ID: 1094054891

View in Genome Browser
Species Human (GRCh38)
Location 12:26258717-26258739
Sequence CAGTATTAGATCAATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 4, 2: 9, 3: 12, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094054887_1094054891 15 Left 1094054887 12:26258679-26258701 CCACACAATAATAGTGGGAGACT 0: 1257
1: 5149
2: 5372
3: 1946
4: 1256
Right 1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG 0: 1
1: 4
2: 9
3: 12
4: 116
1094054886_1094054891 16 Left 1094054886 12:26258678-26258700 CCCACACAATAATAGTGGGAGAC 0: 1186
1: 4987
2: 5079
3: 1872
4: 1067
Right 1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG 0: 1
1: 4
2: 9
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094054891 Original CRISPR CAGTATTAGATCAATGAGAC AGG Intronic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
905751225 1:40466230-40466252 CTGTATGAGATCACTGAGGCAGG - Intergenic
908625239 1:66032948-66032970 AAGAATTAGATAAATGAGGCCGG - Intronic
909141257 1:71868775-71868797 GAGTATTAGGTCAGTGAGAGAGG - Intronic
909141259 1:71868802-71868824 GAGTATTAGGTCAGTGAGAGAGG - Intronic
910836013 1:91511240-91511262 AACTAATAGATCAATGAGCCAGG - Intronic
912423301 1:109563099-109563121 CAAAATTAGAACACTGAGACTGG + Intronic
912967704 1:114250757-114250779 CATTATTAAATCAAAGAGAGAGG + Intergenic
915815981 1:158965314-158965336 CAGTATTAGATCGATCATTCAGG + Intronic
917362604 1:174193552-174193574 CAATATTAGTTTAAGGAGACAGG - Intronic
918755617 1:188337127-188337149 CAGTTTTTGATCACTCAGACAGG + Intergenic
918806533 1:189053899-189053921 CATAGTTAGATAAATGAGACTGG + Intergenic
919510520 1:198457754-198457776 CAGTATTTGATAAATGAAATAGG + Intergenic
921193996 1:212735216-212735238 CATTATTAGTTCAATGATATTGG - Intronic
922348825 1:224719029-224719051 CAGGATGAGTTCAATGAGCCTGG - Intronic
924094070 1:240533116-240533138 CATTATGAGATGTATGAGACAGG + Intronic
1067184270 10:44013894-44013916 GAGTATTAGTTCCAGGAGACAGG - Intergenic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1072208499 10:93225288-93225310 AAGCATTAAAACAATGAGACAGG + Intergenic
1072252835 10:93595342-93595364 CAGTTTTGGATCAATGTGAGAGG - Intronic
1072340410 10:94442625-94442647 CAGTACTAGATAAGTGAGAATGG + Intronic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1075298404 10:121298423-121298445 CAGTTTTAGAACAATGCGAGAGG + Intergenic
1081067927 11:38570657-38570679 AACTATTAGATCAAACAGACCGG + Intergenic
1083072292 11:59997776-59997798 CAGTATGAAAACTATGAGACAGG - Intergenic
1085911067 11:80827426-80827448 CAGTGTAACATCAATAAGACTGG + Intergenic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1089651119 11:119913786-119913808 CAGCAATAGATACATGAGACAGG + Intergenic
1091014477 11:132037881-132037903 CAGTTTAACAGCAATGAGACTGG - Intronic
1091514981 12:1170154-1170176 CACTATTACATGAATAAGACAGG - Intronic
1091529066 12:1337114-1337136 CAGTATTAGATCAAAGATTAAGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1096485607 12:51978858-51978880 CAGGATTGGATCAGAGAGACAGG + Intronic
1097119689 12:56721593-56721615 CAGGATTAGATAAAGGTGACAGG + Intronic
1099856914 12:88179732-88179754 CTGTATTAAATAAATGCGACCGG - Intronic
1101695532 12:107122269-107122291 AAGTATTAGTTGACTGAGACTGG + Intergenic
1101893480 12:108735846-108735868 TATTATTAAATAAATGAGACTGG + Intergenic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1104614718 12:130258173-130258195 CAGTGGTAGTTCACTGAGACAGG + Intergenic
1104614726 12:130258232-130258254 CAGTGGTAGTTCACTGAGACAGG + Intergenic
1104614734 12:130258291-130258313 CAGTGGTAGTTCACTGAGACAGG + Intergenic
1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG + Intergenic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1107712471 13:43163867-43163889 AAGTATTAGGGCAATGAGAAAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1111199883 13:84920814-84920836 CAGTATCACCTCAATGATACTGG - Intergenic
1113033333 13:106018687-106018709 CAGCATTCGATCACTGAGTCAGG - Intergenic
1114898566 14:27026341-27026363 CAGCATTATATCAAGGAGAGAGG - Intergenic
1117178154 14:53166095-53166117 GAGTATTAAATCCCTGAGACTGG + Intergenic
1117256350 14:53981766-53981788 CAATATTGAATCAATGAGACTGG - Intergenic
1117564362 14:56978156-56978178 CTGTATTACATGAATGAGTCTGG - Intergenic
1119981421 14:79086076-79086098 TAGTATTAGAATCATGAGACTGG - Intronic
1120710911 14:87792347-87792369 CAACACTAGAGCAATGAGACCGG + Intergenic
1121859702 14:97305641-97305663 GAGTATTTGATTAATGAGCCTGG - Intergenic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127317599 15:57812691-57812713 CAATATTAGATCAACCATACAGG - Intergenic
1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG + Intergenic
1133339805 16:5028805-5028827 CAATATTGGCTGAATGAGACAGG + Intronic
1138844135 16:60544716-60544738 CTGTATTAGAGCACTGACACTGG - Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG + Intergenic
1144794733 17:17883351-17883373 CATTATTAGAAGAATGAAACAGG + Intronic
1146502638 17:33377515-33377537 CAGTATAAGATGAATGCGATTGG - Intronic
1149828846 17:59853692-59853714 CAGTGTTATTTCTATGAGACAGG - Intergenic
1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1163215972 19:15877703-15877725 CAGAAGTAGATCACTGAGAAGGG - Intergenic
1163223549 19:15938867-15938889 CAGTTCTAAATCAATGAGAAAGG + Intergenic
1163317871 19:16553916-16553938 CAGAAAGAGAGCAATGAGACAGG + Intronic
931546850 2:63397839-63397861 CAGTATTATTTCAATGAGTTTGG + Intronic
936407488 2:112219831-112219853 CAGTATTAGATCGTTGAGGTAGG - Intronic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
936932206 2:117801668-117801690 CGATATTAGATTAATGAGAAGGG - Intergenic
937308673 2:120887862-120887884 CAGTGCTAGATCAATATGACAGG + Intronic
941349632 2:164415654-164415676 CAGTAGGAGTTCAATAAGACAGG + Intergenic
943007978 2:182409738-182409760 TTGAATGAGATCAATGAGACTGG - Intronic
945070397 2:205983327-205983349 CAGTATTGGTTCATTAAGACGGG + Intergenic
945548730 2:211191838-211191860 CAGATTGAGATCAGTGAGACAGG + Intergenic
945553111 2:211246064-211246086 CAGTAAGAGATGAATGAGACAGG - Intergenic
1169046340 20:2537090-2537112 CAGTATCAGACAAATGTGACAGG + Intronic
1169189751 20:3650754-3650776 CAGAATTAGTTCAACGAAACAGG - Exonic
1170156156 20:13271506-13271528 TAGTATTAGAAAAATGACACGGG - Intronic
1171223023 20:23418639-23418661 CATTAAAAGATCAATGAGGCTGG + Intronic
1181846470 22:25713396-25713418 TTATAATAGATCAATGAGACTGG + Intronic
949093265 3:54833-54855 CAGGATTAGGTCATAGAGACAGG + Intergenic
957033518 3:75270901-75270923 CAGGATTAGGTCATAGAGACAGG + Intergenic
959216221 3:103453782-103453804 AAGTAGTAGGTGAATGAGACTGG - Intergenic
959551806 3:107668467-107668489 CAGTATTATTTCTATGAGCCCGG + Intronic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
960875164 3:122288505-122288527 CAGGAATAGATCTCTGAGACAGG - Intergenic
961640967 3:128364647-128364669 CAGCAGTAGATGAATGAGGCTGG - Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
963966704 3:151380010-151380032 CACTATTAGATAAATAAGAGAGG - Intronic
972090447 4:35275102-35275124 CAGTATAAAAGCAAAGAGACAGG + Intergenic
973673456 4:53240231-53240253 GAGTCTTAGATCAATGAAATGGG - Intronic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
974303579 4:60102074-60102096 CAGTTTAAGAGCAATGAGAAAGG - Intergenic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
980620283 4:135292374-135292396 CAGTATTAGTTCCATGAGCATGG + Intergenic
981697240 4:147571298-147571320 AGGTATTAGATTAATGAGGCTGG - Intergenic
986415529 5:7524543-7524565 CTGTAGAAGATCAAAGAGACTGG - Intronic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
992953848 5:81888016-81888038 CAGGATCAGAGCAATGAGAACGG + Intergenic
996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG + Intergenic
999168643 5:149573639-149573661 GAACATTAGCTCAATGAGACAGG + Intronic
1001337144 5:170808488-170808510 CAGATTTAGATCAATGACAGAGG + Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1007273519 6:40656576-40656598 AAGTATTAGAACAATGGGAAAGG - Intergenic
1007586355 6:42992430-42992452 AACTATTAGATCAATTAGAAAGG - Intronic
1010426693 6:75735597-75735619 CTATCTTAGATCAATGAGGCAGG - Intergenic
1010522445 6:76855100-76855122 CAGTATTAGAGGGATCAGACAGG + Intergenic
1025779644 7:64589103-64589125 CACTAATAGATCACTGAGGCAGG - Intergenic
1027653127 7:80896375-80896397 CAGTAATAGAGAAATGAGAAAGG - Intronic
1027969202 7:85056842-85056864 CAGTATGACATCAATGAGGTGGG - Intronic
1027969471 7:85059991-85060013 CAGTATGACATCAATGAGGTGGG + Intronic
1032824137 7:135552691-135552713 CAATAATGGATCAATTAGACTGG + Intergenic
1033754921 7:144390397-144390419 CAGTATAAGACCACTGAGATTGG - Intergenic
1037056418 8:14447173-14447195 CAGTTTTTGTTCCATGAGACTGG - Intronic
1038614809 8:29083292-29083314 CAGTATTAAACAAATGAGTCTGG - Intronic
1038848630 8:31253062-31253084 CAGGATTATTTCAATGATACTGG + Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1047802569 8:128325264-128325286 CAGCATTAGATAAATGACAATGG - Intergenic
1047939284 8:129813273-129813295 CAGCATTAGATTATTGAGGCAGG - Intergenic
1050712403 9:8480485-8480507 CTGTATGAGAACAATGAGAAAGG + Intronic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1052633987 9:31076736-31076758 CTTTATTATATCATTGAGACTGG - Intergenic
1053903920 9:42822454-42822476 CACAATGAGATCAATGAGGCAGG + Intergenic
1054531067 9:66183060-66183082 CACAATGAGATCAATGAGGCAGG - Intergenic
1056405769 9:86273373-86273395 CAGTTCTAGAACAATGAGCCTGG + Intronic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1187653615 X:21442342-21442364 CTGAATCAGAACAATGAGACAGG + Intronic
1191055446 X:56235073-56235095 ATGTATTAGAACAATGAGAGTGG - Intronic
1191816603 X:65252691-65252713 CTGTATTAGATCAATGTAAATGG - Intergenic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1195990542 X:110677987-110678009 CTATATTAAATCAATGAGACGGG - Intronic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1199528224 X:148816561-148816583 CAGTATTAGAATAATGAGAATGG + Intronic
1200335356 X:155345423-155345445 CAGAAATAGACAAATGAGACTGG - Intergenic
1200351112 X:155495798-155495820 CAGAAATAGACAAATGAGACTGG + Intronic