Left 1094051665 12:26226959-26226981 CCGGGCGCTGCTGTTACATAAGC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 122
1094051670_1094051674 -8 Left 1094051670 12:26226984-26227006 CCGGGGCCACCGCGCCTCCGCCC 0: 1
1: 0
2: 4
3: 76
4: 586
Right 1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 122
1094051669_1094051674 -7 Left 1094051669 12:26226983-26227005 CCCGGGGCCACCGCGCCTCCGCC 0: 1
1: 0
2: 7
3: 48
4: 392
Right 1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094051674 Original CRISPR CTCCGCCCGCTGCGCAGCGC CGG Intronic
900342977 1:2197395-2197417 CTGCGCCAGCCGGGCAGCGCAGG - Intronic
900786892 1:4655129-4655151 CTCCGCCGGCGGCACAGCGAAGG - Exonic
901242590 1:7704111-7704133 CCCCGCTCGTTGCGCAGCGCCGG + Intronic
904037934 1:27568729-27568751 CTCCGCTCGCTGCGCCCCTCAGG + Intronic
905463078 1:38134021-38134043 CTCCGCCTGCTCCGCCGCCCCGG - Intergenic
905995847 1:42380435-42380457 CGCCGCCCACTGCGCATCTCTGG + Intergenic
910759098 1:90718001-90718023 CTCCCCGCGCCGCGCCGCGCCGG + Intergenic
914428289 1:147599196-147599218 CTCCGCCCTCTGCGAAGTGCAGG - Intronic
915519919 1:156436174-156436196 CTCCGCGCGCTGCCCGCCGCCGG + Intergenic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
922502916 1:226110169-226110191 CTCCGCCCGGTGCGTCCCGCGGG + Intergenic
923072869 1:230581677-230581699 CTCCACCCCCTGCCCAGCCCCGG - Intergenic
1063971702 10:11385647-11385669 CCCCACCTGCTGCGCAGAGCTGG - Intergenic
1065022168 10:21509794-21509816 CTCCGCCCAATGCGAAGAGCTGG + Intergenic
1065188611 10:23191983-23192005 CCGCGCGCGCTGAGCAGCGCCGG - Intergenic
1068554909 10:58448297-58448319 CGCCCCCTGCTCCGCAGCGCCGG - Intergenic
1069909394 10:71750410-71750432 CTACTCCCACTGCTCAGCGCGGG - Exonic
1069945845 10:71985124-71985146 CCACGCCAGCTGCGCAGCACAGG - Intronic
1070197990 10:74176659-74176681 CTCCGCCCCGTGCGAAGGGCTGG - Intronic
1075405211 10:122190743-122190765 CTCCCCCCGCTGCACATCACTGG - Intronic
1076674322 10:132140363-132140385 CTCCTCCCGCTGCCCAACGGTGG - Intronic
1083679463 11:64344505-64344527 CTCCTCCAGCTGCACAGAGCTGG - Exonic
1084412785 11:69013875-69013897 ATCCTCCCGCTGAGCAGCGCAGG - Intergenic
1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG + Intronic
1097891349 12:64780753-64780775 CTCCTCCCGCCTCGCGGCGCCGG - Intergenic
1102278356 12:111599393-111599415 CCCCGCCCGCTCCGCCGCGCCGG + Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1105414002 13:20193301-20193323 CCCCGCCCACGGCACAGCGCCGG - Intergenic
1106242830 13:27924262-27924284 CTCCTCCGGCTCCGCAGCGTAGG - Exonic
1114612492 14:24051978-24052000 CTCCCCCCGCCTCGGAGCGCCGG - Exonic
1114623490 14:24113829-24113851 CTCCGCCCGCTCCTGAGGGCAGG - Intronic
1119494733 14:75069221-75069243 CTCCGCGCGCTCGGCTGCGCTGG - Intronic
1123047569 14:105526431-105526453 CCCCGCCCCCTCCGCAGCGCCGG - Intergenic
1124700770 15:31909994-31910016 CTCCACCCACTGAGCAGCCCAGG - Intergenic
1126406939 15:48331675-48331697 CCCCGGCCGCTGTCCAGCGCTGG + Exonic
1129503178 15:76059709-76059731 CTCCGCCCCCTGCCCAGCTCAGG + Intronic
1129710598 15:77818784-77818806 CTAGGCCCGCGGCGCCGCGCTGG - Intronic
1132660196 16:1057816-1057838 GGCCGCCCACTGCCCAGCGCCGG - Intergenic
1136585188 16:31180018-31180040 CTCCGCCCCCTTCGTAGGGCAGG - Intergenic
1136610319 16:31362036-31362058 CTCCGGCCTCTGCTCAGCCCTGG + Intronic
1138190853 16:55012893-55012915 CTCAGCCTGGTGCGCAGCTCTGG - Intergenic
1141830945 16:86509850-86509872 CTCCGCCCGCGGTTCAGCCCCGG - Intergenic
1141891640 16:86930259-86930281 CTCCACCCTCTGGGGAGCGCTGG - Intergenic
1142288054 16:89179485-89179507 CTCCGCACGCGGCTCAGGGCAGG - Exonic
1147900280 17:43779044-43779066 CTCCGGGAGCTGCGGAGCGCGGG + Intergenic
1148744476 17:49910640-49910662 GTTCCCACGCTGCGCAGCGCTGG + Intergenic
1151683602 17:75634434-75634456 CTCCGCCTGCTGTGCAGCAGAGG + Intronic
1151938826 17:77280745-77280767 CTGCGCACGGTGCCCAGCGCAGG + Intronic
1152245803 17:79183978-79184000 CTCCGGCCGCTGCGGAGAGGAGG + Intronic
1157260720 18:46173886-46173908 CTCCTCCCGCTGCAGACCGCGGG - Intronic
1160025043 18:75209567-75209589 CGCCGGCCGCCGCGCAGCTCCGG - Intergenic
1160025378 18:75211629-75211651 CTCCGCCCGCAGCCCGGCGCCGG + Intronic
1160256129 18:77250236-77250258 CTCCGCCCGCTGCGCGACCACGG - Intergenic
1160763712 19:797985-798007 CTCTGCCCCCGGCGCAGCCCCGG + Intronic
1160970809 19:1766982-1767004 CTCCCCCCGCAGCGGAGCCCGGG - Intronic
1162799447 19:13102812-13102834 CTCCGGCCGCTGCGCCGCCAGGG - Exonic
1163834273 19:19563582-19563604 CCCTTCCCGCTGCCCAGCGCTGG - Exonic
1164498709 19:28793682-28793704 CTTCCCACGCTGCGGAGCGCGGG - Intergenic
1165089174 19:33373743-33373765 CTCCGCCCGTTCCGCAGCCGCGG - Exonic
1165445745 19:35856141-35856163 CTCGGCCAGCTGCGCAGCGTGGG + Intronic
1165757962 19:38305050-38305072 CCCTGCCCCCTGCCCAGCGCTGG + Intergenic
1165774363 19:38396001-38396023 CGCCGCGCGCTGGGCCGCGCTGG + Exonic
1166111493 19:40625981-40626003 CTGCGCCCTCTGCCCTGCGCAGG + Exonic
1166471693 19:43083913-43083935 CCCTGCCCGCTGCACCGCGCGGG - Intronic
1167612547 19:50514390-50514412 CTAGCCCCGCTGCGCAGCACGGG + Intronic
1168254151 19:55156955-55156977 CCCCGCCCCCTTCGCAGCCCTGG + Intronic
1168323589 19:55525634-55525656 CTCCTCCCGCTGAGCACGGCAGG + Intergenic
933049967 2:77590802-77590824 CTCCCCCTGCTCCACAGCGCTGG + Intronic
935237574 2:101151388-101151410 CTGCGCCTGCTGCGCTCCGCGGG - Intronic
937915631 2:127097448-127097470 CTCCACCTGCTGCACAGCCCAGG - Intronic
938414556 2:131093430-131093452 CTCCGGTGGCTGCGCAGCGTCGG - Intronic
939629399 2:144515906-144515928 CTCCCCGCGCCGCGCAGCTCTGG + Intronic
939990638 2:148875112-148875134 CTCCGAGCGCTGCGCATCCCGGG - Intergenic
943589888 2:189784346-189784368 TTCCGCAAGCTGCGCAGCGCCGG - Intronic
1169673789 20:8132468-8132490 CTCTGCCTGCTGAGCGGCGCCGG + Intronic
1171415951 20:24980502-24980524 CTCTACACGCTGGGCAGCGCGGG + Intronic
1171533252 20:25865933-25865955 ATCCAGCCGCTGCGCAGCGGTGG - Intronic
1176100990 20:63364505-63364527 CTGCGCCCGCTGGAGAGCGCTGG + Intronic
1176566765 21:8392109-8392131 CCCCGCCGGCGGCGCGGCGCAGG - Intergenic
1178992511 21:37367336-37367358 CGCCGCCCTCTGCGCCGGGCCGG + Intronic
1180160998 21:45998681-45998703 CTCCCCTCGGTGCGCAGGGCAGG + Intronic
1181670696 22:24424318-24424340 CTCCGCACCCCGCGCCGCGCCGG - Intronic
1183585925 22:38752848-38752870 CTCCAGCCGCTGCACAGTGCAGG - Intronic
1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG + Intronic
949281459 3:2352413-2352435 CTGCGAGCGCTGCGCAGCCCTGG - Intronic
949982251 3:9509055-9509077 CGCTCCCAGCTGCGCAGCGCTGG + Intronic
950571304 3:13801660-13801682 CTGCTCCCGCTGCCCACCGCTGG - Intergenic
952744502 3:36764428-36764450 CGCCGGGCGCTGCGCGGCGCGGG - Intergenic
961670256 3:128523602-128523624 CACCCCCAGCTGGGCAGCGCAGG - Intergenic
968382316 4:107536-107558 CTCCGCCCGCCCCTCCGCGCTGG + Intergenic
968509704 4:990169-990191 CTGAGCCTGCTGCGCGGCGCCGG - Exonic
968605143 4:1531912-1531934 CTCCTCCTGCTGCCCAGGGCGGG - Intergenic
968834236 4:2951313-2951335 CCCAGCCCGCTGCCCAGGGCAGG - Intronic
968904550 4:3445345-3445367 CCCCGCCAGCCGCGCACCGCAGG - Exonic
969709926 4:8836911-8836933 CACCGCCCGTTTCCCAGCGCTGG - Intergenic
972670871 4:41213690-41213712 TTCCGCCCGGTGGGCAGCGCAGG + Intronic
973820546 4:54658393-54658415 CTCCGCCCCCCGCGCAACGTCGG - Intronic
985593567 5:777775-777797 CTCCGCCTGCTGCGGGGCTCAGG - Intergenic
985713907 5:1445410-1445432 CCCCTCCCGCTCCGCAGCGCTGG + Exonic
990410333 5:55535033-55535055 CCCCTCCCGCTGAGCAGCGCAGG + Intronic
991090774 5:62691803-62691825 CTCCGCTGGCTGGGCAGCCCAGG - Intergenic
998176313 5:139904224-139904246 ACCCGCCCCCAGCGCAGCGCGGG - Intronic
1002638331 5:180618986-180619008 CGCCGCCCGCGGCGCCCCGCAGG + Intronic
1002929649 6:1624428-1624450 CGCCGCCCGCTGCGGGGCCCCGG - Intronic
1004353616 6:14912477-14912499 CACCTCCCACTGCGCAGCCCAGG + Intergenic
1004614889 6:17280833-17280855 CTCCCCGCGCGGCGCGGCGCTGG - Intergenic
1006470144 6:34224058-34224080 CCCGGCCCGCCGCCCAGCGCAGG - Intergenic
1008458387 6:51738827-51738849 CTCCTCCCTCTGCTCAGGGCAGG + Intronic
1008760426 6:54846784-54846806 CCGCGCCCGCCGCACAGCGCCGG - Exonic
1012912905 6:105137238-105137260 CTCCGCCCGCCGGGGGGCGCGGG - Intergenic
1013514766 6:110875489-110875511 CGCCGCCCGCCGCCCAGCGCGGG - Intronic
1018628730 6:165804790-165804812 CTCCGCCCGCGGCCCGGCCCCGG - Intronic
1019293110 7:259985-260007 CGCCGGCCGCTGCGCTGCCCGGG + Exonic
1023378058 7:39577811-39577833 CTCCGCCTGCGGCCCAGTGCAGG + Intronic
1023418184 7:39950967-39950989 CTCCGCCTCCTGCCCGGCGCGGG - Exonic
1025608194 7:63054401-63054423 CTCCGGCGGCTGCGCCGCGGCGG - Intergenic
1028981326 7:96970797-96970819 CTCAGCCCTCTGTGCAGTGCTGG - Intergenic
1029206052 7:98869938-98869960 CTCCTCCGGGCGCGCAGCGCGGG + Intronic
1033390725 7:140924837-140924859 CTCCGCCCGCGGCGCCGCCCGGG - Intergenic
1034166460 7:149028538-149028560 CTCCGCCCCCTGCCAATCGCCGG - Exonic
1034446161 7:151115272-151115294 CCGCGCCCGCCGCGCAGCACTGG - Intronic
1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG + Exonic
1041689761 8:60678232-60678254 CGCCGCCGGCCGCGCAGCGTCGG + Intergenic
1042267709 8:66925643-66925665 CTCCGCCCCCTCCCCAGAGCCGG - Intergenic
1045489091 8:102655753-102655775 CCCCGCCCGCGGCGCGGGGCAGG - Exonic
1048572799 8:135669230-135669252 CCCCTCCCGCTGCGGATCGCGGG - Intergenic
1048968053 8:139628346-139628368 CTCGGCACGCTGTGCAGGGCAGG - Intronic
1049660008 8:143815677-143815699 GTCCGCCCGCTGTGCCGCACCGG + Intergenic
1058153567 9:101487099-101487121 CTCCTCCCGCCTCGCAGCTCAGG + Intronic
1058467627 9:105244883-105244905 CTCCGCCTCCTCCGCCGCGCAGG + Exonic
1061449225 9:130659680-130659702 CTCCGCCGGCAGCCCCGCGCAGG + Intergenic
1061749148 9:132763704-132763726 CTCCACCCACTTGGCAGCGCTGG + Intronic
1189308837 X:40006268-40006290 CTCCGCCAGCGGCGCGGAGCTGG - Intergenic
1189310044 X:40012499-40012521 CTCCCCGCGCCGCGCCGCGCCGG - Intergenic
1190326453 X:49209849-49209871 CCTCGCCCTCTGCCCAGCGCTGG + Intronic
1196645751 X:118116428-118116450 CGCCGCGCACCGCGCAGCGCCGG + Intronic
1200218506 X:154379274-154379296 CTGCGCGCGCTGCGCGGGGCGGG - Exonic