ID: 1094054318

View in Genome Browser
Species Human (GRCh38)
Location 12:26253368-26253390
Sequence TTTCCTCACCAGGAGATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094054312_1094054318 2 Left 1094054312 12:26253343-26253365 CCTGAGTTCTAACCCCACCTCAT 0: 1
1: 0
2: 2
3: 13
4: 225
Right 1094054318 12:26253368-26253390 TTTCCTCACCAGGAGATCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1094054313_1094054318 -10 Left 1094054313 12:26253355-26253377 CCCCACCTCATCATTTCCTCACC 0: 1
1: 1
2: 1
3: 77
4: 864
Right 1094054318 12:26253368-26253390 TTTCCTCACCAGGAGATCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1094054311_1094054318 23 Left 1094054311 12:26253322-26253344 CCAGCTTTGAGGTCAAACACTCC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1094054318 12:26253368-26253390 TTTCCTCACCAGGAGATCTTAGG 0: 1
1: 0
2: 1
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094054318 Original CRISPR TTTCCTCACCAGGAGATCTT AGG Intronic
900214851 1:1475911-1475933 TTTCCTCCCGAGGGGACCTTTGG - Intronic
900222064 1:1514265-1514287 TTTCCTCCCGAGGGGACCTTTGG - Intronic
900955008 1:5881303-5881325 TTTTGTCACCAGGAGAACCTGGG - Intronic
904476066 1:30765281-30765303 TTTCCCCACCTGGAGTCCTTGGG - Intergenic
905258131 1:36698602-36698624 CTTCCTCACCTGGACACCTTAGG - Intergenic
906715106 1:47962840-47962862 TGTCCTCACCAAGAGCCCTTGGG - Intronic
907867030 1:58408268-58408290 TTTCATCACCTGAAGATCTGGGG - Intronic
912552947 1:110496246-110496268 TTCCCACCCCAGGAGAACTTAGG + Intergenic
914738692 1:150444452-150444474 TTACCTCATAAGGAGATCCTTGG + Intronic
916584369 1:166137595-166137617 TTTCCTCACCTGCAGATCAGAGG + Intronic
916664055 1:166949259-166949281 TTGCCTTTCCAGGAGATATTTGG - Intronic
918037282 1:180886704-180886726 TTTCCTCATCAAGAGAGCTTGGG + Exonic
919668688 1:200318706-200318728 TTTGCTCCCCAGGAGACATTAGG - Intergenic
921063446 1:211606180-211606202 TTTCCTCCCCAGGAGACCCCTGG + Intergenic
1067204076 10:44198840-44198862 GTTCCTCACCAAGAGATCCAGGG - Intergenic
1069877968 10:71574703-71574725 TTTCCTGACAAGGGCATCTTTGG + Intronic
1070253609 10:74795246-74795268 TTTCCTAAGAAGGAAATCTTTGG + Intergenic
1071266446 10:83968830-83968852 TTTGCTCACAAGCATATCTTTGG + Intergenic
1072867536 10:99079717-99079739 TTTTCTCACCAGGAAAAGTTTGG + Intronic
1074737139 10:116447109-116447131 TTTCCTCCCAAGGAGAACATGGG - Intronic
1074758825 10:116648861-116648883 TGTCCTCAACAGGACATTTTGGG - Intergenic
1075124467 10:119688585-119688607 TTTCCCCACCAGGGGACATTTGG - Intergenic
1075246555 10:120827475-120827497 ATTACTCACTAGGAGATGTTAGG + Intergenic
1075538041 10:123287681-123287703 TGGCCTCACCAGGAGGGCTTTGG + Intergenic
1075911209 10:126127161-126127183 CTTCCTCCCATGGAGATCTTTGG - Intronic
1076014843 10:127019374-127019396 TTTGATCATCAAGAGATCTTTGG + Intronic
1076490804 10:130860079-130860101 AGTCCTCTCCAGGAGAGCTTGGG + Intergenic
1076666523 10:132096061-132096083 TTTCCTCACCTGAAGAGCTGGGG + Intergenic
1078279769 11:9889627-9889649 TTTCCACACCTGGAGTGCTTAGG - Intronic
1078536719 11:12180847-12180869 TTTCTTCAACAGTTGATCTTGGG + Intronic
1079393395 11:20041285-20041307 CTTCCTCACTATGTGATCTTGGG + Intronic
1080686280 11:34517829-34517851 TTTCCTCATCAGTAAATTTTAGG - Intergenic
1080845697 11:36024865-36024887 TTTCCTCACCCTGACTTCTTAGG + Intronic
1083279931 11:61620670-61620692 ATTCCTCACCAGGACATCCCTGG - Intergenic
1083621277 11:64050530-64050552 TGTCCTCACCAGGTGACCCTTGG - Intronic
1087205071 11:95385974-95385996 CTTCATCACCAGGATATTTTTGG - Intergenic
1087732564 11:101795761-101795783 TTTCCTCACACTGAGAGCTTGGG - Intronic
1087923828 11:103896816-103896838 TTTTCTCCCCAGGGGATATTTGG + Intergenic
1088087015 11:105993559-105993581 TTTCATCATGAAGAGATCTTGGG + Intergenic
1088711751 11:112514537-112514559 TTTCATCACCACAAGATGTTAGG + Intergenic
1090566458 11:127997343-127997365 TTTTCTCACCTTGGGATCTTAGG + Intergenic
1091086616 11:132727435-132727457 TTTCCTCCCCAGGAGAGCCCTGG - Intronic
1093676456 12:21946034-21946056 TTCCCTCTCCTGGAGATCTATGG - Intergenic
1093941408 12:25059032-25059054 CTTGCTCACCAGGCAATCTTGGG - Intronic
1094054318 12:26253368-26253390 TTTCCTCACCAGGAGATCTTAGG + Intronic
1094303939 12:28996864-28996886 TTGCATCACCAGGAGGACTTCGG - Intergenic
1097762328 12:63482108-63482130 TTTCCTCATCAGGATATCTATGG - Intergenic
1098535736 12:71591919-71591941 TTTTCTCTCCAGGAGACCATGGG + Intergenic
1098721311 12:73902371-73902393 TTGCCTCACACGTAGATCTTGGG + Intergenic
1099288637 12:80747184-80747206 TTTACTCTCCAGGAGACATTTGG + Intergenic
1099487431 12:83245895-83245917 TTTGCTGTGCAGGAGATCTTTGG + Intergenic
1100246016 12:92757689-92757711 TTTACCCACCAGGTGAACTTGGG - Intronic
1101308272 12:103553221-103553243 TTTGCTCTCCAGGGGATATTTGG - Intergenic
1102201796 12:111062562-111062584 TTTCATCACCAGGGCATCTCCGG - Intronic
1102231302 12:111264243-111264265 TTTACTCAACAGCAGATTTTTGG - Intronic
1102715969 12:114972948-114972970 TGTCCTCATAAGAAGATCTTAGG + Intergenic
1109585539 13:64397540-64397562 GTTCCTCACCAGGATATTCTAGG + Intergenic
1111215704 13:85138581-85138603 TTTCCTAGCCAGGTGACCTTAGG + Intergenic
1112089423 13:96067411-96067433 TTTGCTTAGCAGGAGACCTTGGG - Intergenic
1112238626 13:97658815-97658837 TTTCCTCATCACAAGATATTGGG - Intergenic
1113359124 13:109612146-109612168 TGTCCTCACAAGAAGATATTAGG - Intergenic
1117336528 14:54760931-54760953 TTTCTGCACAGGGAGATCTTTGG - Intronic
1118445514 14:65847708-65847730 TTTCCTCTCCAGGAGATGTTGGG - Intergenic
1119591490 14:75892492-75892514 TTTCCCCCCCAGGAGACATTTGG + Intronic
1126981827 15:54253201-54253223 TTTCCTTACCATGAAGTCTTGGG + Intronic
1127553509 15:60064909-60064931 TTTGCTCCCCAGGAGATATTTGG - Intergenic
1127563268 15:60161662-60161684 TTTCCTCTCCAGGTTATTTTGGG - Intergenic
1128382974 15:67126878-67126900 TCTCCTCACCAGGAGGTCGTAGG - Intronic
1130824533 15:87530464-87530486 TTCCCAAACCAGGAGATCTCTGG - Intergenic
1131392103 15:92057992-92058014 TTTCCTCACCTGGGAATCTGGGG - Intronic
1132306805 15:100820862-100820884 TTTCCTTTCCAGGTTATCTTTGG + Intergenic
1134856867 16:17527339-17527361 TTTCCTCCACAGCAGCTCTTAGG + Intergenic
1135176074 16:20230452-20230474 TTTAGTCACCATGGGATCTTGGG + Intergenic
1138006423 16:53341958-53341980 TTTCCTGCCCAGGAGACATTTGG + Intergenic
1138905205 16:61323297-61323319 TTTCATCACCAGGAAAAATTAGG + Intergenic
1138976689 16:62216213-62216235 TTTCCTGAACTGCAGATCTTGGG - Intergenic
1140524807 16:75613760-75613782 TTTGCTCCCCAGGAGACTTTTGG - Intronic
1141742779 16:85905108-85905130 CTGCCCCACCAGGAGATATTTGG - Intronic
1141818298 16:86427862-86427884 TTTCCCAACCACGTGATCTTAGG - Intergenic
1144060648 17:11580959-11580981 ATTCCTCACCATGTGCTCTTGGG - Intergenic
1145754340 17:27380050-27380072 GTTCCTCACCGGGGGAGCTTCGG + Intergenic
1146427604 17:32757309-32757331 TTTGCTCACCAGGGGACATTTGG + Intronic
1149203211 17:54212662-54212684 TTTCTTCTCCACTAGATCTTAGG - Intergenic
1150779266 17:68106596-68106618 TTTCCTCTCCAGTAGATATGGGG + Intergenic
1151160695 17:72162944-72162966 TTGCCTCACAAGGAGGTCTGGGG - Intergenic
1151433494 17:74080441-74080463 TCTCCCCACCAGGAGATGCTTGG - Intergenic
1152874795 17:82780434-82780456 TTTCTCCACCAGGAGTTCATAGG - Intronic
1154127234 18:11702392-11702414 CTTCCTCACCAGGACAGCTGTGG - Intronic
1155352213 18:24917791-24917813 TTTGCTCTCCAGCAGATCTCAGG - Intergenic
1156933372 18:42672537-42672559 TTTCTTCCCCAGGAGCTCTGGGG - Intergenic
1157749144 18:50162576-50162598 TTGGCTCATCAGGACATCTTTGG + Intronic
1157808221 18:50674091-50674113 TTCTCTCACCAGCAAATCTTGGG - Intronic
1158444294 18:57505502-57505524 TTTTCTCAACAGGAAAGCTTTGG - Intergenic
1160108894 18:76006350-76006372 TTACCTCACCAGCAGAGCGTTGG + Intergenic
1166274638 19:41744323-41744345 TTTCCCAATCAGGAGATTTTTGG - Intronic
931173091 2:59825757-59825779 TTGCCTGACCAGGAGAATTTGGG - Intergenic
931195300 2:60047208-60047230 TGTCGTCACCAGGAGGTCTGGGG - Intergenic
932026612 2:68140136-68140158 TTTCCTCAGCAAGAGATACTTGG - Intronic
932764435 2:74461019-74461041 TTGCCTCACCAAGAGGCCTTAGG - Intergenic
936237684 2:110757868-110757890 TTTGCTGTCCAGGAGCTCTTTGG + Intronic
937120054 2:119434755-119434777 TTTCCTCACCAAGAGGGCATGGG + Intronic
937244001 2:120480628-120480650 TTTCCTGACCATGAGATTTGGGG - Intergenic
939333766 2:140798765-140798787 TTTGCTCACCAGGAGACATTTGG - Intronic
939634624 2:144566466-144566488 ATTCCTCACAAGTAGCTCTTTGG + Intergenic
940666692 2:156618211-156618233 ATTTCTCACCAAGAAATCTTAGG - Intergenic
941693760 2:168528818-168528840 TTTCCTCACCTTTAAATCTTAGG + Intronic
942019865 2:171856403-171856425 TTTGCTCACCAGGGTATATTTGG - Intronic
943568800 2:189547665-189547687 TTTCTTCAAAAGGACATCTTTGG + Intergenic
945185068 2:207132070-207132092 TTTCATGACCAGGAAATATTAGG + Intronic
945755391 2:213839472-213839494 TTTCCTTATCACAAGATCTTAGG + Intronic
947671545 2:231939662-231939684 TCTCCTCACCAGGGGATGGTGGG + Intergenic
1170104402 20:12737803-12737825 TGTCCTCACCAGTATGTCTTGGG + Intergenic
1173449380 20:43149174-43149196 TTTCTTCACAAAGGGATCTTGGG - Intronic
1173874079 20:46358753-46358775 TTTCCCCAGCAGCAGACCTTGGG - Exonic
1175010606 20:55730932-55730954 TTTCCTAAGAATGAGATCTTTGG + Intergenic
1175608143 20:60328328-60328350 TTTCTTCTCCATGAGATCTGAGG + Intergenic
1177596510 21:23250318-23250340 TTTGCTTTCCAGGTGATCTTAGG - Intergenic
1179357144 21:40671183-40671205 TTTCCTCACCACATGATTTTAGG + Intronic
1181395196 22:22616469-22616491 CTTCCTCCCCAGGCGACCTTGGG + Intergenic
1182864734 22:33593986-33594008 TTTCCTCGCCAGGAAATGGTAGG + Intronic
1183141008 22:35939145-35939167 TTTCCTTTCCAGTATATCTTAGG + Intronic
1184430494 22:44439347-44439369 TTTCCTCACCTGGAGAACTGGGG - Intergenic
949554055 3:5137185-5137207 TTACCTCACCATGAGCTCATGGG - Intronic
949636911 3:5992628-5992650 TTTGCTGACCAAGAGGTCTTAGG + Intergenic
950964438 3:17136544-17136566 TTTTCTGACCAGGAGGTCATGGG + Intergenic
952011758 3:28907890-28907912 TTTACCCTTCAGGAGATCTTAGG + Intergenic
953422138 3:42762395-42762417 TTTCTTCACCTGGGGACCTTGGG + Intronic
954635730 3:52069842-52069864 TATCCCCAACAGGAGATTTTGGG + Intergenic
955087938 3:55721091-55721113 TTTCCCCATCAGGAAATATTGGG - Intronic
955612196 3:60769395-60769417 TTTCCTTACCAGGAAATTTGAGG + Intronic
961287192 3:125815673-125815695 TCCCTTCACCAGGAGATCATGGG - Intergenic
962491001 3:135894059-135894081 TTTCCTATTCATGAGATCTTAGG + Intergenic
962748749 3:138417413-138417435 TTTCCTCACCATGTGGCCTTGGG + Intergenic
962906075 3:139804326-139804348 TTTCCTCACCAGAAGGACTGGGG + Intergenic
963328133 3:143884626-143884648 TGTGCTCCCCAGGAGATATTTGG - Intergenic
964753786 3:160076572-160076594 TTTCTTCACCATGACAACTTAGG - Intergenic
965075664 3:163972125-163972147 CTTTCTCAGCAGGAGGTCTTAGG - Intergenic
966280233 3:178217688-178217710 TTTCCTCTCCGGGAAATCTGTGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967703579 3:192622569-192622591 TTTACTAACTAGGAGAACTTAGG + Intronic
968678608 4:1900086-1900108 TTTGCTGACCAGGTCATCTTGGG + Intronic
969454255 4:7292115-7292137 TTTTCTCCCCAGGAGATCAGCGG - Intronic
971312678 4:25538997-25539019 TTTCCTCCCAAGATGATCTTAGG + Intergenic
971549138 4:27927471-27927493 ATGCATCACCAGGAGCTCTTTGG + Intergenic
971993013 4:33926008-33926030 ATTCCTCAACAGGGGATATTTGG + Intergenic
972011187 4:34184183-34184205 CTTCCTCTCCAGCAGAGCTTGGG - Intergenic
972151897 4:36102130-36102152 TTTCCACACAATGAGCTCTTAGG + Intronic
974739801 4:65992477-65992499 TTTTATCACCAGGACATCATGGG - Intergenic
975384237 4:73737095-73737117 TTTATTAATCAGGAGATCTTGGG - Intergenic
976096644 4:81515374-81515396 TTCCCTCACCAGGAAATATGTGG - Intronic
976493304 4:85697076-85697098 TTTCCTCACTAGCTGATCGTTGG - Intronic
976972835 4:91128632-91128654 TTTCCTCACTCCGAGCTCTTTGG - Intronic
978996095 4:115155099-115155121 TTTGCTTCCCAGGAGATATTTGG - Intergenic
979523083 4:121690449-121690471 TTTGGTAACTAGGAGATCTTTGG + Intronic
979833762 4:125334760-125334782 TTTCCTCACCAGTAGCTGTATGG + Intronic
982275455 4:153632721-153632743 TTTACTCACCTGGAGACCTGTGG + Exonic
987252500 5:16114209-16114231 TGTCAACACCAGGATATCTTTGG + Intronic
989712374 5:44415074-44415096 TGTCCTCACCAGGACCTATTAGG - Intergenic
990822601 5:59859401-59859423 TCTCCTGACAAGGAGTTCTTAGG + Intronic
991900491 5:71455466-71455488 TTTCTTCTCCAGGAGTCCTTAGG - Intergenic
991993929 5:72368717-72368739 TTTCCTCACCAGCTGCCCTTGGG + Intergenic
992058691 5:73020062-73020084 TTGCCTCTCCAGGAGCTTTTTGG - Intronic
992371107 5:76145105-76145127 TGCCCTCTCCAGGAGTTCTTGGG + Intronic
994343255 5:98656697-98656719 TTTCCTGAACAAGAGGTCTTTGG + Intergenic
994396294 5:99228182-99228204 TTTTCTCACCTGCAGATATTAGG + Intergenic
996458667 5:123715625-123715647 ATTAATCACCTGGAGATCTTGGG - Intergenic
996571804 5:124939873-124939895 TTTCCTCACAACAAGATCCTGGG + Intergenic
997397900 5:133579271-133579293 TATTCTTACCAGGAGATCTTGGG - Intronic
998419013 5:141966858-141966880 TTTCCTCACGAAGAGGTCTCTGG + Intronic
1000179900 5:158798767-158798789 TTTCCTCACCTGGTTATCTCTGG - Intronic
1001490415 5:172150885-172150907 CTTCCTCATCAGGAAGTCTTAGG + Intronic
1001877759 5:175216139-175216161 TTTCCTCACCTGGAGTGCTCAGG - Intergenic
1001953643 5:175833366-175833388 TTTCTTCACCACGAGTTCTCTGG - Intronic
1003123195 6:3334921-3334943 TTTCCACACCAGGGGCTCTCCGG + Intronic
1004355166 6:14924199-14924221 TTGCCCCACCAGGGGATGTTTGG + Intergenic
1006907359 6:37541836-37541858 CATCCTCACAAGGAGATCTCAGG + Intergenic
1010015928 6:71104960-71104982 TTCCCTCACCATGAGATATGGGG - Intergenic
1010888850 6:81279945-81279967 TTTCCTGACGTGGATATCTTAGG - Intergenic
1011327792 6:86169802-86169824 TTTCCTGAGCAGAAGCTCTTTGG + Intergenic
1011802804 6:91036828-91036850 TTTGCTCCCCAGAAGATCTCTGG + Intergenic
1012297844 6:97546911-97546933 TTTGCTCACTAGCATATCTTTGG + Intergenic
1013472694 6:110478718-110478740 ATTCCTCACCTGAAGAACTTAGG - Intergenic
1013505737 6:110798292-110798314 TTTCCTCTCCAGAATCTCTTAGG - Intronic
1014645935 6:123972793-123972815 TTTCCTCCTCTGGAGATCATGGG + Intronic
1014863991 6:126505798-126505820 TTTCCCCACCCTGGGATCTTAGG - Intergenic
1014935875 6:127384051-127384073 TTGCCTCACCAGTATATATTTGG + Intergenic
1015008234 6:128310785-128310807 TTTATTCTCCAGGAGATCTTGGG + Intronic
1016656520 6:146524604-146524626 TTTACCCCCCAGGAGATATTTGG + Intergenic
1018061735 6:160094931-160094953 TTGCCTCTCCAGGAGCTTTTTGG + Intronic
1018372023 6:163177280-163177302 CTTCATTACCAGAAGATCTTTGG - Intronic
1019972224 7:4550236-4550258 TTTCCTCACCAGGAGGAGTTTGG - Intergenic
1023521836 7:41057257-41057279 GTTCCTTAACAGGAGACCTTAGG - Intergenic
1030239421 7:107304725-107304747 TTTCCTAGACAGGAGGTCTTTGG - Intronic
1030584509 7:111400950-111400972 TTTCCTCACCAGAATATATTTGG - Intronic
1037357193 8:18033756-18033778 ATTCCTTACCAGGAAATATTTGG + Intergenic
1037459657 8:19096140-19096162 TTTCCTGAGCGGGTGATCTTAGG + Intergenic
1037629143 8:20637202-20637224 TTTCCTAACTATGTGATCTTGGG - Intergenic
1038984816 8:32797049-32797071 TTTCCTCACTCAGAGTTCTTAGG + Intergenic
1042046674 8:64660774-64660796 TAGCCTCACCAGGAGACATTTGG + Intronic
1043296064 8:78665500-78665522 TTTCCTCACCATGAAAGCTTGGG - Intergenic
1046257113 8:111715153-111715175 ATTCCTCCCCAGGAGTCCTTTGG + Intergenic
1046949256 8:120004046-120004068 TTTCCTCATCATCAGATCTTGGG + Intronic
1047741897 8:127813335-127813357 TTTCCTCTCCATGGGATCCTGGG - Intergenic
1048024665 8:130575015-130575037 TTTCCTGAGCAGGAGATTATTGG - Intergenic
1048108973 8:131445289-131445311 AATCCTCACCATCAGATCTTTGG + Intergenic
1050471468 9:5995613-5995635 TTTCCTAACTGGGAGATCTCTGG - Intronic
1055696053 9:78885482-78885504 TGTCCTAACAAGGAGATATTAGG - Intergenic
1055715749 9:79116061-79116083 TGTCCTCATCAGGACAGCTTAGG + Intergenic
1056098288 9:83276167-83276189 TTTCCCCTCCAGGAAATCTTGGG - Intronic
1056187247 9:84147500-84147522 TTTCCTTCCCAGGAGACCTTCGG + Intergenic
1056247538 9:84711170-84711192 TTTCATCACCCTGAGATCCTTGG - Intronic
1058107827 9:100993577-100993599 TTTCCTAGCCATGTGATCTTCGG - Intergenic
1058504126 9:105651911-105651933 TTTCCTCCCCAGGAGCTCGCAGG + Intergenic
1058540767 9:106010379-106010401 TTTACTCACTATGAGACCTTGGG + Intergenic
1059788692 9:117616241-117616263 TTTCCTCAACAGGATATCCTAGG - Intergenic
1060616397 9:125018690-125018712 TTTCCTCACAAGAGGATGTTAGG + Intronic
1060714259 9:125907838-125907860 TTTACTCACCATGTGATCTTGGG + Intronic
1061026731 9:128054666-128054688 TTTCCTCACTGGTTGATCTTTGG - Intergenic
1061090502 9:128423250-128423272 CTTCCTCACCAGGATATAGTCGG - Exonic
1188251019 X:27894334-27894356 TTTTATCCCCAGGAGATATTTGG - Intergenic
1188385026 X:29545978-29546000 TTTGCTCCCCAGGGGATATTTGG + Intronic
1188512898 X:30956043-30956065 TTTTCTCACCAAGAGATCTGAGG - Intronic
1189572778 X:42317012-42317034 TTTCCTCACTATGAGATATGGGG + Intergenic
1190639377 X:52467798-52467820 TGTCTTCACCTGAAGATCTTGGG - Intergenic
1193127425 X:77884737-77884759 TTTGCTCCCCAGGAGATATTTGG - Intronic
1195296468 X:103483038-103483060 TTGTCTCACCAGAAGGTCTTTGG + Intergenic
1199398118 X:147364797-147364819 TTTTCTCACCAAGAGGTCTGAGG + Intergenic
1199665654 X:150094558-150094580 TTTCCTATCCAAGAGATCTTGGG + Intergenic
1199744231 X:150761742-150761764 TTTTCTCACCTGGAGCTCTTTGG - Intronic
1200000751 X:153058672-153058694 TTTCCTCTCCAGCACCTCTTCGG - Intronic