ID: 1094052227

View in Genome Browser
Species Human (GRCh38)
Location 12:26233207-26233229
Sequence TGAAATACCCTGTGAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094052227 Original CRISPR TGAAATACCCTGTGAATTAC TGG (reversed) Intronic
903447236 1:23430510-23430532 TGAAAGTCCCTGTGGATTCCAGG + Intronic
905073548 1:35248997-35249019 TGAAATTCCATATGAATTTCAGG + Intergenic
905158356 1:36008307-36008329 TGGAATACCTTGAGAATTATTGG + Intronic
905552445 1:38853970-38853992 TAAAATGCCCTGTGACTTGCAGG - Intronic
906266361 1:44433577-44433599 TGAAATAAACTGTGAACTGCAGG + Intronic
915057485 1:153148533-153148555 TGAAATACCCTATGTACTTCTGG + Intergenic
919072647 1:192775164-192775186 GAAAATATCCTGTGGATTACTGG + Intergenic
921212768 1:212914229-212914251 TCACATCCCCTGTGACTTACAGG + Intergenic
921713407 1:218395201-218395223 TGAAAGACCCTGGGCAATACTGG + Intronic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
1065112643 10:22454980-22455002 TGAAATAAACTGTGAGTTAGAGG - Intergenic
1068216186 10:53985316-53985338 TGAAGTACCCTGTGAACTTCTGG - Intronic
1069896814 10:71685152-71685174 TGAAATCCCCAGAGAATTCCAGG - Intronic
1071750772 10:88472869-88472891 TGAAATTCTCTGTTAATTATGGG + Intronic
1071867401 10:89750071-89750093 TGAAATAAAATGTAAATTACTGG + Intronic
1071930361 10:90462901-90462923 TGCAAGACCTTGTAAATTACAGG + Intergenic
1074785051 10:116831681-116831703 GGAAAGAACATGTGAATTACAGG - Intergenic
1080048601 11:27835760-27835782 TGGAATACCTTGGGAATTCCAGG + Intergenic
1086593289 11:88541708-88541730 AGAAATACCATGTAATTTACAGG + Intronic
1087116575 11:94531582-94531604 TGAGATACCATGTGAATTGTAGG - Intergenic
1088491355 11:110391230-110391252 AGAAATCCCCTGTCAAATACTGG + Intergenic
1089123089 11:116154574-116154596 CTAAATAACCTGTGAGTTACAGG + Intergenic
1090867277 11:130712229-130712251 TGAAATACAGAGTGAATTAAAGG - Intronic
1091480153 12:820052-820074 TGAAATTCCATGTGAATTTGAGG + Intronic
1093093629 12:14948066-14948088 TCAAATACTCTGTGAATTGAGGG - Intronic
1093100621 12:15024370-15024392 TGAAATAACCTGTTAATACCTGG - Intergenic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1097249015 12:57622145-57622167 GGAGATGCACTGTGAATTACAGG - Intronic
1098003410 12:65969356-65969378 TAAAATACCCTGCGAATTGTTGG + Intergenic
1098380840 12:69867982-69868004 TAAAATACCCTGTTATTTAGAGG + Intronic
1099021431 12:77409482-77409504 TGGAATTACCTGTGAATTATGGG + Intergenic
1099541883 12:83920868-83920890 TAAATTACCCTTTGAATTTCTGG + Intergenic
1100400983 12:94229379-94229401 TTAAAAACTCTGTGTATTACAGG - Intronic
1107103318 13:36617543-36617565 TGAGATACCCTGTAATTTACTGG - Intergenic
1108731003 13:53235770-53235792 TAATATACACTGTGATTTACAGG - Intergenic
1109422696 13:62134239-62134261 TTTTATACCCTGTGAATTTCAGG - Intergenic
1110401241 13:75094363-75094385 TGAAATACTCTTAGGATTACCGG + Intergenic
1112455745 13:99561077-99561099 TGAAATACACTATAAGTTACTGG - Intronic
1113480798 13:110619129-110619151 TGAAATAACCTATACATTACCGG - Intronic
1113626732 13:111853305-111853327 TGGAATTGCCTGTGAATTGCTGG - Intergenic
1113868159 13:113542745-113542767 TGAGATGCCCTGTGCTTTACAGG + Intronic
1114223024 14:20713983-20714005 TGAGAACCCCTGTGAATTTCTGG - Intergenic
1115513553 14:34162270-34162292 TGAAATTACCTTTGATTTACAGG + Intronic
1118237344 14:64020072-64020094 TGAAATACCTCTTGAATTGCAGG + Exonic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1120554965 14:85918493-85918515 TGAAATATCTTGAGAAGTACAGG + Intergenic
1120768276 14:88351889-88351911 TGAAATACCCTGAAAACAACTGG + Intergenic
1128807152 15:70539581-70539603 CAAAATGCCCTGTGAATTGCAGG - Intergenic
1129650774 15:77486858-77486880 TGAGATACCCTGATAGTTACTGG - Intergenic
1132791813 16:1694489-1694511 TGAAATTCCATATGAATTATAGG - Intronic
1138256201 16:55564346-55564368 TGAAATTCCCTATGAATTTTAGG - Intronic
1139084956 16:63573457-63573479 TTAAATAACCTGTGCATTTCAGG - Intergenic
1139172079 16:64643685-64643707 TGAAATAACTTTGGAATTACAGG + Intergenic
1141295556 16:82765214-82765236 TGAAATTCACTGTGAATCAGAGG - Intronic
1143724089 17:8833388-8833410 CAAAATTCCCTGTGAATTCCTGG - Intronic
1144377502 17:14658993-14659015 TGAAATAAAATGAGAATTACAGG + Intergenic
1148803842 17:50253532-50253554 TGAAATATTCTGAGAATTACCGG + Intergenic
1155291115 18:24343475-24343497 TGAAATTCCATGTGAATTTTAGG - Intronic
1157988060 18:52462406-52462428 TGAAATAGGATGAGAATTACAGG - Intronic
1162270492 19:9610976-9610998 TGAGAAACTCTGTGAATTTCAGG - Exonic
1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG + Intergenic
1162886084 19:13698281-13698303 TGAAATAATCTGTAAATAACTGG + Intergenic
1163384920 19:16993711-16993733 TGCGATGCCCTGTGAATTTCAGG - Intronic
925120305 2:1413131-1413153 TTAAATACCCTGTGAAAAAGGGG - Intronic
925122190 2:1427908-1427930 TGAAACACTCTGGGCATTACTGG + Intronic
925890441 2:8429941-8429963 TTAAATTGCATGTGAATTACAGG + Intergenic
926469351 2:13234268-13234290 TGAAATATTCTGAGAATTTCTGG + Intergenic
927356933 2:22185496-22185518 TGAAATCCCGTGTGAATCATTGG + Intergenic
929676877 2:43943285-43943307 TAAAATACCCTGTGAAGAAAAGG + Intronic
931547506 2:63405965-63405987 TGCAATACACTGTCAAATACAGG - Intronic
933403789 2:81832048-81832070 TGAAATATTCTGTAAATTAGTGG + Intergenic
936667886 2:114618813-114618835 TCAAATACCCTGAGAATTCAAGG + Intronic
937838889 2:126504895-126504917 AGCAATTCCCAGTGAATTACTGG + Intergenic
939194297 2:138953665-138953687 TGAAAGACCCAGTGATTCACAGG - Intergenic
942327188 2:174785920-174785942 TGAAGGTCCCTGTGAATGACCGG + Intergenic
942933063 2:181519651-181519673 TGAAATGACCTATGAATTAATGG - Intronic
945200729 2:207278296-207278318 TGAAATCTCCTGGGAATCACAGG - Intergenic
947447503 2:230175486-230175508 TGAAATACCCTGAGAATCAGGGG - Intronic
948184387 2:236008537-236008559 TGAAATACCCAGTGGATTTGGGG + Intronic
948573835 2:238937109-238937131 GGAAATACCGTGGGAAATACAGG - Intergenic
1169616578 20:7454339-7454361 GGAATTACCTTGTGAGTTACAGG - Intergenic
1179341936 21:40519891-40519913 TAAAATACCCTGTTGATTATTGG + Intronic
1184623459 22:45701898-45701920 TTAAAAACCCTGTGAAATAGAGG + Intronic
1184638366 22:45854373-45854395 TGAAATAGCCCATGAAATACAGG + Intergenic
952177660 3:30883632-30883654 TGAAATGCCATGTGAATTTAAGG + Intronic
955129737 3:56153811-56153833 TTAAATACCGTGAGAATTACTGG + Intronic
955456617 3:59128664-59128686 AGAACAATCCTGTGAATTACTGG + Intergenic
956678475 3:71755688-71755710 CGAAATGCCCTCTGAATTGCCGG + Exonic
957115776 3:76023716-76023738 TGAAATATTGTGAGAATTACTGG + Intronic
958996064 3:100906758-100906780 TGAAATATTTTGTTAATTACTGG + Intronic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
961051364 3:123749903-123749925 TGAATTACACTCTGAATTCCTGG + Intronic
961991821 3:131200231-131200253 TGATTTACTCTATGAATTACAGG - Intronic
965107186 3:164371760-164371782 TTATATACTCTGTGAATTAACGG + Intergenic
969852768 4:9974385-9974407 TGAAATCCCCTGTCAGTTCCAGG - Intronic
970781488 4:19743352-19743374 TGAAATACTCTGGTCATTACTGG - Intergenic
971363321 4:25956213-25956235 TAAAATACCCTGTTAATAAATGG + Intergenic
972188294 4:36559343-36559365 TGAAATAGCTTGTGAATTCTAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975679716 4:76864689-76864711 TGAAAGAAGCTCTGAATTACAGG - Intergenic
975988631 4:80232868-80232890 CGAAATACCCTTTCACTTACAGG - Intergenic
977283151 4:95067799-95067821 TGAAATGCCCTGTGGATTTAAGG + Intronic
979749469 4:124260230-124260252 GGAACTACCCTGTGCATTGCAGG + Intergenic
980642689 4:135599986-135600008 TGAAAAACCTTGTGAATAAGTGG - Intergenic
982136196 4:152276451-152276473 GGAAATACCATGTGAATGACTGG - Intergenic
982367134 4:154591443-154591465 GGAAATACTCAGTGAATTATGGG + Intergenic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
989719284 5:44505048-44505070 TGAAATATCCTGTGAAATCTAGG - Intergenic
990009084 5:50974087-50974109 TGAAAAACCCTGTGAAGTAGAGG - Intergenic
990344459 5:54857698-54857720 TGAGAAACTCTGTGAATTTCAGG + Intergenic
992313660 5:75530137-75530159 GGAATTACCCTTTGGATTACTGG + Intronic
993880232 5:93352582-93352604 TCAAATCACCTGTGAATTACTGG + Intergenic
995319742 5:110820276-110820298 TGAAATATCATGTCATTTACAGG + Intergenic
999611895 5:153378731-153378753 TGGCCTACCCTGGGAATTACAGG - Intergenic
1002157946 5:177297641-177297663 TGAAATAAACTGTGAATTTGGGG + Exonic
1003663068 6:8082682-8082704 TGAAAAACTCTGTGAGTTTCTGG - Intronic
1005601929 6:27435138-27435160 TGAGATACCATGTGAATTTTAGG + Intergenic
1005811993 6:29524224-29524246 TTATATAGCCTGTGAATTTCAGG + Intergenic
1010266142 6:73870610-73870632 TGAAATTCACTGTGAAATATGGG + Intergenic
1015761785 6:136670053-136670075 TGAAATAAACTGTCAATTATAGG + Intronic
1017635937 6:156443141-156443163 TGAAATATTCTGAGAATTCCTGG - Intergenic
1020760210 7:12259715-12259737 TGAAATAGCCTTTCAACTACAGG + Intergenic
1021414598 7:20367801-20367823 TGAAATACACTGTGAAGGAAGGG - Intronic
1023637355 7:42225953-42225975 TCAATGACCCTGTGACTTACAGG + Intronic
1023685220 7:42726887-42726909 TAAAATACCTTGAGAATTTCTGG + Intergenic
1023761584 7:43469288-43469310 AGGAATACCCTGTGCCTTACGGG + Intronic
1024187496 7:46967154-46967176 TGAAATTCCATGTGAATTTTAGG - Intergenic
1029441478 7:100589403-100589425 AGAAATAAAGTGTGAATTACTGG - Intronic
1034533071 7:151708712-151708734 TCAAGTTCCCTGTGAATTGCTGG - Intronic
1037025536 8:14031435-14031457 TGAAAGACGCTGTGAATAACTGG - Intergenic
1037093417 8:14951709-14951731 TGAAATAACCTGTAAATTTGGGG - Intronic
1039755791 8:40520637-40520659 TGAAAAACCATGTGATATACAGG - Intergenic
1040636447 8:49279930-49279952 TGAAATAGCCTGACAACTACTGG + Intergenic
1043328015 8:79077588-79077610 TCAAATATCCTGAAAATTACTGG + Intergenic
1044116335 8:88340004-88340026 TGAGATACCGTCCGAATTACAGG + Intergenic
1047736833 8:127773056-127773078 TAAGATAGCCTGTAAATTACAGG - Intergenic
1047917513 8:129598416-129598438 TGAAATTCCATATGAATTTCTGG + Intergenic
1051144242 9:14009629-14009651 TGAAATGCACTGTGATTTGCTGG - Intergenic
1051280334 9:15436632-15436654 TGAAATTCCCTATGAATTTTAGG + Intronic
1051932026 9:22397518-22397540 TAAAAAACCATGTGAATTGCAGG + Intergenic
1055943101 9:81668881-81668903 TAAAATAACTTGTGAATTACAGG - Intronic
1057016209 9:91655237-91655259 CCAAATACTCTGTGAATTGCAGG + Intronic
1058426234 9:104877275-104877297 CACAATACCCTGTGAAGTACAGG + Intronic
1203416785 Un_KI270330v1:613-635 TGAAATGCCCTGTGAATGGAAGG - Intergenic
1186117007 X:6314801-6314823 TGCAATTCCATGTGAATTTCAGG + Intergenic
1188095034 X:26011164-26011186 TGAAAAACTATGTGAATTAATGG + Intergenic
1188099074 X:26060417-26060439 TGGAATAGCCTGAAAATTACAGG + Intergenic
1188904579 X:35776927-35776949 TTTAATAGCCTGTGAATTTCAGG + Intergenic
1189238881 X:39510137-39510159 TGAAAAAGCCTCTGAGTTACTGG + Intergenic
1189948106 X:46201173-46201195 TGAAATAACCTTAGACTTACAGG - Intergenic
1199749040 X:150797578-150797600 TGAAATTCCATGTGAATTTTAGG - Intronic
1200274274 X:154717280-154717302 TGAAAAACACTGTGACTTAGGGG - Intronic
1202280184 Y:23176476-23176498 TGACATACTCTGTCACTTACTGG - Intronic
1202280913 Y:23187321-23187343 TGACATACTCTGTCACTTACTGG - Intronic
1202436651 Y:24845586-24845608 TGACATACTCTGTCACTTACTGG + Intronic